Commercialized non-Camellia tea: traditional function and molecular identification.

Non-Camellia tea is a part of the colorful Chinese tea culture, and is also widely used as beverage and medicine in folk for disease prevention and treatment. In this study, 37 samples were collected, including 33 kinds of non-Camellia teas and 4 kinds of teas (Camellia). Traditional functions of non-Camellia teas were investigated. Furthermore, non-Camellia teas of original plants were characterized and identified by molecular methods. Four candidate regions (rbcL, matK, ITS2, psbA-trnH) were amplified by polymerase chain reaction. In addition, DNA barcodes were used for the first time to discriminate the commercial non-Camellia tea and their adulterants, and to evaluate their safety. This study showed that BLASTN and the relevant phylogenetic tree are efficient tools for identification of the commercial non-Camellia tea and their adulterants. However, some sequences from original plants have not been found and there is a limitation of sequence number of original plants in GenBank. Submitting more original plant sequences to the GenBank will be helpful for evaluating the safety of non-Camellia teas.

Introduction

Tea (the leaves from Camellia plants) has been one of the most widely consumed non-alcoholic beverages in the world for thousands of years. It plays important roles in commerce, health, and culture. However, many other kinds of plants have been widely used as tea as well. These are not from Camellia (Theaceae), and are called non-Camellia tea, such as kuding tea, huangqin tea, laoying tea1, 2. More than 20 kinds of non-Camellia tea are reportedly used within the Chinese culture. Modern pharmacology studies have reported that non-Camellia tea may prevent and/or treat chronic metabolic diseases, by producing hypolipidemic, hypoglycemic, or hypotensive actions. Moreover, most kinds of non-Camellia tea have also been used as medicine for disease prevention and treatment in folklore4, 5, 6.

In recent years, with the increasing international demand for herbal medicines, non-Camellia tea has attracted increasing attention. However, original plants of non-Camellia tea are confused, and some adulterants have begun to appear in the market. Furthermore, fatalities and serious illnesses have occurred after drinking non-Camellia teas, caused by overdose, mislabeled products, or allergic reactions7, 8. For instance, kuding tea is suitable for high blood pressure, body fat or hot body, but not for the person whose body ‘slants cold’ in traditional Chinese medicine theory. According to this theory, a person whose body ‘slants cold’ will receive no improvement from ingestion of kuding tea and symptoms may appear or worsen, including abdominal pain, severe diarrhea and other symptoms. The significant differences in chemical components among different kinds of the original plants could account for such variations in responses. Finally, undefined compounds in some of these teas may be dangerous to health.

Identification of non-Camellia tea is difficult, partly due to a lack of unified standards. Traditionally, morphological features remain as the main basis of taxonomy. However, many of these commercial products are dried and processed, rendering the authentication by morphological methods very difficult. When morphological characteristics are absent, a DNA barcoding technique can identify and detect species utilizing one or a few DNA fragments. DNA barcoding technique is a supplement to traditional authentication method which has been able to solve some identification problems11, 12, 13. In this study, we randomly collected non-Camellia tea from the medicinal material market in China. Using DNA barcoding technique, the original plants from which the teas were derived were identified to (1) explore which DNA regions are better for the authentication of non-Camellia tea traditionally used by Chinese people and (2) evaluate their safety.

Materials and methods

Plant materials

We collected 37 commercialized tea samples, including 33 kinds of non-Camellia tea and 4 kinds of Camellia tea from 16 provinces (Yunnan, Sichuan, Guangxi, etc.) in China during 2012, and recorded the detailed information of these medicinal non-Camellia tea samples, including the local tea name, collecting location and time, and therapeutic effects (Table 1). All the samples were pressed and deposited at the Herbarium of the Institute of Medicinal Plant Development (IMPLAD).

Table 1

Summary of sample collecting location and time, original plants and traditional function of non-Camellia tea.

Local commodity name	Collecting location and time	Original plant	Use part	Traditional function	Reference
Non-Camelliatea
Baixue tea	Yunnan Province. May 2012	Thamnolia vermicularis (Ach.) Asahina	Leaves	Clearing away heat and remove toxic material, relieving cough, reducing sputum, anti-inflammatory.	14, 15
T. subuliforms (Ehrh.) W. Culb.
Big leaf kuding old tea	Guangxi Province June 2012	Ilex latifolia Thunb.	Leaves	Quenching thirst, improving eyesight, relieving restlessness, refreshing oneself, dissolving phlegm, increasing secretion of urine, relieving sore throat.	6, 16, 17
I. kaushue S. Y. Hu
Big leaf kuding tender tea	Guangxi Province June 2012	Ilex latifolia Thunb.	Leaves	Quenching thirst, improving eyesight, relieving restlessness, refreshing oneself, dissolving phlegm, increasing secretion of urine, relieving sore throat.	6, 16, 17
I. kaushue S. Y. Hu
Duosuike sweet tea	Sichuan Province May 2012	Lithocarpus litseifolius (Hance) Chun	Leaves	Reducing fever and causing diuresis, nourishing the liver and kidney, regulating the stomach to descend stomach-qi, moistening the lung to arrest cough.	18, 19, 20
Fengwei tea	Wenshan, Yunnan Province May 2012	Elsholtzia bodinieri Vant.	Leaves	Relieving exterior syndrome by dispersion, regulating flow of qi, harmonizing the stomach.	21
	E. heterophylla Diels
Gongju tea	Huangshan city, An׳hui Province July 2012	Chrysanthemum morifolium Ramat	Flowers	Expelling wind and clearing away heat, clearing liver-fire to treat eye disease, and eliminating toxic substances.	22
Guangxi sweet tea	Guangxi Province June 2012	Rubus suavissimus S. Lee	Leaves, and branch	Clearing away heat and removing toxic material, promoting the secretion of saliva or body fluid, moistening the lung, relieving a cough, relieving sore throat.	23, 24, 25
Hongxue tea	Yunnan Province May 2012	Lethariella cashmeriana Korw.	Leaves	Clearing heart-fire to regain consciousness, relieving pain, hyperlipidemia, anti-fatigue, anti-inflammatory.	14, 15, 26, 27
L. cladonioides (Nyl.) Krog;
L. sernanderi (Motyka) Obermayer;
L. zahlbruckneria (Dr.) Krog.
Huangqin tea	Inner Mongolia Autonomous Region September 2012	Scutellaria baicalensis Georgi;	Herbs	Heat-clearing and damp-drying drug, purging fire for removing toxin, anti-inflammatory, promoting digestion.	3, 28
S. scordifolia Fisch. ex Schrank;
S. amoena. C. H. Wright;
S. viscidula Bunge
Jiaogulan tea	Hunan Province July 2012	Gynostemma pentaphyllum (Thunb.) Makino	Leaves	Anti-fatigue, anti-hypoxia, enhancing immu-neity, hyperglycemic and hypolipidemic.	29, 30, 31
Kuqiao tea	Liangzhou, Sichuan Province May 2012	Fagopyrum tataricum (L.) Gaertn.	Seeds	Hyperglycemic, hypolipidemic, enhancing immunity, et al.	32
Laoying tea	Guangyuan, Sichuan Province May 2012	Litsea coreana Levl. Var. lanuginose	Leaves	Diabetes, expelling dampness, anti-diarrhea, stop burping, promoting digestion, et al.	33, 34, 35, 36
Actinodaphne cupularis (Hemsl.) Gemble
Liangwang tea	Yunnan Province May 2012	Nothopanax delavayi (Franch.) Harms ex Diels	Leaves, and flowers	Clearing away heat and removing toxic material, relaxing muscles and bones, promoting digestion, et al.	37
Luobuhongma tea	Xinjiang Uygur Autonomous Region July 2012	Apocynum venetum L.	Leaves, and flower	Hypotensive, anti-radiation, anti-aging, preventing bronchitis and cold.	38, 39, 40
Luobubaima tea	Xinjiang Uygur Autonomous Region July 2012	Apocynum hendersonii Hook.	Leaves, and flowers	Reducing fever and causing diuresis, flat liver resting to restore energy, hypotensive, hypolipidemic, anti-inflammatory, anti-anaphylaxis.	39, 41
Luohan tea	Guangxi Province June 2012	Engelhardtia roxburghiana. Wall.	Leaves	Clearing away heat and removing toxic material, engendering liquid and allaying thirst, relieving summer-heat, removing dampness.	42
Lvluohua tea	Tibet Autonomous Region July 2012	Epipremnum aureum (Linden & André) G. S. Bunting	Flowers	Hypoglycemic, anti-bacterial, anti-inflammatory, hypotensive.	43, 44
Mabiancao tea	Shanxi Province June 2012	Verbena officinalis L.	Herbs	Clearing away heat and removing toxic material, promoting blood circulation to induce menstrual, diuretic swelling, preventing attack of malaria.	45
Niubaiteng sweet tea	Guangxi Province June 2012	Hedyotis hedyotidea (DC.) Merr.	Stems, leaves	Clearing away heat, dispelling wind, eliminating dampness, detumescence detoxification, et al.	46, 47
Paraguay tea	Bei Jing August 2012	Ilex paraguariensis St. Hilaire.	Leaves	Curing dyspepsia, antiobesity effect.	48, 49, 50
Qingqianliu tea	Jiangxi Province August 2012	Cyclocarya paliurus (Batal.) Iljinsk.	Leaves	Engendering liquid and allaying thirst, clearing away heat and removing toxic material, enhancing physical strength, prolonging life.	51, 52, 53
Sishi tea	Wuyuan, Jiangxi Province August 2012	Scoparia dulcis L.	Herbs	Dispelling wind and relieving cough, clearing away heat, removing dampness by dieresis.	54
Shen tea	Yunnan Province May 2012	Clerodendranthus spicatus (Thunb.) C. Y. Wu ex H. W. Li	Leaves	Clearing heat and expelling damp, removal of stone and increasing secretion of urine.	55
Shiliang tea	Guangxi Province June 2012	Chimonanthus salicifolius S. Y. H;	Leaves	Dispelling wind to relieve exogenous syndrome, regulating qi-flowing for strengthening spleen, anti-diarrhea.	56, 57
C. Zhejiangensis M.C. Liu;
C. nitens Oliv.
Shiya tea	Guangxi Province June 2012	Adinandra nitida Merr. ex Li	Leaves	Engendering liquid and allaying thirst, anti-inflammatory, clearing away heat and removing toxic material.	58, 59, 60
Small leaf kuding tea	Sichuan Province. May 2012	Ligustrum robustum (Roxb.) Blume	Leaves	Cooling and refreshing antipyretic, dieresis.	6, 17, 61
Tianyeju tea	Yunnan Province May 2012	Stevia rebaudiana Bertoni	Leaves	Helping to produce saliva and slake thirst, hypotensive, hypoglycemic.	62
Vine tea	Zhangjiajie, Hunan Province June 2012	Ampelopsis grossedentata (Hand.-Mazz) W. T. Wang	Stems, leaves	Clearing away heat and removing toxic material, diminishing inflammation and relieving sore throat, hypotensive and hypolipidemic.	63, 64
Xiangsiteng tea	Guangxi Province June 2012	Abrus precatorius Linn.	Stems, leaves	Helping to produce saliva, moistening lung, clearing heat, induce diuresis diuresis.	65, 66
Xiangfeng tea	Hebei Province July 2012	Chimonanthus salicifolius S. Y. Hu	Leaves	Promoting digestion, treating liver-stomach disharmony, et al.	57
Yaowang tea	Xi׳an, Shangxi Province July 2012	Potentilla fruticosa L.	Leaves, flowers	Clearing away heat, invigorating the stomach, regulating the menstrual function.	67
P. glabra Lodd. var. mandshurica
Yeju tea	Zhejiang Province August 2012	Chrysanthemum indicum L.	Flowers	Clearing away heat and removing toxic material, dispersing wind and heat, dispersing blood stasis, improving eyesight, hypotensive, et al.	62
Zhegu tea	Wanning, Hainan Province. August 2012	Mallotus oblongifolius (Miq.) Muell. Arg	Leaves	Neutralizing the greasy, promoting digestion, eliminating summer-heat, prevention and treatment of common cold.	68
Traditional tea
Black tea	Fujian Province March 2012	Camellia sinensis	Leaves	Strengthening tendons and bones, anti-fatigue, preventing cold.	69
Green tea	Chongqing Province June 2012	Camellia sinensis	Leaves	Refreshing oneself, resolving phlegm, promoting digestion, inducing diuresis, detoxify.	6
Tieguanyin tea	Fujian Province March 2012	Camellia sinensis	Leaves	Exciting the brain, inducing diuresis strong heart, anti-aging, anticancer and detoxification.	70
Xihulongjing tea	Hangzhou, Zhejiang Province August 2012	Camellia sinensis	Leaves	Refreshing oneself, resolving phlegm, promoting digestion, inducing diuresis, detoxify.	6

DNA barcoding

Four candidate barcodes (rbcL, matK, psbA-trnH and ITS2) were selected based on previous barcoding studies71, 72, 73. We isolated the total genomic DNA from approximately 100 mg of dried powder from each sample using the cetyl trimethylammonium bromide method. Extracted DNA was stored in sterile microcentrifuge tubes at −20 °C.

The selected regions were amplified by polymerase chain reaction (PCR) on a PCR system 9700 thermocycler (Gene Co., USA). DNA was amplified in 20 µL of reaction mixtures containing 1 U ExTaq polymerase with 10× ExTaq buffer (100 mmol/L pH 8.3 Tris–HCl, 500 mmol/L of KCl) (Takara, China), 1.25 mmol/L of deoxyribonucleotide triphosphate, 0.05 mmol/L of each primer, and 20 ng of template DNA. Primers and reaction conditions used in the present study were listed in Table 2. The amplified products were sequenced in forward directions with the primers used for amplification in the Beijing Genomics Institute (China). Sequences were assembled and aligned using Bioedit Sequence Alignment editor version 7.0.9.

Table 2

Primers and reaction conditions used in the present study.

Gene name	Name of primer and primer sequence 5′-3′	PCR reaction condition
rbcL	724R: TCGCATGTACCTGCAGTAGC	95 °C 5 min
	1F: ATGTCACCACAAACAGAAAC	94 °C 30 s, 56 °C 30 s, 72 °C 100 s, 35 cycles
		72 °C 7 min
matK	3F: CGTACAGTACTTTTGTGTTTACGAG	95 °C 5 min
	1R: ACCCAGTCCATCTGGAAATCTTGGTTC	95 °C 30 s, 52 °C 30 s, 72 °C 100 s, 32 cycles
		72 °C 7 min
psbA-trnH	trnH: CGCGCATGGTGGATTCACAATCC	94 °C 4 min
	psbA: GTTATGCATGAACGTAATGCTC	94 °C 30 s, 58 °C 45 s, 72 °C 100 s, 32 cycles
		72 °C 7 min
ITS2	ITS2F: ATGCGATACTTGGTGTGAAT	95 °C 5 min
	ITS2R: GACGCTTCTCCAGACTACAAT	95 °C 30 s, 56 °C 30 s, 72 °C 100 s, 35 cycles
		72 °C 7 min

BLASTN and phylogenetic analysis

BLASTN and the nearest distance method were used to identify obtained relative accurate identification of species. First, the measured DNA sequences from non-Camellia tea were determined using BLASTN against the NCBI databases to identify the original plants of non-Camellia tea with similarity over 95%. To optimize correct identifications, DNA sequences of four candidate regions (rbcL, matK, ITS2, psbA-trnH) from non-Camellia tea were determined from the best reciprocal hits. In most cases this corresponded to the sequence with the highest BLAST score. Second, in order to find a suitable reference sequence, all of rbcL, matK, psbA-trnH, and ITS2 were extracted from the National Center for Biotechnology Information (NCBI) database according to the names of origin plant of the non-Camellia tea. After cluster and phylogenetic analysis, individual sequences were eliminated because of their ambiguous nucleotides shorter than 100 bp. Finally, the download sequences including 29 rbcL, 26 matK. 22 psbA-trnH, and 29 ITS2 (Table 3) combining with the sequences of commercial non-Camellia tea were used to construct phylogenetic trees by Mega 5.0 and Clustal X with a bootstrap value of 1000 replicates, respectively. Preliminary trees were reconciled by setting the bootstrap value greater than 50%, yielding a more credible consensus tree.

Table 3

The sequence information in GenBank.

Species	Genbank no.
rbcL	matK	psbA-trnH	ITS2
Abrus precatorius (1–2)	JN407285; JF738654	JN407125	JN406972	AF467015
Actinodaphne cupularis	–	–	–	HQ697213
Apocynum venetum	–	–	–	DQ449485
Ampelopsis grossedentata	JQ182479	JF953244;	JF437070	–
Camellia sinensis (1–2)	JN654337	AJ429305; JN654321	GQ487359	FJ004887
Chimonanthus nitens	–	–	–	AY786094
Chimonanthus Zhejiangensis	–	AY525341	–	AY786106
Chimonanthus salicifolius	HQ427177	HQ427325	HQ427018	AY786102
Chrysanthemum x morifolium	–	EU334382; HM989758	EF091621	EF091597
Chrysanthemum indicum	JF949971	–	JF949971	EF577298; JN315940
Clerodendranthus spicatus	GQ464985	FJ513161	FJ513103; GQ464982	HM595465
Cyclocarya paliurus (1–2)	AY263942; AY147094	AY147098	–	AF179583
Dasiphora fruticosa	–	AB458578	JN044379	–
Engelhardia roxburghiana	–	–	–	AF303801
Epipremnum aureum (1–2)	JQ734504; JN090003	JN090088	–	–
Fagopyrum tataricum	JN187117	JF829984	JQ807577	AB000339
Gynostemma pentaphyllum	AY968523	AY968451	EF621687	FJ980303
Hedyotis hedyotidea	HM752999	HM753079	HM640314; HM640334	HQ148756
Ilex aquifolium	–	JN896160	–	–
Ilex kaushue	JF942007	JF954101	JN044945	–
Ilex latifolia	JF942011	HQ427289	JN044949	AF200592; AY140215
Ilex paraguariensis	FJ394634	GQ248141	GQ248322	FJ394705
Lethariella cashmeriana	–	–	–	AF297743; DQ980014
Lethariella sernanderi	–	–	–	AF297744
Ligustrum robustum	JF942292	JF954385	JN045240	–
Litsea coreana	–	–	–	AF272286
Lithocarpus litseifolius	–	EF057121	–	EF057112
Mallotus oblongifolius	JF738963	–	–	–
Poacynum pictum	–	–	–	DQ451830
Potentilla fruticosa	PFU06818	–	AM114863	AF163478
Scutellaria amoena	HQ676585	JX981408	HQ680371	–
Scutellaria baicalensis	GQ374130	JX981417; HQ676586; FJ513169	HQ680366	JF421544; FJ609732
Scutellaria scordifolia	HM590110	HQ839713	FJ513143	FJ546875
Scutellaria viscidula	HQ676583	HQ676587	HQ680369	–
Scoparia dulcis	JQ593281	JQ588687; JQ588683	–	AY963776
Stevia rebaudiana	AY215182	AY215865	AY215611	AB457301
Thamnolia vermicularis	–	–	–	JQ409350
Verbena officinalis (1–3)	HM850444; JF950020; JN893754	HM850974	GQ435188; HE966861	GQ434586

–Species without the gene sequence in NCBI.

Results

Traditional uses

According to the literature (Table 1), original plants of 33 kinds of non-Camellia tea are distributed across 29 genera in 22 families. The most widely used plant portions are leaves (26), followed by flowers (7), herbs (3), stems (3), and the least used plant portions are seeds (1) and branches (1). The investigated non-Camellia teas have a variety of therapeutic applications (Table 1). The non-Camellia teas have been mainly used for three therapeutic effects: (I) heat-clearing tea (20), such as vine tea, qingqiangliu tea, yeju tea; (II) digestant tea (8), such as laoying tea, zhegu tea, liangwang tea; (III) health tea (9), such as jiaogulan tea, kuqiao tea, lvluohua tea.

DNA extraction, PCR, and sequencing success

All samples were extracted through CTAB method successfully. At the same time, the PCR success rates of rbcL, matK, psbA-trnH and ITS2 were 91.9% (34/37), 75.8% (28/37), 78.4% (29/37) and 100% (37/37), respectively. All the PCR products were sequenced successfully. In all sequences, rbcL sequence lengths ranged from 625 bp to 692 bp; matK sequence lengths ranged from 780 bp to 860 bp. psbA-trnH sequence lengths were from196 bp to 587 bp, and ITS2 sequence lengths were from 426 bp to 506 bp.

Species identification based on BLASTN

The rbcL, matK, psbA-trnH, and ITS2 sequences of the non-Camellia teas were also blasted against the NCBI database with maximum identity that are greater than 95% using an e-value below 0.0 to determine the difference between the original plants. The closest match in the database was recorded and DNA sequences of non-Camellia tea were determined from the reciprocal best hits.

Taking into account the uncertainties arising from incomplete databases, shared barcodes, ambiguous common names and sequencing without success, BLASTN analysis of the rbcL data showed 32 commercialized samples were assigned to species, one sample to genus, and one sample was not recorded in the GenBank (Table 3). But because rbcL identification ability is limited, only 11 commercialized samples matched with the original plants, including 7 kinds of non-Camellia teas and 4 kinds of traditional tea (Table 4).

Table 4

BLASTN identification result of non-Camellia tea.

No.	Commodity tea name	rbcL	matK	psbA-trnH	ITS2
BYC-1	Paraguay tea	Ilex sp.	Ilex aquifolium	Ilex paraguariensis#	Ilex paraguariensis#
BYC-2	Baixue tea	Ampelopsis brevipedunculata	Ampelopsis grossedentata	Ampelopsis grossedentata	Caprifoliaceae
BYC-3	Blank tea	Camellia sinensis#	Camellia sinensis#	Camellia cuspidata	Camellia sinensis#
BYC-4	Big leaf Kuding tender tea	Ilex kaushue#	Ilex aquifolium	Ilex pentagona	Ilex latifolia#
BYC-5	Big leaf Kuding old tea	N	N	N	Ilex latifolia#
BYC-6	Duosuike sweet tea	Quercus nigra	Fagaceae	Quercus phillyraeoides	Lithocarpus sp.
BYC-7	Fengwei tea	Elsholtzia stauntonii	Mosla chinensis	Mosla chinensis	Lamiaceae
BYC-8	Gongju tea	Chrysanthemum mutellinum#	Chrysanthemum×morifolium#	Chrysanthemum indicum	Chrysanthemum morifolium#
BYC-9	Green tea	Camellia sinensis#	Compositae	Camellia cuspidata	Camellia sp.
BYC-10	Guangxi sweet tea	N	N	N	Rubus crataegifolius
BYC-11	Hongxue tea	Panax ginseng	N	N	Scutellaria baicalensis
BYC-12	Huangqin tea	Scutellaria rehderiana	Scutellaria baicalensis#	Scutellaria baicalensis#	Scutellaria baicalensis#
BYC-13	Jiaogulan tea	Gynostemma pentaphyllum#	Gynostemma pentaphyllum#	Gynostemma pentaphyllum#	Gynostemma pentaphyllum#
BYC-14	Kuqiao tea	Panax ginseng	N	N	Stevia rebaudiana
BYC-15	Laoying tea	Litsea japonica	Cinnamomum brenesi	N	Litsea coreana#
BYC-16	Liangwang tea	Macropanax dispermus	Schefflera heptaphylla	Metapanax delavayi#	Metapanax delavayi#
BYC-17	Luobuhongma tea	Apocynum cannabinum	Apocynum cannabinum	Apocynum cannabinum	Apocynum venetum#
BYC-18	Luobubaima tea	Apocynum cannabinum	Apocynum cannabinum	Apocynum cannabinum	Poacynum hendersonii#
BYC-19	Luohan tea	Engelhardtia fenzelii	Alfaropsis roxburghiana#	Unknown	Engelhardtia roxburghiana#
BYC-20	Lvluohua tea	Edgeworthia chrysantha	Thymelaeaceae	Thymelaeaceae	Edgeworthia chrysantha
BYC-21	Mabiancao tea	Verbena bracteata	Verbena rigida	Verbena stricta	Verbena officinalis#
BYC-22	Niubaiteng sweet tea	Hedythyrsus sp.	Hedyotis hedyotidea#	Hedyotis hedyotidea#	Hedyotis hedyotidea#
BYC-23	Qingqianliu tea	Unknown	Cyclocarya paliurus#	Unknown	Cylocarya paliurus#
BYC-24	Sishi tea	Bacopa sp.	N	Gratiola neglecta	Callicarpa poilanei
BYC-25	Shen tea	Clerodendranthus spicatus#	N	N	Orthosiphon aristatus#
BYC-26	Shiliang tea	N	Chimonanthus salicifolius S. Y. H#	Chimonanthus salicifolius#	Chimonanthus salicifolius S.Y. H#
BYC-27	Shiya tea	Panax ginseng	N	N	Adinandra elegans
BYC-28	Tianyeju tea	Stevia rebaudiana#	Stevia rebaudiana#	Stevia rebaudiana#	Stevia rebaudiana#
BYC-29	Tieguanyin tea	Camellia sinensis#	Compositae	Camellia chekiangoleosa	Camellia sp.
BYC-30	Vine tea	Ampelopsis brevipedunculata	Ampelopsis grossedentata#	Ampelopsis grossedentata#	Compositae
BYC-31	Xihulongjing tea	Camellia sinensis#	Camellia sinensis#	Camellia sinensis#	Camellia sinensis#
BYC-32	Xiangsiteng tea	Abrus precatorius#	Abrus precatorius#	Abrus precatorius#	Abrus precatorius#
BYC-33	Xiangfeng tea	Panax ginseng	Chimonanthus salicifolius#	Chimonanthus salicifolius#	Chimonanthus Zhejiangensis#
BYC-34	Small leaf Kuding tea	Panax ginseng	N	Ligustrum robustum#	Ligustrum robustum#
BYC-35	Yaowang tea	Potentilla fruticosa#	Draba lanceolata	N	Dasiphora phyllocalyx
BYC-36	Yeju tea	Chrysanthemum mutellinum	Chrysanthemum×morifolium	Chrysanthemum indicum#	Chrysanthemum indicum#
BYC-37	Zhegu tea	Mallotus sp.	N	Mallotus apelta	Mallotus sp.

N, Sequencing without success; Unknown, not identification using DNA barcoding. #Identification results are correct.

The matK analysis data showed 24 commercialized samples were assigned to species, 4 to family. As one common primer of DNA barcoding, matK is suitable for genera identification. In this report, only 13 commercialized samples matched the designation of the original plants: 11 kinds of non-Camellia teas and 2 kinds of traditional teas (Table 4).

BLASTN analysis of the psbA-trnH data indicated 26 samples were assigned to species, 1 to family, and 2 were not recorded in GenBank. Only 13 commercialized samples matched the designation of the original plants: 12 kinds of non-Camellia teas and 1 kind of traditional tea (Table 4).

The ITS2 BLASTN result indicated 30 commercialized samples were assigned to species, 4 to genera, 3 to family. Of these, 23 commercialized samples matched the designation of the original plants: 21 kinds of non-Camellia teas and 2 kinds of traditional teas (Table 4).

In summary, using one or more DNA data by BLASTN analysis, 23 non-Camellia teas were assigned to their original plants successfully.

Species identification based on phylogenetic tree

Some original plants of the non-Camellia tea listed on labels lacked GenBank records. So the reference databases only comprised 29 rbcL, 26 matK, 22 psbA-trnH and 29 ITS2 sequences obtained by downloading all the sequences that yielded an e-value of 0.0 in the initial BLAST searches, and the measured DNA sequences comprised of 34 rbcL, 28 matK, 32 psbA-trnH and 37 ITS2. All the sequences were also used to construct phylogenetic trees using Mega 5.0 and Clustal X, with a bootstrap value of 1000 replicates, respectively. Moreover, we reconciled preliminary trees by setting the bootstrap value greater than 50% to yield a more credible consensus tree.

In the rbcL, matK, psbA-trnH and ITS2 tree, 13 (39%), 10 (30%), 8 (30%) and 12 (36%) commercialized samples of identification result accord with the original plants of non-Camellia tea, respectively (Fig. 1).

Figure 1

Phylogenetic trees constructed by DNA barcoding sequences. A, rbcL; B, matK; C, psbA-trnH; D, ITS2.

Discussion

Non-Camellia tea of misidentification and potential risk

Non-Camellia tea has been widely used in China for centuries. However, correct identification of some of these teas has remained a problem. According to our investigation, some non-Camellia teas from several original plants are used wildly in different regions. For instance, Huangqin tea comes from at least four original plants of the Scutellaria genus, including Scutellaria baicalensis, S. scordifolia, S. amoena, S. viscidula, etc. They were distributed in more than ten provinces in China. However, it is not easy to distinguish differing species of the same genus. Based on experience, the villagers generally seek to collect the herb that has the similar morphological species. Even some people collected other genus species to use as Huangqin tea, such as Dracocephalum rupestre. Therefore, it is of great importance to establish an unequivocal identification system for quality control of non-Camellia tea for safety and optimum therapeutic use.

Accuracy of authentication based on BLASTN and phylogenetic tree

In our BLASTN results, 11, 11, 12 and 21 non-Camellia teas were identified by rbcL, matK, psbA-trnH and ITS2, respectively. That means the ITS2 have more different loci than chloroplast regions. Of course, the plant species lacking GenBank records should not be ignored.

In all phylogenetic trees, yeju tea, gongju tea and all downloaded species from Chrysanthemum were grouped in a clade with strong support, but both samples did not match with their original plants. It means that yeju tea, gongju tea can be identified at genera level by a signal DNA barcoding marker. At the same time, the possibility of mixed-use between yeju tea and gongju tea also should be considered. The identification of genera also existed in Ilex (paraguay tea and big leaf kuding tea) in rbcL and ITS2 trees. However, additional data are needed for further authentication. Chimonanthus (shiliang tea and xiangfeng tea) became more interesting and different because of the diverse plant materials of shiliang tea. Further research with broader sampling of these species will advance the identification work.

Laoying tea is from Litsea coreana var. lanuginose (Lauraceae) and Actinodaphne cupularis (Hemsl.) Gemble (Lauraceae), and the major original plant is the former. In the ITS2 tree, all downloaded sequences of species from Lauraceae were in the same clade with the BYC-20 as sister group, and the commercial sample has much closer relationship with L. coreana. This means that laoying tea can be most accurately identified by ITS2.

Finally, some non-Camellia teas, such as hongxue tea, baixue tea, lvluohua tea and kuqiao tea, were not accurately matched to their original plants in all trees, indicating significant errors associated with the accuracy of DNA barcording among these species. The limited data in all trees among these species probably contribute to these errors. These results show that commercial non-Camellia teas should be identified with more accurate DNA barcoding sequences and broader sampling techniques.

Safety evaluation based on BLASTN and phylogenetic tree

Consumers have become more interested in the beneficial effects of tea to improve health. However, non-Camellia tea is not easily identified by morphological characteristics in the market. Adulteration and misidentification are common in the non-Camelliaea teas market, which might be malgenic or lethal. Several kinds of non-Camelliaea tea (e.g., Verbena officinalis L.) are considered abortifacients, and, if unknowingly consumed by a pregnant woman, could cause miscarriage. Luobuma tea from Apocynum (Apocynaceae) also is difficult to morphologically distinguish from some toxic plants in Apocynaceae. In our study, V. officinalis L. was accurately identified by DNA barcoding. Luobuhongma tea and luobubaima tea were identified at the genera level by BLASTN and both samples were grouped in a branch separated with other kinds of non-Camelliaea tea. However, we did note that DNA barcoding technology can׳t identify some of non-Camellia teas, such as fengwei tea, vine tea and sishi tea. This is because there are only a limited number of these sequences from original plants in GenBank. As a consequence, it is not easy to evaluate the safety of non-Camelliaea teas. More original plant sequences need to be submitted to GenBank in order to improve the safety of non-Camellia teas

Conclusions

Non-Camellia tea has been ingested for centuries for cultural and health purposes. These teas have been used to protect health and prevent diseases, such as cancer, hyperlipidemia, hypertension and hyperglycemia. In recent years, with the development and utilization of non-Camellia tea, only few non-Camellia teas have been developed into beverages, such as jiaogulan tea and kuding tea. But published data concerning the toxicity of some kinds of non-Camellia tea are very limited; the pharmacological activity and mechanisms of action for most kinds of non-Camellia tea have not been systematically studied. Additional research on all of these aspects of non-Camellia tea is needed.

In this study, molecular results revealed that DNA barcoding technology is a viable and effective method to identify non-Camelliaea tea. DNA barcoding technology can offer an effective method to help provide more accurate ingredient labels to consumers, thereby helping improve the safety of food and botanicals. This is particularly pertinent in an increasingly global economy where longer and more complex market chains increase distances between suppliers and consumers, and where regulatory agencies are becoming more stringent with food and botanicals81, 82.