PLK2 phosphorylates and inhibits enriched TAp73 in human osteosarcoma cells.

TAp73, a member of the p53 tumor suppressor family, can substitute for p53 function, especially in p53-null and p53-mutant cells. However, TAp73 enrichment and phosphorylation change its transcriptional activity. Previously, we found that the antitumor function of TAp73 was reactivated by dephosphorylation. Polo-like kinase 2 (PLK2) plays an important role in bone development. Using a biological information database and phosphorylation prediction software, we hypothesized that PLK2 phosphorylates TAp73 and inhibits TAp73 function in osteosarcomas. Actually,we determined that PLK2 physically binds to and phosphorylates TAp73 when TAp73 protein abundance is up-regulated by cisplatin. PLK2-phosphorylated TAp73 at residue Ser48 within the TA domain; phosphorylation of TAp73 was abolished by mutating this residue. Moreover, PLK2 inhibition combined with cisplatin treatment in osteosarcoma Saos2 cells up-regulated p21 and puma mRNA expression to a greater extent than cisplatin treatment alone. Inhibiting PLK2 in TAp73-enriched Saos2 cells resulted in inhibited cell proliferation, increased apoptosis, G1 phase arrest, and decreased cell invasion. However, these changes did not occur in TAp73 knockdown Saos2 cells. In conclusion, these findings reveal a novel PLK2 function in the phosphorylation of TAp73, which prevents TAp73 activity in osteosarcoma cells. Thereby, this research provides an insight into the clinical treatment of malignant tumors overexpressing TAp73.

Introduction

Osteosarcoma is the most common bone malignancy. It predominantly affects adolescents and young adults 1, and its treatment remains challenging 2.

The tumor suppressor protein p53 plays a very important role in tumor suppression. In more than half of human cancers, this protein is mutated or deleted through different mechanisms 3, 4. The TAp73 protein is a member of the p53 family. It has a similar structure to p53 and activates some p53 target genes 5. TAp73 plays varying roles under different conditions that have yet to be completely elucidated. In contrast with p53, TAp73 is rarely mutated and is frequently overexpressed in human tumors; 5 further, its functions can at least partially substitute for those of p53.

Since Llamazares et al. 6 first reported the polo‐like kinase (PLK) PLK2 in 1991, a total of five members of the PLK family have been reported: 7 PLK1, PLK2, PLK3, PLK4, and PLK5. The PLK family members are involved in the regulation of all cell cycle phases (G1, G2, S, and M). Although studies have shown that PLK1 plays a prosurvival role in human tumors 8, 9, the functions of PLK2 are complex and controversial 10, 11. In addition, an increasing number of studies have revealed a close interaction between the PLK and p53 families, especially in human cancers. In fact, PLK2 is a unique PLK protein that regulates skeletal development and mitosis 12. Some reports have suggested that PLK2 functions in osteosarcoma cells; 13, 14, 15 however, its associated effects and mechanisms remain to be determined.

The phosphokinase‐mediated reversible phosphorylation of proteins helps to coordinate a considerable number of principal cell processes, such as cell growth, proliferation, and apoptosis 16, 17, 18. In our study, we identified several phosphorylation sites on TAp73 using the PhosphoSite database www.phosphosite.org that appear to be associated with distinct functions (Fig. 1A).

Figure 1

Generation of the hypothesis. Details are provided in the Supplementary Materials section.

To theoretically determine whether PLK2 activates or inactivates TAp73, we used the online bioinformatics phosphorylation predictor Scansite 3.0 19 (http://scansite3.mit.edu) to predict the phosphorylation sites of TAp73 (Fig. 1B). In addition, we used the predictor GPS‐polo 1.0 to identify PLK‐binding sites 20 in this protein (Fig. 1C).

We have previously demonstrated that the acidophilic kinase casein kinase 2 (CK2) phosphorylates TAp73 and inhibits its tumor suppressor function 21. Further, PLK2 recognizes substrates that are similar to CK2 and catalyzes some substrates more efficiently than CK2 22, 23. In addition, Songyang et al. 24 have demonstrated that CK2 displays a consensus sequence that is identical to that of the PLK family, which includes PLK2. Thus, we speculated that PLK2 may exert a similar kinase activity and function on Tap73 as CK2.

Finally, integrating the site predictions with the kinase characteristics, DNA states, and face accessibility, we hypothesized that in osteosarcoma, PLK2 phosphorylates Ser48 of TAp73, which acts as a tumor suppressor to inhibit TAp73 function (Fig. 1D, details in Supplementary Information).

Materials and Methods

Cell lines

The human osteosarcoma cell lines Saos2 and MG63 were obtained from the ATCC. Stable TAp73 knockout Saos2 cells (i.e., Saos2 (TAp73‐KD)) were generated by transducing Saos2 cells with a pLKO.1‐puro lentiviral vector (Addgene) expressing shRNA (targeting the same sequence as siRNA‐TAp73), as described previously 25. Cells were cultured in McCoy's 5A or DMEM medium (Invitrogen, Carlsbad, CA, USA) supplemented with 10% fetal bovine serum (FBS). The medium was replaced with fresh medium as necessary, and cultures were maintained at 37°C in the presence of 5% CO2.

Transfection

According to the experiment performed, the appropriate expression vectors (20 μg of Flag‐pcDNA3‐TAp73, Flag‐pcDNA3‐TAp73S48A, or Flag‐pcDNA3‐PLK2 obtained from Dr. Zhi‐Min Yuan, Harvard University, USA) and small interfering RNA (200 pmol of siPLK2 or siTAp73, Dharmacon, Lafayette, CO, USA) were transfected into cells using Lipofectamine 2000 transfection reagent (Invitrogen) at 48 h before the experiments were performed, according to the manufacturer's recommendations and as described previously 26. Control siRNA (contr‐si) and empty pcDNA3 (Invitrogen) were used as controls. As described in our previous study 21, the TAp73 S48A mutant, in which Ser‐48 was substituted with Ala (GENEWIZ, Inc., NJ, USA), was confirmed by DNA sequencing.

Drug treatment

Cells were seeded at a density of 60–70% at 24 h before the treatments. The DNA damage reagents cisplatin (Qiru Corp., Ji'nan, China) and adriamycin (ADM, Sigma, St. Louis, MO, USA) were diluted to the indicated concentrations in cell culture medium. The PLK2 inhibitor ELN582646 27, 28 (Elan Pharmaceuticals, South San Francisco, CA), was diluted to 5 μg/mL in cell culture medium.

Real‐time reverse transcriptase PCR

Isolated RNA was subjected to reverse transcription and PCR, as described previously 15. The relative gene expression levels (2−ΔΔ Ct) were normalized to β‐actin mRNA, which was used as an internal control. Table 1 shows the primer and siRNA sequences.

Table 1

The siRNA and PCR primer sequence

	Gene	Sequence
Primer	PLK2	Forward, 5′‐ATCACCACCATTCGCACTCG‐3′
		Reverse, 5′‐AAATGGGGGCCTCCCTAGTA‐3′
	TAp73	Forward, 5′‐CCATCAAGGAGGAGTTCACGGA‐3′
		Reverse, 5′‐TCGGTGTTGGAGGGGATGACA‐3′
	p21	Forward, 5′‐AGCGACCTTCCTCATCCACC‐3′
		Reverse, 5′‐AAGACAACTACTCCCAGCCCCATA‐3′
	puma	Forward, 5′‐TCTCCTCTCGGTGCTCCTTCACT‐3′
		Reverse, 5′‐ACGTTTGGCTCATTTGCTCTTCA‐3′
	β‐actin	Forward, 5′‐ACGTGGACATCCGCAAAG‐3′
		Reverse, 5′‐GACTCGTCATACTCCTGCTTG‐3
siRNA	PLK2	Sequence (549–571): 5′‐UCUUUGUCAAUCUUUUCCCUUGGGAAAAGAUUGACAAAGAAA‐3′
	TAp73	Sequence (4927–4949): 5′‐AUUAAAGUGCUUUAACUGGUACCAGUUAAAGCACUUUAAUGC‐3′

Co‐immunoprecipitation (co‐IP), western blot (WB), and phos‐tag WB

Western blot 21 and co‐IP 29 were performed as described previously. Phosphorylated TAp73 was detected by phos‐tag WB. Immunocomplexed TAp73 was assessed to detect endogenous phosphorylated TAp73 using an anti‐TAp73 antibody after conducting a phos‐tag MT SDS‐PAGE assay (Wako Pure Chemical Industries, Ltd., Japan), as previously described 30. Additionally, as described previously 21, Flag‐PLK2 and Flag‐TAp73, or Flag‐TAp73 (S48A) was purified using anti‐Flag antibodies incubated in kinase buffer overnight, after which the samples were subjected to a TAp73 phos‐tag WB. The antibodies used are listed in the Supporting Materials section.

Metabolic labeling of PLK2 in Saos2 cells

To determine the half‐life of endogenous PLK2, pulse‐chase experiments were performed as previously described 31.

Indirect immunofluorescence microscopy

Indirect immunofluorescence experiments were performed as described previously 32. The antibodies used are listed in the Supporting Materials section.

Flow cytometry (FCM), cell wound‐healing assay, and apoptosis assay

FCM and cell wound‐healing assays were conducted as described previously 33, 34. A terminal deoxynucleotidyl transferase dUTP nick end‐labeling (TUNEL) kit (Roche, Mannheim, Germany) was used to assess apoptosis according to the manufacturer's instructions.

Cell counting Kit‐8 assay

Cell proliferation was assessed by measuring optical density (OD) using a Cell Counting Kit‐8 (Dojindo Laboratories, Kumomato, Japan), according to the manufacturer's recommendations 35. The first measurement was performed on day 0, 24 h after cells were seeded in the wells. Absorbance (450 nm) was recorded using a microplate reader (Molecular Devices VMax Kinetic Microplate Reader V Max, Sunnyvale, CA, USA).

Statistical analysis

Each sample was assayed in triplicate. Data are expressed as the mean ± standard deviation (SD). Differences between two groups were compared using the two‐tailed Student's t‐test or chi‐squared test. Differences between more than two groups were compared using one‐way analysis of variance (ANOVA) in conjunction with Dunnett's post‐hoc test, ANOVA for repeated measures or the chi‐squared test. Differences were considered significant when P < 0.05.

Results

PLK2 physically interacts with TAp73 in vitro and in vivo, and catalyzes TAp73 phosphorylation within TA1 residue S48 in response to cisplatin stimulation

To test our hypothesis, co‐IP experiments between endogenous PLK2 and TAp73 were conducted using Saos2 cells stimulated with three different concentrations of cisplatin to determine whether PLK2 and TAp73 physically bind to each other. Endogenous PLK2 was found to directly bind to endogenous TAp73 in a cisplatin dose‐dependent manner (Fig. 2A). Unexpectedly, negative co‐IP results were observed between PLK2 and TAp73, as the abundance of TAp73 was low in Saos2 cells under normal culture conditions.

Figure 2

PLK2 binds to TAp73 and phosphorylates it at Ser48. (A) Positive co‐immunoprecipitation results between PLK2 and TAp73 using the indicated concentrations of cisplatin in Saos2 cells. Under normal culture conditions, Saos2 cells express TAp73 at a very low level, and negative co‐IP results were observed between TAp73 and PLK2 without cisplatin stimulation. Similar results were observed when ADM was substituted for cisplatin. (B) Phosphorylation of endogenous TAp73 was not detected unless it was enriched. However, TAp73 phosphorylation was detected in cells treated with cisplatin with or without PLK2 inhibition, and it was increased with cisplatin treatment alone compared with the other treatments (P < 0.05). (C) After incubation of purified Flag‐PLK2 with purified Flag‐TAp73 or Flag‐TAp73 (S48A) for the indicated duration, in vitro phosphorylation of purified Flag‐TAp73 occurred. (D) Only nonphosphorylated proteins were observed in analysis of the TAp73 point mutant Flag‐TAp73 (S48A). (E, F) In MG63 cells, similar to Saos2 cells, PLK2 was also found to bind to and phosphorylate TAp73. Cis and ADM are abbreviations for cisplatin and adriamycin, respectively, in the figures.

Because PLK2 is a kinase, we investigated whether it phosphorylates TAp73. Endogenous TAp73 in Saos2 cells was stimulated using cisplatin (50 μg/mL), after which the cells were harvested and subjected to phos‐tag WB under different conditions. The phos‐tag WB results showed that the intensity of the phosphorylation bands differed depending on the amount of TAp73 protein present and that PLK2 inhibition reduced the amount of phosphorylated TAp73 (Fig. 2B). Because many kinases promote the phosphorylation of this protein, an in vitro phosphorylation assay was performed. Flag‐PLK2 and Flag‐TAp73 were purified and were then incubated together in kinase buffer for the indicated durations. These samples were then subjected to phos‐Tag WB, which revealed that ectopic TAp73 phosphorylation occurred in vitro and increased in a time‐dependent manner (Fig. 2C). However, when the purified mutant TAp73 (S48A) was subjected to phos‐Tag WB, the phosphorylation signal was nearly absent (Fig. 2D).

PLK2 binding to TAp73 was confirmed in Saos2 cells treated with ADM, and in another human osteosarcoma cell line, MG63, stimulated using cisplatin (Fig. 2A, E). An effect of PLK2 inhibition on endogenous TAp73 was also confirmed (Fig. 2F).

PLK2 regulates transcriptional activity of enriched TAp73

Previous experiments have revealed that PLK2 phosphorylates TAp73 when it is present at a high level. However, whether TAp73 transcription is inactivated remains to be determined. p21, a cell cycle inhibitor, and puma, a proapoptosis gene, are two of the main target genes of TAp73. The PCR results showed that p21 and puma mRNA expression was increased in response to PLK2 inhibition by siRNA or a PLK2 inhibitor in Saos2 cells treated with cisplatin (Fig. 3A–F). Moreover, the increase in p21 and puma expression was greater in the presence of PLK2 inhibition compared with treatment with cisplatin alone. However, the PLK2‐dependent increase in p21 and puma expression did not occur in Saos2 cells that were not treated with cisplatin. In addition, these increases in expression were not observed in cells pretreated with siTAp73 (Fig. 3E–H). Protein expression in these samples was also measured by WB (Fig. 4A, B). These findings suggest that PLK2 regulates TAp73 activity in the presence of TAp73‐activating stimuli. However, the mechanism underlying these changes is unclear; therefore, an immunofluorescence confocal microscopy experiment was performed. The results showed that PLK2 inhibited TAp73 translocation to the nucleus (Fig. 5).

Figure 3

PLK2 regulates TAp73 transcriptional activity. (A, B) In p53‐null Saos2 cells, TAp73 did not affect PLK2 mRNA expression and vice versa. However, PLK2 and TAp73 mRNA expression was significantly up‐regulated after treatment with 25 μg/mL cisplatin (P < 0.05). (C, D) In the absence of cisplatin, PLK2 inhibition did not result in increased p21 or puma mRNA expression (P < 0.05). (E, F) PLK2 and TAp73 expression was detected in Saos2 cells by RT‐PCR and WB. (G, H) In the presence of siTAp73, PLK2 inhibition did not cause an increase in p21 or puma mRNA expression (P < 0.05).

Figure 4

PLK2 and enriched TAp73 affect each other at the protein level. (A) In the presence of cisplatin or adriamycin, PLK2 did not affect TAp73 protein abundance. (B) In Saos2 cells in the absence of cisplatin, the p21 and puma protein levels did not increase after PLK2 inhibition (P < 0.05). (C) After cisplatin stimulation (50 μg/mL) for the indicated durations, the half‐life of the nascent PLK2 protein was approximately 20 min in Saos2 cells, whereas that of the PLK2 protein in Saos2 (TAp73‐KO) cells was approximately 15 min.

Figure 5

PLK2 inhibits TAp73 translocation to the nucleus. The upper row shows Saos2 cells treated with cisplatin (50 μg/mL). PLK2 (red) and TAp73 (green) signals are almost uniform in the cytoplasm and are punctuate in the nucleus. The bottom row shows that the TAp73 (green) signal appears more intense within the nucleus when PLK2 is knocked down by siRNA, suggesting that PLK2 inhibits TAp73 translocation to the nucleus.

TAp73 extends the PLK2 half‐life, and PLK2 and TAp73 interact with each other at the posttranslational level

Whether TAp73 directly induces PLK2 transcription remains unknown. Compared with parental cells, PLK2 mRNA expression was not increased when TAp73 was overexpressed or knocked down by siRNA (Fig. 3C) and vice versa (Fig. 3D), indicating that TAp73 did not directly regulate PLK2 gene expression. Moreover, PLK2 expression did not affect TAp73 mRNA expression. Thus, PLK2 and TAp73 do not directly interact with each other at the transcriptional or translational level. Therefore, we assessed whether TAp73 directly affects PLK2 at the posttranslational level. The co‐IP results showed that PLK2 physically bound to TAp73; thus, we analyzed the nascent PLK2 protein by autoradiography, which revealed that its half‐life in Saos2 cells was prolonged compared with that in Saos2 (TAp73‐KD) cells after cisplatin stimulation (Fig. 4C). Therefore, these findings suggest that PLK2 and TAp73 interact with each other at the posttranslational level.

PLK2 inhibition blocks cells in G1 phase and increases apoptosis in the presence of enriched TAp73, but not in the presence of a low level of TAp73

Because PLK2 is associated with the cell cycle G1/S transition and because the combination of PLK2 knockdown and cisplatin treatment in Saos2 cells increases p21 and puma expression, which play roles in cell cycle arrest and apoptosis, we determined the physiological effects of PLK2 manipulation by performing FCM and apoptosis assays to examine the effects of PLK2 inhibition on cells.

An increase in the proportion of cells arrested in the G1 phase was observed (Fig. 6). Furthermore, an apoptotic peak appeared in Saos2 cells treated with cisplatin in the presence or absence of PLK2 inhibition in contrast with untreated cells. Notably, PLK2 inhibition alone reduced the proportion of Saos2 cells in the G1 phase. These results suggest that PLK2 regulates G1 cell cycle progression in a TAp73‐dependent manner when TAp73 is enriched, as well as through other mechanisms when this protein is present at a low level.

Figure 6

Enriched TAp73 affects PLK2 by regulating cell cycle G1 progression. Compared with Saos2 cells under normal culture conditions (A, B siRNA control), PLK2 inhibition alone by siRNA (C) or a PLK2 inhibitor (D) decreased the proportion of cells in the G1 phase (P < 0.05), which was more evident with siRNA knockdown of PLK2. PLK2 inhibition in the presence of 25 μg/mL cisplatin significantly increased the proportion of cells in the G1 phase (F, G), and this proportion was greater than that with cisplatin stimulation alone (P < 0.05). An apoptotic peak appeared with cisplatin treatment (E, F, G).

To further characterize the apoptotic peak observed in cisplatin‐treated cells in which PLK2 was inhibited, we performed an apoptotic assay. The results of this analysis revealed a significant increase in the proportion of apoptotic Saos2 cells in the presence of cisplatin and PLK2 inhibition compared with cisplatin treatment alone or PLK2 inhibition alone (Fig. 7A). However, the proportion of apoptotic Saos2 (TAp73‐KD) cells did not increase when PLK2 was inhibited compared with treatment with cisplatin alone (Fig. 7B). Thus, PLK2 inhibition promoted cisplatin‐dependent cell cycle arrest and increased Saos2 cell apoptosis.

Figure 7

PLK2 inhibition sensitizes cells to cisplatin‐induced apoptosis through TAp73. (A) In Saos2 cells, the proportion of apoptotic cells increased significantly (P < 0.05), and this increase was greater than that with cisplatin alone (P < 0.05). However, the proportion of apoptotic cells did not increase following inhibition of PLK2 alone. (B) In TAp73 knockdown Saos2 cells, PLK2 inhibition did not affect the proportion of apoptotic cells in the presence or absence of cisplatin.

Knockdown of PLK2 inhibits osteosarcoma cell invasive ability and cell proliferation in the presence of enriched TAp73, but the opposite effects occur in the absence of TAp73 enrichment

Because cell cycle arrest and apoptosis affect cell survival, cell wound‐healing and cell proliferation assays were performed. In the cell wound‐healing assay, healing occurred in 3 days for Saos2 and Saos2 (TAp73‐KD) cells. In contrast, wound healing did not occur by the fifth day (data not shown) in cisplatin‐treated Saos2 cells or in PLK2 knockdown Saos2 cells treated with cisplatin, which also exhibited apoptosis (Fig. 8). The results of the proliferation experiments showed that PLK2 inhibition had a suppressive effect on the Saos2 cell growth in the presence of cisplatin, and this finding was not observed in Saos2 (TAp73‐KD) cells (Fig. 9). However, PLK2 inhibition alone resulted in an increase in cell proliferation in the absence of cisplatin. Consistent with the results of the FCM assay, these results suggest that PLK2 affects cell fate differently according to TAp73 abundance.

Figure 8

PLK2 inhibition affects cell invasion via TAp73. (A) Saos2 osteosarcoma cells subjected to PLK2 inhibition alone were completely healed by day 3, similar to the healing rate observed in parental cells. In contrast, stimulation with 15 μg/mL cisplatin with or without PLK2 siRNA knockdown did not result in healing within 3 days. Wounds healed efficiently in TAp73‐knockout Saos2 cells (B).

Figure 9

Whether PLK2 promotes or inhibits cell proliferation is dependent on TAp73. (A) Cisplatin (5 μg/mL) impaired the proliferation of Saos2 cells. Saos2 cell proliferation was accelerated by PLK2 inhibition alone (P < 0.05). Concomitant cisplatin treatment and PLK2 inhibition impaired cell proliferation to a greater extent than cisplatin treatment alone. (B) However, Saos2 (TAp73‐KD) cell proliferation was more obviously suppressed by cisplatin treatment alone.

Discussion

As a substitute for p53, TAp73 plays an antitumorigenic role under p53‐abnormal conditions. However, phosphorylation of TAp73 and variations in TAp73 abundance can result in tumor activity changes. Examination of the phosphorylation kinases of TAp73 is crucial in the assessment of its phosphorylation.

In this study, we have found that the DNA‐damaging drug cisplatin stimulates the up‐regulation of TAp73 in the osteosarcoma cell line Saos2. Moreover, PLK2 and TAp73 directly interact with each other, and PLK2 phosphorylates TAp73 in vivo and in vitro. Proteins, including TAp73, contain many functional domains 36, 37. Generally, different protein domains allow for chemical modifications that can subsequently alter the activities and functions of the protein. TAp73 contains the domains 37 TA1, DBD, OD, TA2, and SAM. Previous studies 38, 39, 40, 41, 42, 43, 44, 45, 46, 47 have indicated that phosphorylation of the TA1 domain often affects the transcriptional functions of TAp73, inhibiting its antitumor function (Fig. 1A). However, phosphorylation of other domains mainly results in an increase in this function. Thus, identification of the PLK2 phosphorylation site within TAp73 is important for predicting TAp73 function. In this study, in agreement with our predictions, we found that PLK2 phosphorylates Ser48, which is located within the TA1 domain. The PCR and WB results also demonstrated that PLK2 inhibition increased the activity of enriched TAp73. Previous studies 48 have shown that the TAp73 isoform ∆Np73, which lacks the TA domain, has the opposite function of TAp73. This mechanism may be consistent with the inhibitory effect of TA domain phosphorylation in TAp73.

Accumulating evidence strongly suggests a close correlation between PLK2 and TAp73. First, gene knockout experiments have shown that both the PLK2 12 and TAp73 genes 49, 50, 51 play critical roles in embryogenesis and skeletal development, as well as nervous system diseases, but not in tumor development. Second, both genes play significant roles in DNA damage responses in tumor cells 52, 53, 54. Third, both PLK2 and TAp73 are either up‐regulated or down‐regulated in tumors depending on the cellular context 55, 56, 57, 58. In this study, we found that PLK2 phosphorylates enriched TAp73, partially suppressing its transcriptional activity in osteosarcoma cells. However, these effects were not observed when TAp73 was present at a low level. TAp73 also stabilized PLK2 by prolonging its half‐life, which suggests that TAp73 potentiates PLK2 to regulate cell cycle progression in tumors. Moreover, following up‐regulation of endogenous TAp73, PLK2 inhibition resulted in up‐regulation of expression of the TAp73 target genes p21 and puma, inducing G1 phase arrest and apoptosis and impairing cell proliferation. However, cell cycle progression and cell proliferation were promoted when PLK2 inhibition occurred without enrichment of TAp73. These results suggest that PLK2 regulates the cell cycle and cell proliferation through distinct mechanisms in the presence of a low or high TAp73 level.

As mentioned above, whether PLK2 has negative or positive effects in osteosarcoma cells remains unknown. Previous studies have shown that deregulation of PLK2 results in a multinucleated phenotype 59, 60, aberrant cell morphology 31 and aberrant centrioles in U2OS cells 61, all of which are hallmarks of carcinogenesis. Most recently, Jie Li et al. 11 have demonstrated that the PLK2 is essential for the survival of aberrant cells, such as tumor cells. In addition, Mattew et al. have found that the silencing of PLK2 sensitizes tumor cells to the DNA‐damaging agents aphidicolin and paclitaxel 62. In addition, PLK2 activates PLK1 60, which subsequently abolishes the suppressive activity of p53 in p53 wild‐type cells 63, 64. p53 also directly regulates PLK2 expression as a target gene 65. Nevertheless, PLK2 promotes the oncogenic effects of mutant p53 in MG63 cells 14. The above studies demonstrate the tumor‐promoting role of PLK2. However, many other studies have indicated that it is a tumor suppressor 66, 67. In agreement with previous studies, PLK2 inhibition promoted cell cycle progression and cell proliferation in normal culture Saos2 cells, indicating its role as a suppressor. Further, its inhibition resulted in cell cycle arrest and suppression of cell proliferation when TAp73 was enriched by cisplatin, supporting its role as a tumor promoter.

Because TAp73 and PLK2 are involved in DNA damage responses 52, 53, 54 and PLK2 inhibition does not cause DNA damage 27, PLK2, a regulator of cell cycle, does not directly affect TAp73 expression in the absence of cisplatin treatment (Figs 3 and 4). In addition, under normal conditions, we found that the TAp73 level was low in Saos2 cells (Fig. 3F). The physiological effects of variations in the PLK2 level on TAp73 may be too weak to be detected. In contrast with our findings, studies have shown that PLK2 is a tumor suppressor that is silenced by hypermethylation in tumor cells 56, 59. Our research has demonstrated that PLK2 can play a tumor suppressor role through another mechanism that remains unknown. On the other hand, we found that PLK2 plays a role as a tumor promoter in human osteosarcoma cells based on the increased TAp73 observed following treatment with DNA‐damaging agents.

Clinically, a large number of malignant tumors that are p53‐negative or mutant, such as liver, 68 lung 69, esophageal, 70 rectal, 71 ovarian, 72 bladder, 73 and skin 74 tumors, exhibit wild‐type TAp73 overexpression. Therefore, a high TAp73 level is regarded as a poor prognostic marker for cancer patients. Paradoxically, TAp73 gene silencing by methylation has also been reported in a variety of malignant tumors 75, 76 and in bone marrow stromal stem cells 77, suggesting that its low abundance or deficiency may play a role in maintaining undifferentiated cell characteristics. An inverse correlation has been noted between the degree of cell differentiation and the degree of tumor malignancy. As mentioned above, unlike p53, which acts exclusively as a tumor suppressor, TAp73 also plays key roles in cell differentiation and development 55. Therefore, a low TAp73 level in malignant tumors is reasonable. Conversely, the correlation between a high TAp73 level and poor prognosis may not make intuitive sense; however, this relationship has been confirmed clinically. A possible explanation for this finding is that TAp73 expression in tumors becomes up‐regulated under certain conditions, but TAp73 activity remains inhibited. To further clarify this apparent paradox, researchers have used several methods to restore TAp73 function in tumors 69. In our study, we found that PLK2 inhibition restored enriched TAp73 functions in osteosarcoma cells, which provides insights into this issue.

In conclusion, our study demonstrates a novel mechanism of PLK2 in promoting tumor progression, whereby it directly binds to enriched TAp73, catalyzes Ser48 phosphorylation of TAp73, and inhibits TAp73 transcriptional activity (Fig. 10). PLK2 inhibition may effectively sensitize osteosarcomas to cisplatin treatment through the enrichment of TAp73. Our results may be used to guide antitumor treatments in patients whose tumors display TAp73 overexpression.

Figure 10

PLK2 regulates osteosarcoma cell fate in a TAp73‐dependent manner.

Conflicts of Interest

No potential conflicts of interest were disclosed.

Data S1. The process of prediction and hypothesis formation.

Data S2. Antibodies described in the article.

Click here for additional data file.

Data S3. Editorial certificate.

Click here for additional data file.