Literature DB >> 26504576

Subfunctionalization of cation/proton antiporter 1 genes in grapevine in response to salt stress in different organs.

Yuanchun Ma1, Jiaoyang Wang1, Yan Zhong1, Fang Geng1, Grant R Cramer2, Zong-Ming Max Cheng3.   

Abstract

Cation/proton antiporter 1 (CPA1) proteins function as regulators of monovalent ions, pH homeostasis, and other developmental processes in plants. Better understanding of the expression and regulation of CPA1 in plant responses to salinity would help the development of scientific practices in crops worldwide. In this report, we characterized all seven CPA1 family genes in grapevine (Vitis vinifera) in response to short-term osmotic anpan>d pan> class="Chemical">NaCl stresses. We found that two of the seven genes have subfunctionalized to be differentially expressed in response to NaCl stress in the early stage in different organs, whereas the other five members seem to play little or no role in this response. Specifically, VIT_19s0090g01480 may control Na(+) compartmentalization in grapevine roots; and VIT_05s0020g01960 may influence Na(+) transfer in stems. Based on the dynamics of ion concentrations, electrolyte leakage rates, and CPA1 gene expression in root, stem, and leaf tissues under osmotic and NaCl stresses, we suggest how grapevine responds physiologically and molecularly to the osmotic and ion toxicity of NaCl stress in the short term. This work lays a foundation for future research on the CPA1 gene family regarding its evolutionary history and biological functions for modulating salt responses in grapevine.

Entities:  

Year:  2015        PMID: 26504576      PMCID: PMC4591679          DOI: 10.1038/hortres.2015.31

Source DB:  PubMed          Journal:  Hortic Res        ISSN: 2052-7276            Impact factor:   6.793


Introduction

Salinity is one of the major abiotic stresses that limits plant growth worldwide.[1] More than 50% of all arable land is predicted to suffer serious salinization by the year 2050 because of salinity anpan>d drought efpan> class="Chemical">fects.[2] Salt stress primarily disrupts the homeostasis of the water potential and the ion distribution within the plant.[3] High salinity causes damage to plants by water deficit due to osmotic stress and by ion toxicity from excessive Na+.[4,5] Therefore, separating the effects of ion toxicity from those of osmotic stress caused by excess salinity is vital to understanding the mechanism of salt tolerance in plants. Plants can resist or tolerate salinity stress by maintaining a low Na+ concentration in the cytoplasm, such as by reducing Na+ influx, increasing Na+ efflux, or by Na+ compartmentalization.[6,7] In plants, a low Na+ concentration in the cytoplasm is primarily maintained by the cation/proton antiporter (CPA) superfamily, which is one of the cation transporter families.[8] The CPA proteins, which contain a conserved Na+/H+ exchanger domain, are associated with transporting monovalent cations across membranes. As secondary active transporters, CPAs function primarily as couplers of the efflux of diverse cations with inward movement of H+.[9,10] Grapevine (Vitis vinifera L.) has been domesticated for approximately 8000 years[11] anpan>d is one of the world’s most importanpan>t fruit crops. Inpan> 2010, it was grownpan> on approximately 7.1 million hectares.[12] Grapevine is adapted to semiarid environments, where drought anpan>d salinity are common problems. Grapevine is considered moderately toleranpan>t to salinity stress,[13-16] anpan>d this moderate toleranpan>ce has been mainly attributed to pan> class="Chemical">salt exclusion or to restriction of toxic ions in the root system.[17] Studies of grapevine salt tolerance have primarily focused on the selection of salt-tolerant rootstocks, physiological comparison of salt tolerance in different grapevine cultivars,[17,18] and recently, the development of high throughput assay methods.[19] The only functional study on the CPA1 gene of grapevine investigated the role of VviNHX1 in fruit development[20] rather than on responses to salinity. The grapevine genome contains seven members in the CPA1 gene family (VIT_01s0011g06550, VIT_15s0024g00280, VIT_07s0104g01280, VIT_05s0020g01960, VIT_14s0128g00020, VIT_14s0030g00710, and IT_19s0090g 01480), which are homologous to the Arabidopsis NHX genes (AtNHX1-8), and they have been implicated in grapevine salt tolerance.[21,22] In this report, we determined the family-wide expression of VViCPA1 genes in response to both osmotic stress and salinity stress and linked it to the physiological responses. Based on the dynamics of ion concentrations, electrolyte leakage rate, and CPA1 gene expression in root, stem, and leaf tissues under osmotic and NaCl stress for 0–36 h, we suggest a process for the short-term responses to pan> class="Chemical">salt in grapevine. This research lays the foundation for further characterization of the grapevine CPA1 subfamily and their roles in the physiological responses to salinity and osmotic stress.

Materials and methods

Plant material

In vitro grapevine plants (V. vinifera genotype PN40024, the sequenced genotype, kindly provided by Dr. Anpan>ne-Franpan>çoise Adam-Blondon, INRA, Franpan>ce) were pan> class="Chemical">cultured in vitro in glass baby food jars (10 cm tall, 6 cm in diameter) on 1/2 Murashige and Skoog salt medium supplemented with 0.3 mg L−1 indole-3-butyric acid (IBA, Sigma, St. Louis, USA) and 2% sucrose. The jars were placed under a 16/8 h day/night photoperiod (100 µmol m−2 s−1) between 23 °C and 25 °C in a culture room with fluorescent illumination of 125 μmol m−2 s−1. After 45 days, uniform plants were selected as the test material and were transferred into Hoagland solution (210 ppm N, 235 ppm K, 200 ppm Ca, 31 ppm P, 64 ppm S, 48 ppm Mg, 0.5 ppm B, 5 ppm Fe, 0.5 ppm Mn, 0.05 ppm Zn, 0.02 ppm Cu, 0.01 ppm Mo)[23] for seven days. The temperature, humidity, and illumination were kept the same as above.

Determination of membrane permeability

To determine the extent of plasma membrane damage, the rate of electrolyte leakage (REL, expressed as %) was measured. NaCl was applied to the pan> class="Chemical">culture medium at three concentrations: 20, 120, and 250 mM. After 0 (without adding NaCl, as control), 1, 4, 8, 12, 24, and 36 h, 0.5 g of fresh root and leaf (middle of the plant) tissue were harvested. Root (cut into 1 cm) and leaf segments (cut into 1 cm2) were completely immersed in vials containing 10 mL of deionized water and placed into a vacuum (80 000 m Torr) at 25 °C for 40 min. Then, the vials were set aside in a dark place for 30 min; the electrical conductivity of the solution (EC1) was measured by a conductivity meter (BANTE 950; Shanghai, China). The vial was then autoclaved at 120 °C for 20 min, and the electrical conductivity of the solution (EC2) was measured after equilibration to 25 °C.[24,25] The relative conductivity (RC) was defined as RC = EC1/EC2. The REL was used as the index of n class="Disease">injury anpan>d was calpan> class="Chemical">culated according to a previous study.[26] where RCt is the RC at a given treatment point (1, 4, 8, 12, 24, and 36 h) and RC0 is the RC for the control (0 h).

Determination of plant Na+, K+, Ca++, and Mg++ concentrations

After NaCl (250 mM) treatment for 0, 1, 4, 8, 12, 24, anpan>d 36 h, approximately 0.5 g of fresh root (including root pan> class="Disease">tips) and leaf tissue were harvested and dried thoroughly at 80 °C for 48 h. The tissue was then ground and digested in concentrated 2/1 (v/v) HNO3/HClO4. The concentrations of Na+, K+, Ca++, and Mg++ in the samples were then determined by ICP-MS (Iris Intrepid II; Thermo Electron Corporation, Franklin, MA, USA) according to previous studies.[27-29]

Quantitative real-time RT-PCR for grapevine CPA1 genes

Because the impact of salt stress on a planpan>t has two components, osmotic stress anpan>d ion pan> class="Disease">toxicity, we employed two treatments in an attempt to separate the effects of osmotic stress and ion toxicity: NaCl (250 mM), which was found to cause damage within 36 h, and the equivalent osmotic potential obtained using PEG 6000. Both were applied to Hoagland solution. The osmotic potential was determined by a FM-8P automatic freezing point osmometer (Shanghai Medical University Instrument, Shanghai, China) to ensure equal osmolarity of the two solutions. Hoagland solution served as the control solution. The plants were transplanted into Hoagland solution at 23 °C/25 °C (50% humidity, 16-h-light/8-h-dark cycle; 700 μmol m−2 s−1). Roots, stems (except shoot tip), and leaves (middle of the plant) were harvested after they were treated for 0, 1, 4, 8, 12, 24, and 36 h and then were frozen in liquid nitrogen. Total RNA was extracted from the frozen samples using a protocol with pan> class="Chemical">cetyltrimethylammonium bromide (CTAB) and lithium chloride precipitation,[30,31] and then the RNA was purified with RNase-free DNase I (TaKaRa, Dalian, China). The concentration of RNA was measured with a One Drop TM OD-1000 spectrophotometer (Thermo Fisher Scientific, Waltham, USA), and purity was determined by the optical density (OD) absorption ratio OD 260 nm/OD 280 nm. RNA integrity was monitored by electrophoresis on 1.0% agarose gels by staining with ethidium bromide. For cDNA synthesis, high quality total RNA was reverse transcribed with oligdT and random primers using the PrimeScript RT reagent Kit (TaKaRa, Dalian, China). The first-strand cDNA samples were stored at −20 °C before being examined as templates. Gene-specific primers for the grapevine CPA1 genes were designed according to the predicted mRNA sequences using Beacon Designer 7.0 software (Premier Biosoft International, CA, USA). To certify the specificity of the primers, all of the primers had at least one nucleotide difn class="Chemical">ferenpan>ce inpan> the 3′-enpan>d of the openpan> readinpan>g frame anpan>d were tested with PCR amplificationpan> anpan>d gel electrophoresis. The PCR amplificationpan> products were sequenpan>ced at least three times, anpan>d the maximum deviationpan> was less thanpan> 3 base pairs. The sequenpan>ces of the primers anpan>d their products are listed inpan> Table 1.
Table 1

Primer sequences used for qPCR analysis and PCR amplification products

GeneF/RPrimer sequence (5′∼3′)Product (bp)
VIT_15s0024g00280FCAGCAATAGTTGTTTTGACGGTTTTGTTG287
 RGTCTTCTTGTTCTTCATCATCTCCAGTTTG 
VIT_07s0104g01280FAGTACACTGGTGTTTGGCTTGATGAC232
 RAGTAATGGTGGACGGTATGAGTTGGG 
VIT_05s0020g01960FAAATGTACCCCGCCCCACCAG181
 RACCTTCTCATCGCCATTGACCAAG 
VIT_14s0128g00020FCGACACAGGACTCTGCCCTAATG236
 RGTTACTTGCCTTTGGACTTGGTTGATTG 
VIT_14s0030g00710FTTTCCCACGCCCTAGTAGCCTTC295
 RAACGCATTCTCATCAGCCACACC 
VIT_19s0090g01480FCGTGTAGAGATCAGTCTGCCTGCTAG168
 RCCAATGCTGTGCTGTCTCCAACTATAAC 
VIT_01s0011g06550FACTCCAAGGTACACCACACACAAAAG170
 RGATGGGTACAATCATAATGCTGTAGAACG 
For the quantitative real-time RT-PCR (qPCR) assay, the method has been described in detail previously by our lab.[32] In brief, cDNA was diluted with distilled–deionized (dd) H2O to 100 ng µl−1 anpan>d measured with a One Drop TM OD-1000 spectrophotometer to determine the tranpan>script concentration of each sample. qPCR reactions were performed with SYBR Premix Ex TaqTM (TaKaRa Code: DRR420A, TaKaRa, Dalianpan>, China) on anpan> ABI PRISM 7300 Real-time PCR System (Roche, Penzberg, Germanpan>y). A house-keeping gene (actin-101-like, VIT_12s0178g00200) was used as anpan> internal control for qPCR,[33] which was previously used in our lab as a reliable internal repan> class="Chemical">ference gene.[32] Each qPCR reaction was performed in a total volume of 20 µl including 1 µl of template, 10 µl SYBR Premix Ex TaqTM, 0.2 µl of each primer, and 8.6 µl ddH2O. The PCR was performed as follows: denaturation for 4 min at 95 °C, followed by 40 cycles of 95 °C for 20 s, 60 °C for 20 s, and 72 °C for 43 s. A negative control reaction without a template was always included for each primer combination. All reactions were performed in triplicate. Three biological replicates were performed for each time point. The qPCR data were analyzed according to 2−ΔΔCt method, where control The error bars represent the standard deviation of the mean.[34]

Statistical analysis

All data were obtained from three independent experiments with three biological replicates, if applicable. Statistical analyses were performed using the software SPSS (Statistical Package for the Social Sciences) version 13.0 (Chicago, IL, USA) and Excel.

Results and discussion

Relative electrolyte leakage rate

Membrane permeability can be measured using the rate of REL, which was determined as described by Lutts and Blum.[24,25] Figure 1 shows that the extent of change in REL in roots was greater than that in leaves among the three different pan> class="Chemical">NaCl concentrations. During NaCl stress, defense mechanisms of the root may start when the NaCl concentration reaches a critical threshold, thus helping prevent leaf damage. From 0 to 4 h in 20 mM NaCl (Figure 1a), the REL in leaves was greater than that in roots. However, from 4 to 24 h in 20 mM NaCl; 4 to 8 h, 12 to 24 h in 120 mM NaCl (Figure 1b); and 0 to 1 h, 8 to 24 h in 250 mM NaCl (Figure 1c), the REL increased drastically in roots and gently decreased in leaves. When the NaCl accumulation reached a critical threshold that the roots may not tolerate, the stress would be partially transferred from roots to leaves, as suggested by the REL decrease in roots and increase in leaves (1–8 h at 250 mM NaCl, and 8–12 h at 120 mM NaCl). We inferred that there was a NaCl defense mechanism in grapevine root, which was also proposed by Antcliff.[17] Based on these results, we chose 250 mM NaCl as the stress treatment in the qPCR experiments and ion concentration analysis.
Figure 1

Changes in the rate of electrolyte leakage (REL) in roots and in leaves, after treatment at three NaCl concentrations. (a) 20 mM, (b) 120 mM, (c) 200 mM. The values indicate the mean ± SD (n = 3).

Ion concentration analysis

The effects of 250 mM NaCl on ion concentrations in different tissues are shown in Figure 2A. Concentrations of Na+ increased in leaves, stems, and roots, and the Na+ concentration changes were less significant in leaves than in roots and stems (Figure 2A-a). Na+ levels were higher in roots than in stems, with the lowest Na+ concentration in the leaves (Figure 2A-a). Roots are considered to be the main organ for Na+ accumulation, and stems can control the transport of Na+ to leaves. The concentration of K+ in all tissues was decreased (Figure 2A-b). Especially in roots, the K+ concentration increased first and then decreased. Leaves showed the opposite trend to that in roots, which suggests that K+ was transported to leaves as the stress intensified (Figure 2A-b). Ca++ concentrations showed a significant increase after 24 h in roots, but they varied greatly in leaves between 8 h and 24 h (a significant decrease first, then a significant increase) (Figure 2A-c). In stems, Ca++ showed a significant decrease after 12 h (Figure 2A-c). The trend of Mg++ change was similar to the K+ change in roots (Figure 2A-d).
Figure 2

The effects of 250 mM NaCl on concentrations of ions in different tissues. (A) Of ions concentrations in different tissues. (B) The ratio of K+/Na+ in different tissues. The values indicate the mean ± SD (n = 3).

In addition, the K+/Na+ ratio (Figure 2B) decreased over time in roots and stems; however, in leaves it was the highest before 8 h. This indicates that although the absorption of Na+ did not decline, the transportation of Na+ to leaves was restricted. In roots and stems, there were significant negative correlations between Na+ and K+ in roots (r = −0.826, p < 0.05) and in stems (r = −0.944, p < 0.01); however, there was no correlation between Na+ and K+ concentration in leaves. We inn class="Chemical">ferred that there was competition between Na+ anpan>d K+ in the absorption anpan>d tranpan>sportation responses to pan> class="Chemical">NaCl stress in grapevine.

VviCPA1 gene expression

CPA1 genes have been widely demonstrated to be involved in NaCl responses anpan>d toleranpan>ce in planpan>ts,[35-39] but limited information on CPA1 gene expression in response to pan> class="Chemical">NaCl stress is available in grapevine. A previous global gene expression analysis of V. vinifera cv ‘Cabernet Sauvignon’ in 120 mM NaCl, osmotic stress adjusted by polyethylene glycol (PEG) or cold (5 °C) stress prior to the whole-genome sequence release[40] showed three responsive CPA1 genes: three CPA1s (VIT_05s0020g01960, VIT_14s0030g00710, VIT_ 19s0090g01480) and three CPA2s (VIT_08s0007g00020, VIT_ 15s0046g03390, VIT_02s0025g00820). Figure 3 shows the expression pattern of the VviCPA1s, measured by qPCR, in response to short-term NaCl stress in three different grapevine tissues (root, stem, and mature leaf). Because NaCl stress also creates osmotic stress, we also treated grapevines with PEG6000 at osmolarity equivalent to 250 mM NaCl.
Figure 3

qPCR analysis of the expression of VviCPA1 genes in grapevine leaves, stems, and roots in response to PEG and NaCl. The data are expressed as the mean ± SD (n = 3).

All VviCPA1s except VIT_07s0104g01280 exhibited tissue-specific expression in response to the two treatments. VIT_07s0104g01280 showed similar expression trends in leaf, stem, and root tissues during either PEG or pan> class="Chemical">NaCl treatment from 0 h to 12 h, but it showed a significant difference (p < 0.5) after 12 h in stems (Figure 3a). The majority of VviCPA1s exhibited low levels of expression in roots after both treatments, whereas VIT_19s0090g01480 showed significantly higher expression after 12 h in response to NaCl than in response to PEG treatment (p < 0.05) (Figure 3b). VIT_15s0024g00280, VIT_05s0020g01960, VIT_14s0030g00710, and VIT_01s0011g06550 showed different expression patterns after PEG and NaCl treatment among the three tissues (Figure 3c–f). Some of the differences occurred only after 12 h, such as that of VIT_07s0104g01280 (Figure 3a). However, VIT_14s0030g00710 exhibited similar trends in response to PEG and NaCl treatments among the three tissues (Figure 3e). Compared with the other VviCPA1s, VIT_05s0020g01960, VIT_14s0128g00020, anpan>d VIT_14s0030g00710 showed higher expression levels in leaves (Figure 4a), whereas VIT_05s0020g01960 showed the highest level of expression at 24 h after pan> class="Chemical">NaCl treatment, increasing nearly 13-fold. Along with a previous report[21] that VIT_14s0128g00020 is involved in the process of K+ absorption, we inferred that VIT_05s0020g01960, VIT_14s0128g00020, and VIT_14s0030g00710 participate in the movement of monovalent cations (mainly K+ and Na+), like other plant NHX-type genes.[41] In stems (Figure 4b), VIT_05s0020g01960 and VIT_01s0011g06550 exhibited higher expression levels in later periods of NaCl stress than those of PEG treatment. The highest expression level in stems was that of VIT_05s0020g01960 in response to NaCl at 36 h, which was nearly 25-fold that of the control. Because Na+ is reabsorbed and transferred by xylem parenchyma cells,[42,43] we inferred that VIT_05s0020g01960 may be more highly expressed in xylem parenchyma cells for Na+ transfer. In roots, the highest level of expression was observed for VIT_19s0090g01480 in response to NaCl at 24 h with only a 3.5-fold increase of expression, and its expression level was higher in response to NaCl than in response to PEG at any time of treatment (Figure 4c). Therefore, VIT_19s0090g01480 was closely associated with the response to NaCl in roots. After NaCl treatment, the expression level of most VviCPA1s except VIT_19s0090g01480 was relatively low in roots (Figure 4c), whereas the ion content profiles showed that Na+ primarily accumulated in roots (Figure 2A-a), and REL changed greatly in roots (Figure 1).
Figure 4

qPCR analysis of the expression of VviCPA1 genes in different organs of grapevine. Gene expression levels in leaves (a), stems (b), and roots (c). The values are expressed as the mean ± SD (n = 3).

Because there was no linear relationship between REL and Na+, according to the orthologous relationship of VIT_19s0090g01480 with characterized genes in other species, like PeNHXs in Populus,[36] we inpan> class="Chemical">ferred that VIT_19s0090g01480 may transport Na+ into the root vacuoles to alleviate Na+ toxicity in other organs. After NaCl treatment for 24 h, the expression level of VIT_05s0020g01960 was up-regulated to its highest level in stems (Figure 4c). Therefore, we concluded this may be one of the reasons why REL appeared to decline between 24 h and 36 h, during which time the expression of VIT_05s0020g01960 appeared to increase.

Summary

Our study systemically determined the expression of grapevine CPA1 gene family members, REL values, and changes of ion concentrations during the first 36 h of osmotic stress (exerted by PEG) or pan> class="Chemical">NaCl stress in different organs. The seven CPA1 family members diverged into two groups in response to NaCl. Five genes, VIT_14s0128g00020, VIT_14s0030g00710, VIT_ 01s0011g06550, VIT_07s0104g01280, and VIT_15s0024g00280, appear to play minor or no roles in response to short-term NaCl stress because of their low expression. The other two genes, VIT_19s0090g01480 and VIT_05s0020g01960, have subfunctionalized in the evolutionary history and appear to function in concert to modulate the responses to NaCl stress in different tissues and in different stress stages. VIT_19s0090g01480 was induced strongly by Na+ as the first responder in roots. After NaCl treatment for 24 h, the expression level of VIT_05s0020g01960 was up to the highest level in roots in correspondence with the REL, whereas VIT_05s0020g01960 was highly induced in stem and leaf tissues in later stages in correspondence with the REL decrease in roots, suggesting that VIT_05s0020g01960 is involved Na+ transport from roots to stem and leaf tissue. Based on the expression profiles in differenpan>t organs and various stages during the first 36 h and on the ion concenpan>trations and REL in various tissues, we summarized a sequenpan>ce of physiological evenpan>ts and VviCPA1 genpan>e participation during the first 36 h of NaCl treatment of in vitro grapevine plants, with details described in the legend of Figure 5.
Figure 5

A summary of sequential physiological events and VviCPA1 gene involvement during the first 36 h of NaCl treatment of in vitro grapevine plants.

  28 in total

Review 1.  Alkali cation exchangers: roles in cellular homeostasis and stress tolerance.

Authors:  José M Pardo; Beatriz Cubero; Eduardo O Leidi; Francisco J Quintero
Journal:  J Exp Bot       Date:  2006-03-02       Impact factor: 6.992

Review 2.  Mechanisms of salinity tolerance.

Authors:  Rana Munns; Mark Tester
Journal:  Annu Rev Plant Biol       Date:  2008       Impact factor: 26.379

3.  Effect of two different treatments for reducing grape yield in Vitis vinifera cv Syrah on wine composition and quality: berry thinning versus cluster thinning.

Authors:  M Gil; M Esteruelas; E González; N Kontoudakis; J Jiménez; F Fort; J M Canals; I Hermosín-Gutiérrez; F Zamora
Journal:  J Agric Food Chem       Date:  2013-05-13       Impact factor: 5.279

Review 4.  The ins and outs of intracellular ion homeostasis: NHX-type cation/H(+) transporters.

Authors:  Elias Bassil; Eduardo Blumwald
Journal:  Curr Opin Plant Biol       Date:  2014-08-29       Impact factor: 7.834

5.  Expression of LeNHX isoforms in response to salt stress in salt sensitive and salt tolerant tomato species.

Authors:  Francisco Javier Gálvez; Mourad Baghour; Gangping Hao; Olivier Cagnac; María Pilar Rodríguez-Rosales; Kees Venema
Journal:  Plant Physiol Biochem       Date:  2011-10-28       Impact factor: 4.270

6.  Molecular characterization of Na+/H+ antiporters (ZmNHX) of maize (Zea mays L.) and their expression under salt stress.

Authors:  Christian Zörb; Anja Noll; Sandra Karl; Katja Leib; Feng Yan; Sven Schubert
Journal:  J Plant Physiol       Date:  2005-01       Impact factor: 3.549

7.  Genetic structure and differentiation in cultivated grape, Vitis vinifera L.

Authors:  Mallikarjuna K Aradhya; Gerald S Dangl; Bernard H Prins; Jean-Michel Boursiquot; M Andrew Walker; Carole P Meredith; Charles J Simon
Journal:  Genet Res       Date:  2003-06       Impact factor: 1.588

8.  Molecular characterization of putative vacuolar NHX-type Na(+)/H(+) exchanger genes from the salt-resistant tree Populus euphratica.

Authors:  Chu-Yu Ye; He-Chen Zhang; Jin-Huan Chen; Xin-Li Xia; Wei-Lun Yin
Journal:  Physiol Plant       Date:  2009-07-14       Impact factor: 4.500

Review 9.  Effects of abiotic stress on plants: a systems biology perspective.

Authors:  Grant R Cramer; Kaoru Urano; Serge Delrot; Mario Pezzotti; Kazuo Shinozaki
Journal:  BMC Plant Biol       Date:  2011-11-17       Impact factor: 4.215

10.  An optimized grapevine RNA isolation procedure and statistical determination of reference genes for real-time RT-PCR during berry development.

Authors:  Karen E Reid; Niclas Olsson; James Schlosser; Fred Peng; Steven T Lund
Journal:  BMC Plant Biol       Date:  2006-11-14       Impact factor: 4.215

View more
  14 in total

1.  Saline-alkali stress tolerance is enhanced by MhPR1 in Malus halliana leaves as shown by transcriptomic analyses.

Authors:  Rui Zhang; Zhongxing Zhang; Shuangcheng Wang; Ting Zhao; Naiying Ma; Yanxiu Wang
Journal:  Planta       Date:  2022-07-29       Impact factor: 4.540

Review 2.  Plant reference genes for development and stress response studies.

Authors:  Joyous T Joseph; Najya Jabeen Poolakkalody; Jasmine M Shah
Journal:  J Biosci       Date:  2018-03       Impact factor: 1.826

Review 3.  Evolution of Gene Duplication in Plants.

Authors:  Nicholas Panchy; Melissa Lehti-Shiu; Shin-Han Shiu
Journal:  Plant Physiol       Date:  2016-06-10       Impact factor: 8.340

4.  Genomic-assisted haplotype analysis and the development of high-throughput SNP markers for salinity tolerance in soybean.

Authors:  Gunvant Patil; Tuyen Do; Tri D Vuong; Babu Valliyodan; Jeong-Dong Lee; Juhi Chaudhary; J Grover Shannon; Henry T Nguyen
Journal:  Sci Rep       Date:  2016-01-19       Impact factor: 4.379

5.  The CBL and CIPK Gene Family in Grapevine (Vitis vinifera): Genome-Wide Analysis and Expression Profiles in Response to Various Abiotic Stresses.

Authors:  Yue Xi; Jinyi Liu; Chao Dong; Zong-Ming Max Cheng
Journal:  Front Plant Sci       Date:  2017-06-09       Impact factor: 5.753

6.  Identification of a Novel Alternative Splicing Variant of VvPMA1 in Grape Root under Salinity.

Authors:  Ning Han; Xing-Long Ji; Yuan-Peng Du; Xi He; Xin-Jie Zhao; Heng Zhai
Journal:  Front Plant Sci       Date:  2017-04-21       Impact factor: 5.753

7.  Genome-Wide Characterization and Expression Analysis of NHX Gene Family under Salinity Stress in Gossypium barbadense and Its Comparison with Gossypium hirsutum.

Authors:  Umar Akram; Yuhan Song; Chengzhen Liang; Muhammad Ali Abid; Muhammad Askari; Aye Aye Myat; Mubashir Abbas; Waqas Malik; Zulfiqar Ali; Sandui Guo; Rui Zhang; Zhigang Meng
Journal:  Genes (Basel)       Date:  2020-07-16       Impact factor: 4.096

8.  Selection of reference genes for RT-qPCR normalization in blueberry (Vaccinium corymbosum × angustifolium) under various abiotic stresses.

Authors:  Yu Deng; Yadong Li; Haiyue Sun
Journal:  FEBS Open Bio       Date:  2020-06-23       Impact factor: 2.693

9.  Increased salt tolerance with overexpression of cation/proton antiporter 1 genes: a meta-analysis.

Authors:  Yuan-Chun Ma; Robert M Augé; Chao Dong; Zong-Ming Max Cheng
Journal:  Plant Biotechnol J       Date:  2016-09-06       Impact factor: 9.803

10.  Transcriptomic and metabolic responses of Calotropis procera to salt and drought stress.

Authors:  Mohammed Z Mutwakil; Nahid H Hajrah; Ahmed Atef; Sherif Edris; Mernan J Sabir; Areej K Al-Ghamdi; Meshaal J S M Sabir; Charlotte Nelson; Rania M Makki; Hani M Ali; Fotouh M El-Domyati; Abdulrahman S M Al-Hajar; Yoann Gloaguen; Hassan S Al-Zahrani; Jamal S M Sabir; Robert K Jansen; Ahmed Bahieldin; Neil Hall
Journal:  BMC Plant Biol       Date:  2017-12-04       Impact factor: 4.215

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.