Literature DB >> 26566453

Shiga Toxigenic Escherichia coli in Iranian Pediatric Patients With and Without Diarrhea: O-Serogroups, Virulence Factors and Antimicrobial Resistance Properties.

Banafshe Dormanesh1, Soheila Siroosbakhat2, Peyman Karimi Goudarzi3, Ladan Afsharkhas4.   

Abstract

BACKGROUND: Shiga-toxigenic Escherichia coli is an important human pathogen cause of diarrhea, hemorrhagic colitis, hemolytic uremic syndrome and thrombotic thrombocytopenic purpura in humans is a significant public health.
OBJECTIVES: The aim of this study was to determine the molecular characteristics and antimicrobial resistance properties of Shiga toxigenic Escherichia coli (STEC) strains with respect to their seasonal, age and geographical distributions in Iranian pediatric patients with and without diarrhea. PATIENTS AND METHODS: Four hundred and eighty swab samples were taken from pediatric patients with and without diarrhea of four major provinces of Iran. Swab samples were immediately cultured and the positive culture samples were analyzed by the polymerase chain reaction (PCR) method. Finally, antimicrobial susceptibility testing was performed using the disk diffusion method in Mueller-Hinton agar.
RESULTS: In total, 118 out of 200 diarrheic stool samples (59%) and 77 out of 280 non-diarrheic stool samples (27.5%) were positive for E. coli. Samples taken from one to ten months old cases (73.33%) and those from Shiraz province (81.13%) were the most commonly infected. Samples taken in the summer season (91.66%) were the most commonly infected. A significant difference was shown between AEEC and EHEC strains of E. coli. The genes encoding Shiga toxins and intimin protein were the most commonly detected in all strains. O26 (33.33%), O111 (18.18%) and O91 (12.12%) serogroups had the highest incidence in patients with and without diarrhea. Prevalence of the genes that encode resistance against ampicillin (CITM), gentamicin (aac(3)-IV) and tetracycline (tetA) were 80.30%, 75.75% and 65.15%, respectively. The STEC strains harbored the highest levels of resistance against ampicillin (84.84%), gentamycin (78.78%), tetracycline (50%) and sulfamethoxazole (40.90%) antibiotics. We found that 55.08% of diarrheic and 1.29% of non-diarrheic E. coli isolates were resistant to more than six antibiotics.
CONCLUSIONS: Accurate control programs should be organized for antibiotic prescription especially during warmer seasons in Iran. Primary treatment of diarrheic patients with co-trimoxazole, cefotaxime and ceftriaxone is effective.

Entities:  

Keywords:  Iran; Microbial Sensitivity Tests; Shiga Toxigenic Escherichia coli; Virulence Factors

Year:  2015        PMID: 26566453      PMCID: PMC4636853          DOI: 10.5812/ircmj.29706

Source DB:  PubMed          Journal:  Iran Red Crescent Med J        ISSN: 2074-1804            Impact factor:   0.611


1. Background

Shiga toxigenic Escherichia coli (STEC) is a significant cause of gastrointestinal disease, diarrhea, bloody diarrhea, hemolytic uremic syndrome (HUS), thrombotic thrombocytopenic purpura, hemolytic anemia, hemorrhagic colitis (HC) and acute renal failure in humans (1-3). It has been estimated that the STEC strains are one of the most prevalent causes of mortality in pediatrics (3-6). To appraise the pathogenicity of STEC strains, assessment of latent virulence factors is a pre-requisite. The factors that are most frequently associated with STEC infections and diarrhea are Shiga toxins (stx1 and stx2), intimin (eaeA) and hemolysin (hlyA) (1-3, 7). Most outbreaks and sporadic cases of bloody and non-bloody diarrhea, HUS and even HC have been attributed to the O157 serogroup of the STEC strains. In line with this, the roles of non-O157 serogroups like O111, O103, O26, O145, O113, O45, O121, O91 and O128 have been recognized as causes of HUS, HC, bloody and non-bloody diarrhea and other gastrointestinal disorders (1, 2, 8, 9). In addition to O-serogroups and virulence factors, treatment is a critical point to assess the epidemiological contents of STEC strains in the cases of diarrhea, while therapeutic options have become somewhat limited because of the presence of multi drug resistant strains of these bacteria (1-3, 10). Antibiotic resistant strains of STEC can cause more severe diseases in humans and animals. Antibiotic resistance in STEC strains is associated with the presences of some antibiotic resistance genes (1-3, 10). The genes that encode resistance against tetracycline (tetA and tetB), trimethoprim (dfrA1), aminoglycosides (aadA1), fluoroquinolone (qnr), gentamicin (aac(3)-IV), sulfonamide (sul1), cephalothin (blaSHV), ampicillin (CITM), erythromycin (ereA) and chloramphenicol (cat1 and cmlA) are the most commonly detected antibiotic resistance genes in the resistant isolates of STEC strains (1-3, 10). Based on Iranian epidemiological researches, STEC strains have been known as the most commonly detected pathogens in pediatric patients with diarrhea and show a high incidence of resistance (85 - 100%) against commonly used antimicrobial agents (3, 11, 12). Imperious data about the prevalence of O-serogroups, virulence factors and antibiotic resistance properties in STEC strains isolated from pediatric patients are rare in Iran.

2. Objectives

The present research was carried out in order to study the distribution of virulence factors, O-serogroups, antibiotic resistance genes and pattern of antibiotic resistance of STEC strains isolated from diarrheic and non-diarrheic pediatric patients with respect to the role of season, age and geographical area of sample collection.

3. Patients and Methods

3.1. Samples and Escherichia coli Identification

From January 2014 to January 2015 during various seasons of the year, a total of 480 stool samples from diarrheic (n = 200) and non-diarrheic (n = 280) pediatric patients were collected from educational hospitals of various provinces of Iran. Individuals of the diarrheic group were classified into six groups based on their age (less than a month old, 1 - 10 months, 11 - 21 months, 22 - 33 months, 34 - 45 months, 46 - 57 months and 58 - 69 months old). Clinical histories of pediatric patients were obtained through questionnaires. Stool specimens were collected using sterile rectal swabs. All swabs were placed in tubes containing Stuart medium. Samples were transferred to the laboratory at 4°C in a cooler with iced-packs. All samples were diluted using phosphate buffer saline (PBS, Merck, Germany). Samples were then plated onto MacConkey’s agar (MC, Merck, Germany) and incubated overnight at 37°C. From each sample, a typical lactose positive colony was selected and placed onto eosin methylene blue (EMB; Merck, Germany) and incubated overnight at 37°C. Metallic green colonies were considered as typical E. coli colonies. Escherichia coli isolates were also characterized by evaluation of standard biochemical tests including Indole, Methyl red, Voges-Proskauer, Triple Sugar Iron agar (TSI; Merck, Germany), urease, lysine decarboxylase and citrate utilization. Colonies were further confirmed to be E. coli using the polymerase chain reaction (PCR) (13).

3.2. Antimicrobial Susceptibility Testing

Antimicrobial susceptibility of E. coli isolates was determined by the Kirby-Bauer disc diffusion method using Mueller-Hinton agar (Merck, Germany), according to the Clinical and Laboratory Standards Institute guidelines (CLSI 2012). After incubating the inoculated plate aerobically at 37°C for 18 - 24 hours in an aerobic atmosphere, the susceptibility of the E. coli isolates to tetracycline (30 µg/disk), chloramphenicol (30 µg/disk), sulfamethoxazole (25 µg/disk), gentamycin (10 µg/disk), cephalothin (30 µg/disk), trimethoprim (5 µg/disk), ciprofloxacin (5 µg/disk), ampicillin (10 u/disk), co-trimoxazole (25 µg/disk), cefotaxime (30 µg), ceftriaxone (30 µg), cefixime (5 µg), nalidixic acid (30 µg) and norfloxacin (10 µg) antimicrobial agents was measured and the results were interpreted in accordance with interpretive criteria provided by CLSI (CLSI 2012). Escherichia coli ATCC 35218 was used as the quality control organism in antimicrobial susceptibility determination.

3.3. DNA Extraction

Total genomic DNA was extracted from the bacterial colonies. A single colony was inoculated on trypticase soy agar (TSA, Merck, Germany) and incubated over night at 37ºC. Next, 1.5 mL of a saturated culture was harvested with centrifugation for five minutes, at 14000 rpm. The cell pellet was resuspended and lysed in 200 µL of lysis buffer (40 mM tris-acetate, pH 7.8, 20 mM sodium-acetate, 1 mM EDTA, 1% SDS) by vigorous pipetting. To remove most proteins and cell debris, 66 µL of 5 M NaCl solution was added and mixed well, and then the viscous mixture was centrifuged at 12000 rpm for 10 minutes at 4ºC. After transferring the clear supernatant to a new eppendorf tube, an equal volume of chloroform was added, and the tube was gently inverted at least 50 times when a milky solution was completely formed. Following centrifugation at 14000 rpm for five minutes, the supernatant was transferred to another eppendorf tube and double volume of 100% ethanol was added. The tubes were gently inverted five to six times, then centrifuged at 10000 rpm for five minutes. The supernatant was discarded and 1 ml of ethanol (70%) was added to the pellet, and tubes were centrifuged at 10000 rpm for five minutes. Finally, the supernatant was discarded and the pellet was dried for 10 minutes at room temperature, and the pellet was resuspended by 100 µL of H2O. The stock was kept at -20ºC until use. The DNA concentration was determined by measuring absorbance of the sample at 260 nm using a spectrophotometer (14).

3.4. Detection of Serogroups, Virulence Factors and Antibiotic Resistance Genes

The oligonucleotide primers and PCR program used for detection of O-serogroups, virulence factors and antibiotic resistance genes of E. coli isolates are shown in Table 1. All PCR reactions were amplified in a programmable thermal cycler (Eppendorf, Mastercycler® 5330, Eppendorf-Netheler-Hinz GmbH, Hamburg, Germany) PCR device. Finally, 15 µL of PCR products were resolved on a 1.5% agarose gel containing 0.5 mg/mL of ethidium bromide in tris–borate– Ethylenediaminetetraacetic acid (EDTA) buffer at 90 V for one hour, using suitable molecular weight markers. The products were examined under ultraviolet illumination. Strains of E. coli O157: K88ac: H19, CAPM 5933 and E. coli O159: H20, CAPM 6006 were used as positive controls and distilled water was used as the negative control.
Table 1.

The Oligonucleotide Primers and the Polymerase Chain Reaction Programs Used for Amplification of O-Serogroups, Virulence Factors and Antibiotic Resistance Genes of Escherichia coli Isolates From Pediatric Patients With and Without Diarrhea

Target GenePrimer Sequence (5' - 3') [a]PCR Product, bp
O157 b F: CGGACATCCATGTGATATGG259
R: TTGCCTATGTACAGCTAATCC
O145 b F: CCATCAACAGATTTAGGAGTG609
R: TTTCTACCGCGAATCTATC
O103 b F: TTGGAGCGTTAACTGGACCT321
R: GCTCCCGAGCACGTATAAG
O26 b F: CAGAATGGTTATGCTACTGT423
R: CTTACATTTGTTTTCGGCATC
O111 b F: TAGAGAAATTATCAAGTTAGTTCC406
R: ATAGTTATGAACATCTTGTTTAGC
O91 c F: GCTGACCTTCATGATCTGTTGA291
R: TAATTTAACCCGTAGAATCGCTGC
O128 c F: GCTTTCTGCCGATATTTGGC289
R: CCGACGGACTGATGCCGGTGATT
O121 c F: TGGCTAGTGGCATTCTGATG322
R: TGATACTTTAGCCGCCCTTG
O113 c F: GGGTTAGATGGAGCGCTATTGAGA771
R: AGGTCACCCTCTGAATTATGGCAG
O45 c F: CCGGGTTTCGATTTGTGAAGGTTG527
R: CACAACAGCCACTACTAGGCAGAA
stx1 d F: AAATCGCCATTCGTTGACTACTTCT366
R: TGCCATTCTGGCAACTCGCGATGCA
stx2 d F: CGATCGTCACTCACTGGTTTCATCA282
R: GGATATTCTCCCCACTCTGACACC
eaeA d F: TGCGGCACAACAGGCGGCGA629
R: CGGTCGCCGCACCAGGATTC
ehly d F: CAATGCAGATGCAGATACCG432
R: CAGAGATGTCGTTGCAGCAG
aadA1 e F: TATCCAGCTAAGCGCGAACT447
R: ATTTGCCGACTACCTTGGTC
tetA e F: GGTTCACTCGAACGACGTCA577
R: CTGTCCGACAAGTTGCATGA
tetB e F: CCTCAGCTTCTCAACGCGTG634
R: GCACCTTGCTGATGACTCTT
dfrA1 e F: GGAGTGCCAAAGGTGAACAGC367
R: GAGGCGAAGTCTTGGGTAAAAAC
qnr e F: GGGTATGGATATTATTGATAAAG670
R: CTAATCCGGCAGCACTATTTA
aac(3)-IV sul1 e F: CTTCAGGATGGCAAGTTGGT286
R: TCATCTCGTTCTCCGCTCAT
blaSHV e F: TTCGGCATTCTGAATCTCAC822
R: ATGATCTAACCCTCGGTCTC
CITM e F: TCGCCTGTGTATTATCTCCC768
R: CGCAGATAAATCACCACAATG
cat1 e F: TGGCCAGAACTGACAGGCAAA462
R: TTTCTCCTGAACGTGGCTGGC
cmlA e F: AGTTGCTCAATGTACCTATAACC547
R: TTGTAATTCATTAAGCATTCTGCC
aadA1 e F: CCGCCACGGTGTTGTTGTTATC698
R: CACCTTGCCTGCCCATCATTAG

aThe oligonucleotide primers and PCR programs were obtained from previous studies.

bPCR Program: 1 cycle: 95°C, 3 minutes. 30 cycles: 95°C, 20 seconds; 58°C, 40 seconds; 72°C , 30 seconds. 1 cycle: 72°C, 8 minutes. PCR Volume (50 μL): 5 μL PCR buffer 10×, 1.5 mM MgCl

cPCR Program: 1 cycle: 94°C, 6 minutes. 34 cycle: 95°C, 50 seconds; 58°C, 70 seconds; 72°C, 55 seconds. 1 cycle: 72°C, 10 minutes. PCR Volume (50 μL): 5 μL PCR buffer 10×, 2 mM MgCl

dPCR Program: 1 cycle: 95°C, 3 minutes. 34 cycle: 94°C, 60 seconds; 56°C, 45 seconds; 72°C, 60 seconds. 1 cycle: 72°C, 10 minutes. PCR Volume (50 μL): 5 μL PCR buffer 10×, 2 mM MgCl

ePCR Program: 1 cycle: 94°C, 8 minutes. 32 cycle: 95°C, 60 seconds; 55°C, 70 seconds; 72°C, 2 minutes. 1 cycle: 72°C, 8 minutes. PCR Volume (50 μL): 5 μL PCR buffer 10×, 2.5 mM MgCl

aThe oligonucleotide primers and PCR programs were obtained from previous studies. bPCR Program: 1 cycle: 95°C, 3 minutes. 30 cycles: 95°C, 20 seconds; 58°C, 40 seconds; 72°C , 30 seconds. 1 cycle: 72°C, 8 minutes. PCR Volume (50 μL): 5 μL PCR buffer 10×, 1.5 mM MgCl cPCR Program: 1 cycle: 94°C, 6 minutes. 34 cycle: 95°C, 50 seconds; 58°C, 70 seconds; 72°C, 55 seconds. 1 cycle: 72°C, 10 minutes. PCR Volume (50 μL): 5 μL PCR buffer 10×, 2 mM MgCl dPCR Program: 1 cycle: 95°C, 3 minutes. 34 cycle: 94°C, 60 seconds; 56°C, 45 seconds; 72°C, 60 seconds. 1 cycle: 72°C, 10 minutes. PCR Volume (50 μL): 5 μL PCR buffer 10×, 2 mM MgCl ePCR Program: 1 cycle: 94°C, 8 minutes. 32 cycle: 95°C, 60 seconds; 55°C, 70 seconds; 72°C, 2 minutes. 1 cycle: 72°C, 8 minutes. PCR Volume (50 μL): 5 μL PCR buffer 10×, 2.5 mM MgCl

3.5. Statistical Analysis

The data were analyzed using the SPSS (statistical package for the social sciences) software and P Value was calculated using the chi-square test to find any significant relationship between various seasons, ages, clinical symptoms and distribution of O-serogroups, virulence genes and antibiotic resistance properties of STEC strains isolated from pediatric patients with and without diarrhea. A P Value of less than 0.05 was considered statistically significant.

3.6. Ethical Issues

The present study was approved by the ethical committee of educational hospitals of Tehran, Isfahan, Shiraz and Mashhad. The life, health, dignity, integrity, rights to self-determination, privacy, and confidentiality of personal information of research subjects were also protected. All patients or their parents signed the written informed consent.

4. Results

All of the swab samples of pediatric patients with and without diarrhea were studied using the culture method and positive results were confirmed to be E. coli by the PCR technique. Age, seasonal and geographical distribution of E. coli in the pediatric patients with and without diarrhea are shown in Table 2. Of the 480 studied samples, 195 (40.62) samples were positive for E. coli. On the other hand, 118 out of 200 diarrheic stool samples (59%) and 77 out of 280 non-diarrheic stool samples (27.5%) were positive. A significant difference was observed between the prevalence of E. coli from diarrheic and non-diarrheic patients (P < 0.027). Overall, 1 - 10 month old patients had the highest incidence of E. coli (73.33%) yet 58 - 69 month old patients had the lowest incidence of E. coli (38.46%). Escherichia coli strains had the highest prevalence in the Shiraz (81.13%), followed by Isfahan (69.56%) and Tehran (50.84%). The swab samples, which were taken in the summer season had the highest prevalence of E. coli (91.66%), while those that were taken in the winter season had the lowest prevalence (22.22%). There were significant differences in the incidence of E. coli between hot and cold seasons (P = 0.038).
Table 2.

Age, Seasonal and Geographical Distribution of Escherichia coli in Pediatric Patients With and Without Diarrhea

Different CriteriaNo. Samples CollectedPositive Samples [a]
Age distribution, mon
< 13219 (59.37)
1 - 103022 (73.33)
11 - 213021 (70)
22 - 332716 (59.25)
34 - 452916 (55.17)
46 - 572614 (53.84)
58 - 692610 (38.46)
Geographical distribution
Tehran5930 (50.84)
Isfahan4632 (69.56)
Shiraz5343 (81.13)
Mashhad4213 (30.95)
Seasonal distribution
Spring5031 (62)
Summer6055 (91.66)
Autumn4522 (48.88)
Winter4510 (22.22)
Total diarrheic samples 200118 (59)
Non-diarrheic samples 28077 (27.5)
Total 480195 (40.62)

aData are presented as No. (%).

aData are presented as No. (%). Total distribution of virulence genes in the E. coli subtypes of pediatric patients with and without diarrhea is shown in Table 3. Stx1 and eaeA were the most commonly detected virulence factors in the diarrheic and non-diarrheic pediatric patients. The majority of E. coli strains harbored stx1 and eaeA genes together, while the prevalence of E. coli isolates harboring the stx2 and eaeA factors together were low. The AEEC were the most commonly detected subtype yet EHEC was the least commonly detected. The EHEC subtype was only detected in less than a month (7.69%), 1 - 10 (12.5%) and 34 - 45 (10%) month old pediatric patients. Significant statistical differences were observed between the incidence of stx1 and stx2 genes (P = 0.022) and also between the incidence of AEEC and EHEC subtypes (P = 0.031).
Table 3.

Total Distribution of Virulence Factors in Escherichia coli Subtypes Isolated From Diarrheic and Non-Diarrheic Pediatric Patients[a], [b]

Diarrhea Status and Age, monNo. PositivePositiveVirulence Factors
Positive
< 1 19
Non detected4 (30.76)-
EHEC1 (7.69)Stx1, eae, ehly: 1 (100)
AEEC8 (61.53)stx1: 7 (87.5), stx2: 3 (37.5), eaeA: 5 (62.5), stx1, eaeA: 4 (50), stx2, eaeA: 2 (25), stx1, stx2, eaeA: 2 (25)
Total13 (68.42)-
1 - 10 22
Non detected5 (31.25)-
EHEC2 (12.5)Stx1, eae, ehly: 2 (100)
AEEC9 (56.25)stx1: 8 (88/88), stx2: 4 (44.44), eaeA: 6 (66.66), stx1, eaeA: 5 (55.55), stx2, eaeA: 3 (33.33), stx1, stx2, eaeA: 1 (11.11)
Total16 (72.72)-
11 - 21 21
Non detected5 (33.33)-
EHEC-Stx1, eae, ehly: -
AEEC10 (66.66)stx1: 10 (100), stx2: 5 (50), eaeA: 7 (70), stx1, eaeA: 6 (60), stx2, eaeA: 2 (20), stx1, stx2, eaeA: 2 (20)
Total15 (71.42)-
22 - 33 16
Non detected4 (36.36)-
EHEC-Stx1, eae, ehly: -
AEEC7 (63.63)stx1: 5 (71.42), stx2: 3 (42.85), eaeA: 4 (57.14), stx1, eaeA: 4 (57.14), stx2, eaeA: 2 (28.57), stx1, stx2, eaeA: 1 (14.28)
Total11 (68.75)-
34 - 45 16
Non detected3 (30)-
EHEC1 (10)Stx1, eae, ehly: 1 (100)
AEEC6 (60)stx1: 5 (83.33), stx2: 2 (33.33), eaeA: 4 (66.66), stx1, eaeA: 3 (50), stx2, eaeA: 2 (33.33), stx1, stx2, eaeA: 1 (16.66)
Total10 (62.5)-
46 - 57 14
Non detected3 (33.33)-
EHEC-Stx1, eae, ehly: -
AEEC6 (66.66)stx1: 6 (100), stx2: 2 (33.33), eaeA: 5 (83.33), stx1, eaeA: 4 (66.66), stx2, eaeA: 1 (16.66), stx1, stx2, eaeA: 1 (16.66)
Total9 (64.28)-
58 - 69 10
Non detected2 (33.33)-
EHEC-Stx1, eae, ehly: -
AEEC4 (66.66)stx1: 3 (75.00), stx2: 1 (25), eaeA: 2 (50), stx1, eaeA: 2 (50), stx2, eaeA: 1 (25), stx1, stx2, eaeA: 1 (25)
Total6 (60)-
Negative 77
Non detected13-
EHEC-Stx1, eae, ehly: -
AEEC12stx1: 10 (83.33), stx2: 5 (41.66), eaeA: 8 (66.66), stx1, eaeA: 7 (58.33), stx2, eaeA: 3 (25), stx1, stx2, eaeA: 2 (16.66)
Total25 (32.46)-

aAbbreviations: AEEC: attaching and effacing.

bValues are presented as No. (%).

aAbbreviations: AEEC: attaching and effacing. bValues are presented as No. (%). Of the 195 E. coli strains, 66 isolates (33.84%) were confirmed to be STEC. Total distribution of O-serogroups in the STEC strains of pediatric patients with and without diarrhea is shown in Table 4. We found that the most commonly detected O-serogroups in the diarrheic and non-diarrheic pediatric patients were O26 (33.33%), O111 (18.18%) and O91 (12.12%). There were no positive strains for O157 serogroup in the non-diarrheic pediatric patients. The STEC O-serogroups had the highest incidence in 1 - 10 month old pediatric patients. Significant difference was seen between the age of pediatrics and incidence of STEC O-serogroups (P = 0.043).
Table 4.

Total Distribution of O-Serogroups in the Shiga Toxigenic Escherichia coli Strains From Pediatric Patients With and Without Diarrhea

Diarrhea Status and Age, monNo. STEC StrainsDistribution of O-Serogroups [a]
O157O26O103O111O145O45O91O113O121O128
Positive
< 1 91312--1-1-
1 - 10112413--1---
11 - 2110-3-21-2-11
22 - 337-211--1-11
34 - 4571211--1-1-
46 - 576-211--1-1-
58 - 694-1-1-11---
Negative 12-51111-111
Total 664 (6.06)22 (33.33)6 (9.09)12 (18.18)2 (3.03)2 (3.03)8 (12.12)1 (1.51)6 (9.09)3 (4.54)

aValue’s unit is %.

aValue’s unit is %. Total distribution of antibiotic resistance genes in the STEC strains from pediatric patients with and without diarrhea is shown in Table 5. Regarding resistance, CITM (80.30%), aac (3)-IV (75.75%) and tetA (65.15%) were the most commonly detected antibiotic resistance genes in pediatric patients with and without diarrhea. Non-diarrheic pediatric patients had the lowest prevalence of antibiotic resistance genes when compared to diarrheic pediatric. There were no positive results for the cmlA gene. A significant difference was seen between the age of pediatric patients and incidence of antibiotic resistance genes (P = 0.035).
Table 5.

Total Distribution of Antibiotic Resistance Genes in the Shiga Toxigenic Escherichia coli Strains From Pediatric Patients With And Without Diarrhea

Diarrhea Status and Age, monNo. STEC StrainsDistribution of Antibiotic Resistance Genes [a]
aadA1 tetA tetB dfrA1 qnr aac(3)-IV sul1 blaSHV CITM cat1 cmlA
Positive
< 1 9372658648--
1 - 10 11383668769--
11 - 21 102616688591-
22 - 337151547537--
34 - 457152336426--
46 - 57 6141324325--
58 - 694-3-2243141-
Negative 12151215235--
Total 6612 (18.18)43 (65.15)11 (16.66)33 (50)29 (43.93)50 (75.75)38 (57.57)25 (37.87)53 (80.30)2 (3/03)-

aValues unit is %.

aValues unit is %. Susceptibility of STEC strains against 14 commonly used antimicrobial agents is shown in Table 6. The STEC strains of our study harbored the highest levels of resistance against ampicillin (84.84%), gentamycin (78.78%), tetracycline (50%) and sulfamethoxazole (40.90%) antibiotics. Levels of antibiotic resistance in the STEC strains of pediatric patients without diarrhea were lower than those with diarrhea. Figure 1 shows the total distribution of multi-drug resistance in the STEC strains of pediatric patients with and without diarrhea. All of the E. coli strains of pediatric patients with and without diarrhea harbored resistance against one antibiotic. We found that 65 out of 118 (55.08%) diarrheic and one out of 77 (1.29%) non-diarrheic E. coli isolates were resistant to more than six antibiotics.
Table 6.

Antibiotic Resistance Pattern of Shiga Toxigenic Escherichia coli Strains Isolated From Pediatric Patients With and Without Diarrhea[a]

Diarrhea Status and Age, monNo. STEC StrainsPattern of Antibiotic Resistance [b]
TE30C30SXTGM10CF30CIP5TMP5AM10COT25Cef30CftrCfx5F/M300Nor10
Positive
< 196-584548233414
11 - 211061593459233314
22 - 3374-362237122212
34 - 4573-362236113212
46 - 5762-251226121112
58 - 6942-131114-111-1
Negative 123-363326123312
Total 6633 (50)1 (1.51)27 (40.90)52 (78.78)18 (27.27)23 (34.84)25 (37.87)56 (84.84)11 (16.66)17 (25.75)20 (30.30)20 (30.30)8 (12.12)22 (33.33)

aIn this table: TE30: tetracycline (30 µg/disk); C30: chloramphenicol (30 µg/disk); SXT: sulfamethoxazole (25 µg/disk); GM10: gentamycin (10 µg/disk); CF30: cephalothin (30 µg/disk); CIP5: ciprofloxacin (5 µg/disk); TMP5: trimethoprim (5 µg/disk); AM10: ampicillin (10 µg/disk); COT25: co-trimoxazole (25 µg/disk); Cef30: cefotaxime (30 µg/disk); Cftr: ceftriaxone (30 µg/disk); Cfx5: cefixime (5 µg/disk); F/M300: nitrofurantoin (300 µg/disk); Nor10: norfloxacin (10 µg/disk) antimicrobial agents.

b Value’s unit is %.

Figure 1.

Prevalence of Multi-Drug Resistance in the Escherichia coli Isolates of Pediatric Patients With and Without Diarrhea

aIn this table: TE30: tetracycline (30 µg/disk); C30: chloramphenicol (30 µg/disk); SXT: sulfamethoxazole (25 µg/disk); GM10: gentamycin (10 µg/disk); CF30: cephalothin (30 µg/disk); CIP5: ciprofloxacin (5 µg/disk); TMP5: trimethoprim (5 µg/disk); AM10: ampicillin (10 µg/disk); COT25: co-trimoxazole (25 µg/disk); Cef30: cefotaxime (30 µg/disk); Cftr: ceftriaxone (30 µg/disk); Cfx5: cefixime (5 µg/disk); F/M300: nitrofurantoin (300 µg/disk); Nor10: norfloxacin (10 µg/disk) antimicrobial agents. b Value’s unit is %.

5. Discussion

The present investigation focused on the study of the prevalence of O-serogroups, virulence factors and antimicrobial resistance properties of STEC strains isolated from diarrheic and non-diarrheic pediatric patients with respect to age, seasonal and geographical distribution. We found that the 1 - 10 month old patients from the Shiraz during the summer season were the group at highest risk for infection with STEC strains. The main reason for the higher prevalence of E. coli in the summer season in Iran is the fact that during this time climatic events, heat, rain, and thunderstorms, as well as variation of barometric pressure may influence the autonomic nervous system. These events cause a reduction in the levels of human immunity. Therefore, several infections may occur. Furthermore, E. coli has better growth and surveillance in warm conditions. The levels of public and individual health are also decreased in warm climates, such as during summer. After analyzing the average temperatures of the four seasons in the study area (19°C for spring, 35°C for summer, 14°C for autumn and 5°C for winter), it was recognized that the prevalence of E. coli in each season was related to the average temperatures. A significant difference (P = 0.037) was seen between the average temperatures of hot and cold seasons. Similar researches have also reported on the seasonal distribution of E. coli infections (3, 15-18). Available data between years 1996 and 2011, revealed the higher prevalence of E. coli infections during the hot months (18). Higher prevalence of cases of gastrointestinal infections in the warm season of the year has also been reported previously (3, 15-18). We also found that 1 - 10 month old pediatric patients were the most commonly infected group, which was similar to the results of Momtaz et al. (3). They showed that 13 - 24 month old patients were the most infected age group (77.63%). Our results revealed that the E. coli isolates of patients with diarrhea had a high prevalence of virulence factors. We found that the majority of E. coli strains harbored all stx1, stx2 and eaeA genes together, indicating higher levels of pathogenicity and infection. The relatively high occurrence of the stx1 gene compared to stx2 in the diarrheic E. coli isolates suggests that E. coli carrying a combination of the eaeA and stx1 genes is more common than the combination of eaeA and stx2 genes. Some of the E. coli strains of our study harbored the stx1, stx2 and eaeA genes together. The importance of these data lies in the fact that eae-positive strains are considered more virulent for humans than eae-negative strains, as well as strains carrying only the stx2 genes (19). This observation is of concern, as the former combination of genes is known to cause more severe diarrhea in humans (19-21). Momtaz et al. reported on the multiple presences of stx1, eaeA and ehly genes in the EHEC strains of one to 60 month old pediatric patients (3). High presence of stx1, stx2, eaeA and ehly genes, in the E. coli isolates of diarrheic patients from Korea, Brazil, Australia and Kenya, has also been reported previously (21-24). Sang et al. showed that 37.1% of diarrheic patients were positive for E. coli, of which 24.1% were STEC (23). Sang et al. reported that 52.9% of STEC isolates carried stx1, 29.4% possessed stx2, 14.7% carried both stx1 and stx2, and 2.9% had stx2e, and 23.5% carried ehly and 20.5% of the isolates possessed the eaeA gene, which was similar to our results (23). Both O157 and non-O157 strains had a high prevalence in diarrheic pediatric patients of our investigation. On the other hand, O26 (33.33%), O111 (18.18%) and O91 (12.12%) were the most commonly detected O-serogroups in pediatric patients with and without diarrhea. In a study conducted in Iran, O26 (27.04%) had the highest incidence amongst STEC serogroups of diarrheic pediatrics, followed by O111 (18.85%) (3). High prevalence of non-O157 serogroups of STEC strains in the cases of diarrhea has been reported by various studies (15-17, 25). High prevalence of non-O157 strains and especially the O26 strain of STEC in the cases of diarrhea was reported from Germany (26), Japan (27) and South Africa (28). Extreme and highly irregular prescriptions of antimicrobial agents in our study area caused the high levels of resistance of STEC strains against ampicillin (84.84%), gentamycin (78.78%), tetracycline (50%) and sulfamethoxazole (40.90%) antibiotics. These high levels of resistance have been derived from the high presence of certain antibiotic resistance genes including CITM (80.30%), aac (3)-IV (75.75%) and tetA (65.15%). We also found that 55.08% of diarrheic and 1.29% of non-diarrheic E. coli isolates were resistant to more than six antibiotics, which was considerably high. We also recognized that O26 serogroup had the highest levels of antibiotic resistance and antibiotic resistance genes, which was similar to the results of Kijima-Tanaka et al. (27) and Momtaz et al. (3). Our results showed that the STEC strains of our study were also resistant to chloramphenicol (1.51%) and nitrofurantoin (12.12%) antibiotics. Chloramphenicol and nitrofurantoin are forbidden antibiotics and the slight antibiotic resistance to these antimicrobial agents indicated their irregular and unauthorized use in medical treatment in Iran. Similarly, chloramphenicol and nitrofurantoin resistance have also been reported previously (3, 29, 30). Another Iranian study (31) showed that the STEC strains of diarrheic patients were resistant to amoxicillin (72.4%), trimethoprim-sulfamethoxazole (65.5%) and tetracycline (58.6%) antibiotics. Momtaz et al. (2) reported that the STEC strains had the highest levels of resistance against sulfisoxazole (36%), tetracycline (32%), streptomycin (29%), ampicillin (10%), trimethoprim (8%), cotrimoxazole (8%), chloramphenicol (7%), kanamycin (7%), piperacillin (6%), and neomycin (5%) antibiotics, which was similar to our results. In conclusion, we identified E. coli with defined pathotypes, which originated mainly from diarrheic and non-diarrheic pediatric patients of four major provinces of Iran. We also found a large number of virulent and resistant strains of E. coli with higher prevalence of stx1 and eaeA genes, O26, O111 and O91 serogroups, CITM, aac(3)-IV and tetA antibiotic resistance genes and resistance to ampicillin, gentamycin, tetracycline and antibiotics. Shiraz due to its high temperature and moisture had the highest prevalence of E. coli. Simultaneous presence of stx1 and eaeA, and stx2 and eaeA virulence factors in some strains of E. coli in diarrheic children warned about an important public health problem. Prescription of co-trimoxazole, cefotaxime, cephalothin and ceftriaxone can be effective for treatment of the cases of infection due to STEC strains.
  27 in total

Review 1.  Antibiotic resistance mechanisms among pediatric respiratory and enteric pathogens: A current update.

Authors:  Angela B Brueggemann
Journal:  Pediatr Infect Dis J       Date:  2006-10       Impact factor: 2.129

2.  Shiga toxin activatable by intestinal mucus in Escherichia coli isolated from humans: predictor for a severe clinical outcome.

Authors:  Martina Bielaszewska; Alexander W Friedrich; Thomas Aldick; Robin Schürk-Bulgrin; Helge Karch
Journal:  Clin Infect Dis       Date:  2006-10-02       Impact factor: 9.079

3.  Antimicrobial susceptibility patterns of E. coli from clinical sources in northeast Ethiopia.

Authors:  M Kibret; B Abera
Journal:  Afr Health Sci       Date:  2011-08       Impact factor: 0.927

4.  Molecular epidemiology of Escherichia coli isolated from young South African children with diarrhoeal diseases.

Authors:  P M Galane; M Le Roux
Journal:  J Health Popul Nutr       Date:  2001-03       Impact factor: 2.000

5.  Prevalence and genetic characteristics of Shigatoxigenic Escherichia coli from patients with diarrhoea in Maasailand, Kenya.

Authors:  Willie K Sang; Hamadi I Boga; Peter G Waiyaki; David Schnabel; Njeri C Wamae; Sam M Kariuki
Journal:  J Infect Dev Ctries       Date:  2012-02-13       Impact factor: 0.968

6.  Isolation of Verocytotoxin-producing Escherichia coli O157:H7 from cattle at slaughter in Italy.

Authors:  S Bonardi; E Maggi; A Bottarelli; M L Pacciarini; A Ansuini; G Vellini; S Morabito; A Caprioli
Journal:  Vet Microbiol       Date:  1999-06-30       Impact factor: 3.293

7.  Associations between virulence factors of Shiga toxin-producing Escherichia coli and disease in humans.

Authors:  P Boerlin; S A McEwen; F Boerlin-Petzold; J B Wilson; R P Johnson; C L Gyles
Journal:  J Clin Microbiol       Date:  1999-03       Impact factor: 5.948

8.  Prevalence of the stx2 gene in coliform populations from aquatic environments.

Authors:  Cristina García-Aljaro; Maite Muniesa; Juan Jofre; Anicet R Blanch
Journal:  Appl Environ Microbiol       Date:  2004-06       Impact factor: 4.792

9.  Shiga toxin-producing Escherichia coli infection.

Authors:  Cheleste M Thorpe
Journal:  Clin Infect Dis       Date:  2004-04-15       Impact factor: 9.079

10.  Clinical course and the role of shiga toxin-producing Escherichia coli infection in the hemolytic-uremic syndrome in pediatric patients, 1997-2000, in Germany and Austria: a prospective study.

Authors:  Angela Gerber; Helge Karch; Franz Allerberger; Hege M Verweyen; Lothar B Zimmerhackl
Journal:  J Infect Dis       Date:  2002-08-02       Impact factor: 5.226

View more
  2 in total

1.  Prevalence and antimicrobial resistance of shiga toxin-producing Escherichia coli and enteropathogenic Escherichia coli isolated from patients with acute diarrhea.

Authors:  Saeid Bouzari; Elham Farhang; Seyed Mostafa Hosseini; Mohammad Yousef Alikhani
Journal:  Iran J Microbiol       Date:  2018-06

2.  Antibiogram studies of Escherichia coli and Salmonella species isolated from diarrheal patients attending Malam Mande General Hospital Dutsin-Ma, Katsina State, Nigeria.

Authors:  Ayodele Timilehin Adesoji; Ahmad Mansur Liadi
Journal:  Pan Afr Med J       Date:  2020-10-01
  2 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.