Literature DB >> 26504680

Isolation of nuclear microsatellites in the African timber tree Lophira alata (Ochnaceae) and cross-amplification in L. lanceolata.

Rosalía Piñeiro1, Adrien Staquet1, Olivier J Hardy1.   

Abstract

PREMISE OF THE STUDY: Microsatellite markers were isolated in the rainforest tree Lophira alata (Ochnaceae), an important timber tree from Central Africa, and cross-amplified on its savannah counterpart, L. lanceolata. METHODS AND
RESULTS: From a microsatellite-enriched library sequenced on a 454 GS FLX platform, 13 primer combinations were identified. Amplification was optimized in two multiplex reactions. The primers amplified di- and trinucelotide repeats, with two to seven alleles per locus. Eleven primers also amplified in L. lanceolata.
CONCLUSIONS: Microsatellite primers developed for the genus Lophira displayed sufficient variation to investigate hybridization between congeneric species in the rainforest-savannah transition.

Entities:  

Keywords:  Lophira; Ochnaceae; nSSR; next-generation sequencing; tropical rainforests; universal primers

Year:  2015        PMID: 26504680      PMCID: PMC4610311          DOI: 10.3732/apps.1500056

Source DB:  PubMed          Journal:  Appl Plant Sci        ISSN: 2168-0450            Impact factor:   1.936


Lophira Banks ex C. F. Gaertn. (Ochnaceae) is a genus of tropical trees endemic to Central and West Africa. Taxonomic treatments recognize two closely related species with similar morphology but well-differentiated habitats: a rainforest species, L. alata Banks ex C. F. Gaertn., and a savannah species, L. lanceolata Tiegh. ex Keay (Hutchinson and Dalziel, 1954; Aubreville, 1959; Bamps, 1970). The rainforest congener, L. alata, is a timber tree (azobé) of high economic value in Central Africa (Biwolé et al., 2012; Engone Obiang et al., 2012). Its timber is used for outdoor constructions such as harbors, hydraulic infrastructure, railways, and bridges (Palla et al., 2002). Despite its abundance in Cameroon, it is classified as a vulnerable species in the red list of the International Union for Conservation of Nature (IUCN, 2014) due to the massive logging pressure that currently affects its natural populations. In the contact zone between rainforest and savannah vegetation, the two species can be found in sympatry, and it has been hypothesized that hybridization may be occurring between them. In this study, we provide and characterize the first set of microsatellites for L. alata and test cross-amplification in two populations of L. lanceolata.

METHODS AND RESULTS

A microsatellite-enriched library was generated by Genoscreen genomic platform (Lille, France) for one sample of L. alata from central Gabon (OH2473; Appendix 1) pooled with DNA of three other species, following the methods of Malausa et al. (2011) and Micheneau et al. (2011). One milligram of genomic DNA was digested with RsaI, ligated to adapters, and amplified. PCR products were enriched with streptavidin-coated magnetic beads and 3′-biotinylated (AG)10, (AC)10, (AAC)8, (ACG)8, (AGC)8, (AAG)8, (ACAT)6, (ATCT)6 and subsequently amplified. A total of 14,207 reads were generated on a 454 GS FLX sequencer (454 Life Sciences, a Roche Company, Branford, Connecticut, USA). Using QDD (Méglecz et al., 2010), the Genoscreen genomic platform identified 1505 loci containing microsatellite motifs. Subsequently, primer sets were designed on 376 of the loci (multiple primer pairs per locus up to a total of 2615) giving 80–500-bp PCR products, with more than five repeats and with 50–64°C annealing temperature. Sixty-eight primer combinations, corresponding to loci with the longest di-, tri-, and tetranucleotide repeats and with a minimum distance of 10 bp from the microsatellite, were selected. The amplification of the 68 primer pairs was tested on seven geographically separated individuals of L. alata. Fluorescent labeling of primers was performed using three primers per locus: a reverse primer, a forward primer with a universal linker sequence (Q1, Q2, Q3, or Q4) at the 5′ end, and a third primer consisting of the same universal sequence Q1, Q2, Q3, or Q4, labeled with 6-FAM, NED, VIC, or PET, respectively (Schuelke, 2000; Micheneau et al., 2011). PCR amplifications were performed in 1.5 μL buffer (10×), 0.6 μL MgCl2 (25 mM), 0.45 μL dNPTs (10 mM each), forward primer at 0.07 μM, dye-labeled and reverse primers at 0.2 μM, 0.08 μL Taq polymerase (TopTaq DNA Polymerase, 5 U/μL [QIAGEN, Valencia, California, USA]), 1.5 μL of template DNA (of ca. 10–50 ng/μL), and H2O up to a final volume of 15 μL. Amplifications were performed as follows: 94°C (4 min); 25 cycles of 94°C (30 s), 55°C (45 s), 72°C (1 min); followed by 10 cycles each of 94°C (30 s), 53°C (45 s), 72°C (45 s); and a final extension at 72°C for 10 min. PCR products (0.8 μL) were separated on an ABI 3730 sequencer (Applied Biosystems, Lennik, Belgium) with 12 μL of HiDi and 0.3 μL of GeneScan 500 LIZ Size Standard (Applied Biosystems). Thirteen primer combinations exhibiting robust amplification, no stutter peaks, and polymorphism at the intraspecific level were selected (Table 1).
Table 1.

Description of 13 newly developed microsatellite loci in Lophira alata in two multiplex reactions LML11 and LMK13.

LocusPrimer sequences (5′–3′)Fluorescent labelaRepeat motifTa (°C)GenBank accession no.
LML11
 P12F: TTCCTCACCTTCTCCGTCACQ4-NED(CAC)1060KP666122
R: TGAGAGTTTGGTTGGTGGTG
 P24F: CACCGAAGCATCTTCCTCTCQ4-NED(CT)860KP666123
R: TACCCAATTCAGCACGTCAA
 P31F: CACATGCACACGCACTTGTAQ3-VIC(TTC)860KP666124
R: TGAGATCCACGGTAAGGTGA
 P44F: CTCCTTTCTCTTTCGTTTGTCCTQ2-NED(AC)1060KP666125
R: TGATTCGATCTTCGGGTTTC
 P53F: CCCTTGGAAACCAAACTCAAQ1-6-FAM(AC)960KP666126
R: GCAACATTATGAAGAAGGCAAA
 P66F: ATTGGACAAGCCTCAACTCGQ2-NED(AC)1260KP666127
R: GGGGTCGATAATCAAGGAGG
LMK13
 P18F: TGCAGTGCAAATCATTCAAQ2-NED(TTG)757KP666128
R: ATTCAATCACAACCAACGCA
 P34F: CCCTCTGTTGTCACCTCCATQ2-NED(TTC)957KP666129
R: GGAGCAAGAGGAAGCAAATG
 P36F: GACTTAAATAGAAACGTCAATAATAGCAQ1-6-FAM(ACA)1257KP666130
R: GGTTTGTTGAGTTCAATCATTGTT
 P40F: AAACAGGTTTGTGTCCCCTTTQ4-NED(GTT)757KP666131
R: CGAAGGGAGAATTGGAACC
 P47F: GGGGTACCACCATTTGGAGTQ1-6-FAM(AC)757KP666132
R: TTCCTATTTGTAGGACTTGGAGTT
 P51F: CATGTGCAGACATGCCATACTQ3-VIC(TG)757KP666133
R: ATTTGTAGGGCCTCAACCAG
 P62F: CCTCTTGCTCCTCCAAATCAQ2-NED(TC)857KP666134
R: TTGAAACATGACTTAAATGGATGTG

Note: Ta = annealing temperature.

Fluorescent label on forward primer. Q1 = TGTAAAACGACGGCCAGT (Schuelke, 2000), Q2 = TAGGAGTGCAGCAAGCAT, Q3 = CACTGCTTAGAGCGATGC, Q4 = CTAGTTATTGCTCAGCGGT (Q2–Q4, after Culley et al., 2008).

Description of 13 newly developed microsatellite loci in Lophira alata in two multiplex reactions LML11 and LMK13. Note: Ta = annealing temperature. Fluorescent label on forward primer. Q1 = TGTAAAACGACGGCCAGT (Schuelke, 2000), Q2 = TAGGAGTGCAGCAAGCAT, Q3 = CACTGCTTAGAGCGATGC, Q4 = CTAGTTATTGCTCAGCGGT (Q2–Q4, after Culley et al., 2008). Multiplex PCR containing six (LML11) and seven (LMK13) microsatellites were set up, taking care to avoid complementary primers and markers with identical dye and amplicon size in the same multiplex with the help of Multiplex Manager (Holleley and Geerts, 2009). Fluorescent labeling of primers was performed using three primers per locus: a reverse primer, a forward primer with one universal sequence (Q1, Q2, Q3 or Q4) at the 5′ end, and a third primer consisting of the same universal sequence Q1, Q2, Q3, or Q4, labeled with 6-FAM, NED, VIC, or PET, respectively (Schuelke, 2000; Micheneau et al., 2011). Type-it Microsatellite PCR Kit (QIAGEN) was used for amplification in a final volume of 14.5 μL containing: 1 μL DNA (approx. 5–20 ng), 7.5 μL Type-it Multiplex Mix, 0.1 μL of forward primers (final concentration of 0.07 μM), 0.15 μL of the reverse primers and labeled primers Q1, Q2, Q3, and Q4 (final concentration of 0.1 μM for each), and H2O. The PCR profile was: 95°C (5 min); followed by 20 cycles of 95°C (30 s), 57°C (180 s) for LMK13 or 60°C (90 s) for LML11, 72°C (30 s); followed by eight cycles of 94°C (30 s), 53°C (45 s), 72°C (45 s); and a final extension at 60°C (30 min). PCR products were run on an ABI 3730 (Applied Biosystems) with 12 μL of HiDi and 0.3 μL of GeneScan 500 LIZ Size Standard (Applied Biosystems). The resulting electropherograms were automatically scored with GeneMapper 3.7 (Applied Biosystems) and manually corrected. Individual genotypes exhibited one or two alleles per microsatellite locus, as expected for diploid organisms. To characterize the 13 microsatellite loci (Table 2), 33 individuals from a L. alata population in northwestern Cameroon (Pallisco) were genotyped. Allele sizes, number of alleles per locus, expected (He) and observed (Ho) heterozygosity, and inbreeding coefficient (FIS) were estimated with SPAGeDi 1.4 (Hardy and Vekemans, 2002). Linkage disequilibrium (LD) between each pair of loci was tested with GENEPOP 4.1.4 (Raymond and Rousset, 1995). Deviation from Hardy–Weinberg equilibrium (HWE) was tested for each locus using a χ2 test with GENEPOP, and permutation tests (999 permutations of alleles among individuals) were conducted with SPAGeDI. Transferability of the isolated primers to the savannah congener was tested in 26 individuals from two Cameroonian populations of L. lanceolata (Yong and Bango). The number of private alleles was calculated for each species.
Table 2.

Genetic properties of the 13 newly developed, polymorphic microsatellite loci in Lophira alata and cross-amplification results in two populations of L. lanceolata.[a,b]

Lophira lanceolata
Lophira alata (Pallisco, N = 33)Yong (N = 10)Bango (N = 16)
Allele size range (bp)AHeHoFISχ2Perm P valuePrivateAllele size range (bp)AAllele size range (bp)APrivate
LML11
 P12105–11930.310.300.031.0000.81221131105–12232
 P24147–15130.280.240.130.0360.4641147–15121511
 P31153–17660.690.73−0.050.2960.6724151–1582151–15831
 P44170–17830.260.090.640.0060.0053
 P53202–20420.330.34−0.051.0000.857196–2105202–21254
 P66271–28360.280.280.010.2070.8114269–2723267–27242
LMK13
 P18130–13750.700.510.270.0970.0181123–1374123–14052
 P34162–16520.390.270.300.1590.110160–1653160–16531
 P36148–17070.750.160.780.0000.0007
 P40171–18130.240.27−0.131.0000.55511711171–17931
 P47180–18430.240.040.850.0000.000180–2037180–21387
 P51192–19630.250.210.140.4680.3842191–1943189–19333
 P62255–26040.660.75−0.140.3910.2693253–2552253–25632

Note: A = number of alleles; FIS = inbreeding coefficient; He = expected heterozygosity; Ho = observed heterozygosity; N = number of individuals.

Tests for deviation from HWE: χ2 = P value for χ test; perm P value = P value for permutation of alleles among individuals (values P < 0.01 are set boldface); private = number of species-specific alleles.

See Appendix 1 for population locality information.

Genetic properties of the 13 newly developed, polymorphic microsatellite loci in Lophira alata and cross-amplification results in two populations of L. lanceolata.[a,b] Note: A = number of alleles; FIS = inbreeding coefficient; He = expected heterozygosity; Ho = observed heterozygosity; N = number of individuals. Tests for deviation from HWE: χ2 = P value for χ test; perm P value = P value for permutation of alleles among individuals (values P < 0.01 are set boldface); private = number of species-specific alleles. See Appendix 1 for population locality information. In the L. alata population, all 13 microsatellite loci were polymorphic (Table 2), with the number of alleles per locus ranging from two to seven. He varied between 0.24 and 0.75, and FIS between −0.14 and 0.85. Three loci (P36, P44, P47) significantly deviated from HWE (P < 0.01 in both χ2 and permutation tests) due to homozygosity excess (Table 2). Significant LD (P < 0.01) was found between loci P18 and P34. LD at P < 0.05 was detected between four pairs of loci (P62 and P40, P62 and P51, P18 and P31, and P51 and P31). Eleven microsatellite markers exhibited robust amplification in the two populations of L. lanceolata studied (Table 2), where one to eight alleles per locus were retrieved. All loci were polymorphic between the two L. lanceolata populations. P24 was monomorphic in the Bango population, whereas P12 and P40 were monomorphic in the Yong population. All loci except for three (P53, P34, and P47) exhibited private alleles for L. alata, whereas all but one (P24) exhibited specific alleles for L. lanceolata.

CONCLUSIONS

The 13 nuclear microsatellite loci optimized showed sufficient levels of variation to estimate genetic diversity levels in L. alata and L. lanceolata. These markers will be an important tool to assess how the Pleistocene climatic oscillations have shaped the genetic structure of the two species in Central African rainforests. In addition, the finding of species-specific alleles may help detect ongoing interspecific gene flow in the rainforest–savannah contact zone, where the two species can be found in sympatry.
Appendix 1.

Voucher information for Lophira populations characterized in this study.

Voucher no.SpeciesCollection localityaCollection datebCollectorLatitude (°N)Longitude (°E)
AS0055–59, AS0065–69L. lanceolataYong25/02/13Biwole A.6.2111.57
AS0099L. lanceolataBango26/02/13Biwole A.6.7611.84
AS0100, AS102–105L. lanceolataBango26/02/13Biwole A.6.7311.87
AS0101L. lanceolataBango26/02/13Biwole A.6.7311.88
AS0120L. lanceolataBango26/02/13Biwole A.6.7211.97
AS0121L. lanceolataBango26/02/13Biwole A.6.7211.98
AS0124L. lanceolataBango26/02/13Biwole A.6.7111.99
AS0128–129L. lanceolataBango26/02/13Biwole A.6.6712.04
AS0130L. lanceolataBango26/02/13Biwole A.6.6712.05
AS0135–137L. lanceolataBango26/02/13Biwole A.6.6612.06
AB0007L. alataPallisco08/08/12Biwole A.5.5299.012
AB0008L. alataPallisco08/08/12Biwole A.5.4979.060
AB0023L. alataPallisco08/08/12Biwole A.5.5269.011
AB0024L. alataPallisco08/08/12Biwole A.5.4939.069
AB0025L. alataPallisco08/08/12Biwole A.5.4969.059
AB0026L. alataPallisco08/08/12Biwole A.5.4929.068
AB0027L. alataPallisco08/08/12Biwole A.5.4949.068
AB0028L. alataPallisco08/08/12Biwole A.5.4959.065
AB0033L. alataPallisco08/08/12Biwole A.5.4958.952
AB0034L. alataPallisco08/08/12Biwole A.5.4958.953
AB0035L. alataPallisco08/08/12Biwole A.5.4948.948
AB0036L. alataPallisco08/08/12Biwole A.5.4958.953
AB0037L. alataPallisco08/08/12Biwole A.5.4938.948
AB0038L. alataPallisco08/08/12Biwole A.5.4878.947
AB0039L. alataPallisco08/08/12Biwole A.5.4908.948
AB0040L. alataPallisco08/08/12Biwole A.5.4928.950
AB0041L. alataPallisco08/08/12Biwole A.5.4948.949
AB0042L. alataPallisco08/08/12Biwole A.5.4908.950
AB0043L. alataPallisco08/08/12Biwole A.5.4888.943
AB0044L. alataPallisco08/08/12Biwole A.5.4958.952
AB0045L. alataPallisco08/08/12Biwole A.5.4878.946
AB0046L. alataPallisco08/08/12Biwole A.5.4958.951
AB0047L. alataPallisco08/08/12Biwole A.5.4898.949
AB0048L. alataPallisco08/08/12Biwole A.5.4938.949
AB0049L. alataPallisco08/08/12Biwole A.5.4888.949
AB0051L. alataPallisco08/08/12Biwole A.5.4888.947
NB0395L. alataPallisco08/08/12Biwole A.5.4928.950
NB0401L. alataPallisco08/08/12Biwole A.5.5549.053
NB0405L. alataPallisco08/08/12Biwole A.5.4938.949
NB0408L. alataPallisco08/08/12Biwole A.5.4918.952
NB0410L. alataPallisco08/08/12Biwole A.5.4918.952
NB0413L. alataPallisco08/08/12Biwole A.5.4898.949
OH2473cL. alataSavanne-Okondja15/10/09Hardy O.J.−0.65413.675

All collections are located in Cameroon except for OH2473 from central Gabon.

Collection date (day/month/year).

Seedling grown by Precious Woods Gabon, Compagnie Equatoriale des Bois S.A. The geographical coordinates correspond to the mother plant and are approximate.

  6 in total

1.  An economic method for the fluorescent labeling of PCR fragments.

Authors:  M Schuelke
Journal:  Nat Biotechnol       Date:  2000-02       Impact factor: 54.908

2.  QDD: a user-friendly program to select microsatellite markers and design primers from large sequencing projects.

Authors:  Emese Meglécz; Caroline Costedoat; Vincent Dubut; André Gilles; Thibaut Malausa; Nicolas Pech; Jean-François Martin
Journal:  Bioinformatics       Date:  2009-12-10       Impact factor: 6.937

3.  High-throughput microsatellite isolation through 454 GS-FLX Titanium pyrosequencing of enriched DNA libraries.

Authors:  Thibaut Malausa; André Gilles; Emese Meglécz; Hélène Blanquart; Stéphanie Duthoy; Caroline Costedoat; Vincent Dubut; Nicolas Pech; Philippe Castagnone-Sereno; Christophe Délye; Nicolas Feau; Pascal Frey; Philippe Gauthier; Thomas Guillemaud; Laurent Hazard; Valérie Le Corre; Brigitte Lung-Escarmant; Pierre-Jean G Malé; Stéphanie Ferreira; Jean-François Martin
Journal:  Mol Ecol Resour       Date:  2011-02-21       Impact factor: 7.090

4.  Development and characterization of microsatellite loci in Pericopsis elata (Fabaceae) using a cost-efficient approach.

Authors:  Claire Micheneau; Gilles Dauby; Nils Bourland; Jean-Louis Doucet; Olivier J Hardy
Journal:  Am J Bot       Date:  2011-09-16       Impact factor: 3.844

5.  Multiplex Manager 1.0: a cross-platform computer program that plans and optimizes multiplex PCR.

Authors:  Clare E Holleley; Paul G Geerts
Journal:  Biotechniques       Date:  2009-06       Impact factor: 1.993

6.  Characterization of microsatellite loci in the Hawaiian endemic shrub Schiedea adamantis (Caryophyllaceae) and amplification in related species and genera.

Authors:  T M Culley; S G Weller; A K Sakai; K A Putnam
Journal:  Mol Ecol Resour       Date:  2008-06-28       Impact factor: 7.090

  6 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.