Literature DB >> 26489754

Mitochondrial genomes and comparative analyses of Culex camposi, Culex coronator, Culex usquatus and Culex usquatissimus (Diptera:Culicidae), members of the coronator group.

Bruna Demari-Silva1, Peter G Foster2, Tatiane M P de Oliveira3, Eduardo S Bergo4, Sabri S Sanabani5, Rodrigo Pessôa6, Maria Anice M Sallum7.   

Abstract

BACKGROUND: The Coronator Group currently encompasses six morphologically similar species (Culex camposi Dyar, Culex coronator Dyar and Knab, Culex covagarciai Forattini, Culex usquatus Dyar, Culex usquatissimus Dyar, and Culex ousqua Dyar). Culex coronator has been incriminated as a potential vector of West Nile Virus (WNV), Saint Louis Encephalitis Virus (SLEV), and Venezuelan Equine Encephalitis Virus (VEEV). The complete mitochondrial genome of Cx. coronator, Cx. usquatus, Cx.usquatissimus, and Cx. camposi was sequenced, annotated, and analyzed to provide genetic information about these species.
RESULTS: The mitochondrial genomes of Cx. coronator, Cx. usquatus, Cx.usquatissimus, and Cx. camposi varied from 15,573 base pairs in Cx. usquatus to 15,576 in Cx. coronator. They contained 37 genes (13 protein-encoding genes, 2 rRNA genes, and 22 tRNA genes) and the AT-rich control region. Comparative analyses of the 37 genes demonstrated the mitochondrial genomes to be composed of variable and conserved genes. Despite the small size, the ATP8, ATP6 plus NADH5 protein-encoding genes were polymorphic, whereas tRNAs and rRNAs were conserved. The control region contained some poly-T stretch. The Bayesian phylogenetic tree corroborated that both the Coronator Group and the Culex pipens complex are monophyletic taxa.
CONCLUSIONS: The mitochondrial genomes of Cx. coronator, Cx. usquatus, Cx. usquatissimus and Cx. camposi share the same gene composition and arrangement features that match to those reported for most Culicidae species. They are composed of the same 37 genes and the AT-rich control region, which contains poly-T stretches that may be involved in the functional role of the mitochondrial genome. Taken together, results of the dN/dS ratios, the sliding window analyses and the Bayesian phylogenetic analyses suggest that ATP6, ATP8 and NADH5 are promising genes to be employed in phylogenetic studies involving species of the Coronator Group, and probably other species groups of the subgenus Culex. Bayesian topology corroborated the morphological hypothesis of the Coronator Group as monophyletic lineage within the subgenus Culex.

Entities:  

Mesh:

Substances:

Year:  2015        PMID: 26489754      PMCID: PMC4618934          DOI: 10.1186/s12864-015-1951-0

Source DB:  PubMed          Journal:  BMC Genomics        ISSN: 1471-2164            Impact factor:   3.969


Background

Culex camposi Dyar, Culex coronator Dyar and Knab, Culex covagarciai Forattini, Culex ousqua Dyar, Culex usquatus Dyar and Culex usquatissimus Dyar are members of the Coronator Group of the subgenus Culex [1]. Morphological features of the fourth-instar larva, pupa and female cannot distinguish among species of the Coronator Group. However, traits of the male genitalia allow species identification. Species of the Coronator Group are largely distributed and some are sympatric in the Neotropics [2]. In southeastern Brazil, for instance, the geographical distribution of Cx. usquatus, Cx. coronator and Cx. camposi overlaps [1]. Phylogenetic relationships among the species remain unresolved, because results of studies employing DNA sequences of the cytochrome c oxidase subunit 1 (COX1) mitochondrial gene [3, 4] and of the internal transcribed spacer 2 (ITS2) of the ribosomal DNA [5] showed poorly supported clades. Likely because of the lack of studies, there is no evidence of hybridization among species of the Coronator Group. Culex coronator is a potential vector of arboviruses. As such, this species may participate in the dynamics of the transmission of the Saint Louis Encephalitis Virus (VESL), the Venezuelan Equine Encephalitis Virus (VEEV), the Mucambo Virus (MV) [6, 7], and the West Nile Virus (WNV) [8]. Experiments of susceptibility of Cx. coronator to the WNV showed that the population from Florida, USA, is competent in disseminating the WN-FL03p2-3 strain under some conditions; however, the transmission rate decreases at lower temperatures (0–17 % at 25 °C and 28–67 % at 28 °C) [8]. The impossibility of accurately identifying a species can lead to inconclusive studies regarding the vector status of it. The problematic identification of species of the Coronator Group may be causing difficulties in defining the medical importance of this group. The mitochondrial genome of the majority of the metazoan organisms is a small genome (ranging from 15 to 20 kb). It contains 37 genes, which encode 13 Protein-Coding Genes (PCGs) involved in oxidative phosphorylation, 2rRNA (rrnL and rrnS) and 22 tRNAs genes, which are necessary for the translation of the proteins encoded by the genes [9, 10]. The mitochondrial genome also encompasses a region that is rich in adenine (A) and thymine (T). This AT-rich region starts and controls the replication of the mitochondrial genome [11]. Because of the lack of recombination and fast evolutionary processes in comparison to those that involve nuclear genes, the mitochondrial genome seems to be a source of information that can be employed to address evolutionary processes of both vertebrates and invertebrates [12-14]. Although being largely employed in molecular taxonomy and phylogeny, only Culex quinquefasciatus Say and Culex pipiens L. possess their mitochondrial genome available in the Genbank. Considering the potential taxonomic and phylogenetic content of genes of the mitochondrial genome for Culex species and the role of Cx. coronator as vector of arboviruses, four species of the Coronator Group were the focus of this study. Next generation sequencing technology was applied to sequence the mitochondrial genomes of Culex coronator, Culex usquatus, Culex camposi, and Culex usquatissimus. The objectives of the study were to: 1) describe the mitochondrial genome of four species of the Coronator Group; 2) to analyze the mitochondrial genome of four species of the Coronator Group; 3) to compare the genomes of species of the Coronator Group with other species of the Culicidae family available in the Genbank; 4) to assess the monophyly of the Coronator Group.

Methods

Mosquito sampling and DNA extraction

Mosquitoes and collection data from individuals employed in the study are in Table 1 and Fig. 1. Immature stages were field collected as either larvae or pupae and kept in the laboratory to obtain adults associated with larval and pupal exuviae for species identification. Only males were employed to sequence the mitochondrial genome because species identification is based on traits of the male genitalia (Table 1). Fourth-instar larval, pupal exuviae and dissected male genitalia were mounted on microscope slides in Canada balsam and are deposited in Coleção Entomológica de Referência, Faculdade de Saúde Pública, Universidade de São Paulo, Brazil, as vouchers. Males were kept in 95 % ethanol and stored at −80 °C until DNA extraction.
Table 1

Species, specimen codes, gender, states and geographical coordinates of the collection of localities in Brazil

SpeciesSpecimencodeSexStateGeographicalcoordinates
Culex coronator RS10_109Rio Grande do Sul29°39′35″S 50°13′03″W
Culex usquatissimusACAC16_101Acre9°41′03″S 67°08′05,3″W
Culex usquatissimusRORO25_19Rôndonia10°18″03″S 63°14′09,1″W
Culex usquatus SP29_156São Paulo21°37′07″S 50°56′24″W
Culex camposi MS04_38Mato Grosso do Sul19°29′59,4″S 55°36′33,8″W
Fig. 1

Map of Brazil showing the collection sites of species of the Coronator Group of Culex (Culex) (Diptera: Culicidae)

Species, specimen codes, gender, states and geographical coordinates of the collection of localities in Brazil Map of Brazil showing the collection sites of species of the Coronator Group of Culex (Culex) (Diptera: Culicidae)

PCR amplification and sequencing

Genomic DNA was extracted from each mosquito individually using QIAgen Dneasy® Blood and Tissue kit (QIAgen Ltd., Crawley, UK) following the same procedures adopted by Foster et al. [15]. The mitochondrial genome of each individual was amplified in two PCRs. A long PCR amplification generated a fragment of ~12,000 base pairs (bp) and a second reaction targeted a fragment of ~4,500 bp. Two sets of primers were used as follows: 16Sa (5′ CGCCTGTTTATCAAAAACAT 3′) and LCO1490 (5′ GGTCAACAAATCATAAAGATATTGG 3′) to amplify ~12,000-bp fragment, and 16Sb (5′ CCGGTTGAACTCAGATCA 3′) and HCO2198 (5′ TAAACTTCAGGGTGACCAAAAAATCA 3′) to generate fragments of ~4,500-bp. See Folmer et al. 1994 [16] for additional information about the LCO1490 and HCO 2198 primers, and Kambhampati and Smith (1995) [17] for 16Sa and 16Sb primers. Each PCR reaction was performed using GoTaq® Long PCR Master Mix (Promega, Wisconsin, USA) following the protocols proposed by the manufacturer. The long PCR products were purified in DNA Clean & Concentrator™ (Zymo Research, California, USA) and quantified with Qubit (LifeTechnologies, Oregon, USA) for library preparation. Individually barcoded PCR libraries were created for the 12,000 bp and 4,500 bp PCR products employing Nextera® XT DNA Sample Preparation Kit (Illumina, Illinois, USA) and sequenced on the Illumina MiSeq platform with paired-end 250 base pairs chemistry.

Genome assembly and annotation

Mira v4 software was used for sequence assembly and Tablet to view the assembly [18, 19]. The MITOS website [20] was used to delimit the genes. Annotation of protein coding genes was conducted using the Wise2 v2.2 package and the HMMER2 models [21] (HMMER v3.1b2; http://hmmer.janelia.org/).

Sequence analysis

Nucleotide composition values were calculated using the MEGA 6.06 software [22]. The GC—and AT-skews were used to determine strand asymmetry [23]. To measure these values, the following formulas were used: GC-skew (G-C) / (G + C) and AT-skew (A-T) / (A + T). The secondary structure of tRNAs was inferred in tRNAscan-SE 1.21 [24]. A sliding window of 200 bp and steps of 25 bp was implemented to estimate nucleotide divergence. The analysis was performed using the five complete mitochondrial genome sequences in DnaSP v. 5.10.01 [25]. Ratios between non-synonymous (dN) and synonymous (dS) substitution among protein-coding sequences of all pairs of species were calculated in KaKs calculator [26] using a modified Yang-Nielsen algorithm. This ratio is currently employed to estimate if genes are under negative (purifying) selection (dN/dS < 1), positive (adaptative) selection (dN/dS > 1), or neutral evolution.

Phylogenetic analysis

Phylogenetic analysis was carried out using Bayesian inference from the concatenated sequences of all protein coding genes of the five newly sequenced Culex specimens, plus the mitochondrial genomes of four species available in the GenBank, as follows: Cx. quinquefasciatus [HQ724617], Cx. pipiens [HQ724616, HQ724615], Aedes albopicutus [NC_006817] and Anopheles darlingi [NC_014275]. The latter two species were employed as outgroups. Multiple alignments were generated in Clustal X [27] and then edited visually in BioEdit [28] to ensure that genes were in the frame. The best-fit model of nucleotide substitution for each gene was estimated in JModeltest 0.1.1 package [29], under Akaike Information Criterion (AIC). Bayesian analysis was performed in MrBayes v. 3.1.2 [30] and the dataset was partitioned by genes. Two independent runs with one cold and three heated chains each, were implemented for 1,000,000 generations with trees sampled every 100 generations; the consensus topology was generated after a burnin of 25 % of the retained trees.

Results and discussion

Mitochondrial genome organization and nucleotide composition

The mitochondrial genomes of Cx. coronator, Cx. usquatus, Cx. usquatissimus and Cx. camposi contain 37 genes, which have been found in other metazoan and Culicidae species, including 13 protein-encoding genes, 22 tRNAs and 2 rRNA genes ,( rrnL and rrnS) and the AT-rich control region [31-34]. The genomes are approximately of the same length of Culex quinquefasciatus (15,587 base pairs): 15,573 bp in Cx. usquatus and Cx. usquatissimus from Acre state (Cx. usquatissimus AC); 15,574 bp in Cx. usquatissimus from Rondônia state (Cx. usquatissimus RO); and 15,576 bp in Cx. coronator (Table 2). No difference was observed in the length of the 13 protein coding genes. Furthermore, differences in gene length were primarily caused by insertion/deletions in the intergenic spacers and in the AT-control region.
Table 2

Structural feature of the mitochondrial genome of four species of Cx. coronator, Cx. usquatus, Cx. camposi, and Cx. usquatissimus

SpeciesMitochondrial gene structure in base pairs
PCGtRNA genesrRNA genesControl regionTotal
Cx. coronator 11,2261,4822,12472515,576
Cx. usquatissimus AC11,2261,4822,12472115,573
Cx. usquatissimus RO11,2261,4832,12472215,574
Cx. usquatus 11,2261,4832,12471915,573
Cx. camposi 11,2261,4822,12471915,570
Structural feature of the mitochondrial genome of four species of Cx. coronator, Cx. usquatus, Cx. camposi, and Cx. usquatissimus In all species, nucleotide composition was biased toward overall AT content. This AT-bias has been reported in the mitochondrial genomes of other metazoan species [34-37]. In Cx. coronator, Cx. usquatissimus AC from Acre state and Cx. usquatissimus RO from Rondônia state, the AT content value was 78.6 %, whereas in Cx. usquatus and Cx. camposi it was 78.9 % (Table 3). These values were similar to those found in other Culicidae species with the mitochondrial genome reported [31-34]. Considering species of the Anopheles albitaris complex, the AT content ranged from 77.1 % to 77.4 %; whereas in Cx. quinquefasciatus it was 77.7 %, and in Ae. aegypti, 79 %. Similar to Anopheles species [34] and other orders of Insecta [36], the value of the AT content increased in the third codon position of the PCGs varying from 81.4 % to 86.6 %, being slightly lower than in the control region (89.2 % to 90.1 %). One explanation for this phenomenon is the “transcription hypothesis of the codon usage” [38]. According to Sun et al. [38], the high availability of ATPs, along with the lack of other NTPs in cells, leads to the maximization of the use of adenines in the third codon position in order to increase the efficacy of the transcription. The overall AT-skew was positive in all species (0.0025 for Cx. usquatissimus RO and Cx. usquatissimus AC; 0.0012, 0.003 and 0.0038, in Cx coronator, Cx. camposi and Cx. usquatus, respectively), whereas the GC-skew was −0.15 for all species, showing that adenine and cytosine are in the highest proportion compared to thymine and guanine, respectively, in the majority strand. Those findings are in agreement with other studies of species of the genera Anopheles and Drosophila [34].
Table 3

Overall nucleotide composition and A + T content per structural feature, and by codon position in protein-coding genes

%%A + T%A + T in PCG
Codon position
TCAGOveralltRNArRNAControl regionIntergenic space1st2nd3nd
Cx. usquatissimus AC39.212.439.49.178.678.982.190.194.578.067.286.3
Cx. coronator 39.212.439.39.178.679.182.289.489.578.367.286.6
Cx. usquatissimus RO39.212.439.49.178.679.182.189.589.577.073.581.4
Cx. usquatus 39.212.439.59.078.778.682.189.290.978.367.286.4
Cx. camposi 39.212.339.59.078.779.182.489.689.677.173.581.5
Overall nucleotide composition and A + T content per structural feature, and by codon position in protein-coding genes

The protein-coding genes (PCGs)

Except for the COX1 gene in which no canonical ATN was found, the majority of the PCGs of Culex species possessed the start codon ATN (Additional file 1). The absence of the ATN start codon in the COX1 gene was found in Cx. quinquefasciatus, Cx. pipiens, Ae. aegytpti and in other insects [31-35] and therefore it has been widely discussed [39]. In 1983, de Brujin [40] proposed a tetranucleotide (ATAA) positioned upstream in the proximity of the opening codon of COX1 (TCG) as a start codon for Drosophila melanogaster. The author hypothesized that if an ATA, a recognized start codon, overlaps a stop codon TAA in the frame −1, the ATA of the tetranucleotide ATAA could function as a highly conserved 0 frame and as an opening frame. Notwithstanding, in the mitochondrial genome of Culex species, the closest ATAA tetranucleotide is located within the trnL2 gene, overlapping 36 base pairs of the gene. Consequently, it is plausible to suppose that the hexanucleotide ATTTAA, which usually flanks the beginning of the COX1 in mosquitoes, is involved in the initiation of the translation signal of this gene, as it was proposed for Tetrodontophora bielanensis [39]. Eleven genes (ATP6, ATP8, COX3, CytB, NAD2, NAD3, NAD4, NAD4L, NAD5, NAD6) have complete TAA stop codons, except for COX1 and COX2 genes, which terminate with an incomplete codon T. This phenomenon has been extensively reported in other mitochondrial genomes, especially in COX genes, and so far it has been related to posttranscriptional polyadenylation, during which residual adenines are added in order to originate TAA terminators [34, 36, 41]. A total of 322 nucleotide sites were variable across PCGs of all Culex species analyzed, in which 270 were at the 3rd, 51 at the 1st and 1 at the 2nd codon position, encompassing most of those transition mutations. As expected, genes with a larger length (NAD2, COX1, NAD4, NAD5, CytB and NAD1) concentrated the majority of the polymorphisms; however COX1,only presented synonymous substitutions, whereas NAD2, NAD5, NAD4, CytB, and NAD1 showed 3, 2, 1, 3, and 2 non-synonymous substitutions, respectively. Additionally, despite the small length, ATP6 and ATP8 were polymorphic genes in Culex species, with 23 (2 non-synonymous) and 4 variable (2 non-synonymous) sites. Additionally, the dN/dS ratios (Fig. 2) were very low, ranging from 0.0 to 0.09, suggesting that all PCGs are under strong negative selection. Despite that, the strength of selection varies among genes; COX1, COX2, COX3, NADH1, NADH3, NADH4, NADH4L and NADH6 are the mitochondrial genes that are under the strongest purifying selection.
Fig. 2

Ratio of non-synonymous / synonymous (dN/dS) nucleotide substitutions. Ratios were calculated among the 13 protein-coding genes of the mitochondrial genome of four species of the subgenus Culex: Cx. coronator, Cx. usquatus, Cx. camposi, and Cx. usquatissimus

Ratio of non-synonymous / synonymous (dN/dS) nucleotide substitutions. Ratios were calculated among the 13 protein-coding genes of the mitochondrial genome of four species of the subgenus Culex: Cx. coronator, Cx. usquatus, Cx. camposi, and Cx. usquatissimus Results of the analysis of the relative synonymous codon usage (RSCU) showed that the codons with adenine and thymine in the third position were overused when compared to other synonymous codons (Table 4), which commonly occurs in other metazoan mitochondrial genomes [36, 37, 42]. This can be observed in the leucine amino acid, i.e., while the TTA codon presented a RSCU value of 3.75, the codon CTG, which also translates a leucine, showed a RSCU value of 0.14.
Table 4

Relative synonymous codon usage (RSCU) and overall average of codon usage in the PCGs of Cx. coronator, Cx. usquatus, Cx. camposi, and Cx. usquatissimus

Amino acidCodonOverall averageRSCUAmino acidCodonOverall averageRSCUAmino acidCodonOverall averageRSCUAmino acidCodonOverall averageRSCU
FTTT218.21.51STCT59.61.39YTAT156.41.5CTGT36.01.2
FTTC71.40.49STCC38.40.89YTAC51.40.5CTGC24.60.8
LTTA297.63.75STCA86.42.01stopTAA--WTGA75.21.6
LTTG33.40.42PCCT9.60.22stopTAG--WTGG16.40.4
LCAA50.40.64PCCC49.62.00HCAT63.41.5RCGT2.20.3
LCTC19.80.25PCCA17.00.68HCAC21.20.5RCGC1.00.1
LCTA63.40.80PCCA31.21.26QCAA68.01.7RCGA26.43.5
LCTG11.00.14PCCG1.60.06QCAG12.00.3RCGG1.00.1
IATT274.61.62TACT91.41.93NAAT240.41.5SAGT57.01.3
IATC63.80.38TACC18.20.38NAAC74.20.5SAGC30.20.7
MATA211.61.68TACA74.81.58KAAA204.21.6SAGA38.40.9
MATG39.60.32TACG5.00.11KAAG54.20.4SAGG23.80.6
VGTT48.61.56AGCT60.22.68DGAT32.01.6GGGU17.20.7
VGTC2.80.09AGCC6.00.27DGAC8.00.4GGGC0.80.0
VGTA71.82.30AGCA23.21.03EGAA54.81.6GGGA80.43.1
VGTG1.80.06AGCG0.40.02EGAG12.00.4GGGG5.60.2
Relative synonymous codon usage (RSCU) and overall average of codon usage in the PCGs of Cx. coronator, Cx. usquatus, Cx. camposi, and Cx. usquatissimus

RNA genes

The set of 22 tRNA genes in all species varied in length from 64 bp in trnR gene to 72 bp in trnV gene (Additional file 1). The AT content ranged from 78.6 % to 79.1 % (Table 3). The anticodons of all tRNAs in Culex species were the same as that of other insects [31-35] (Additional file 1). The conventional cloverleaf-like structure of tRNAs was found in 20 (Additional file 2) of the 22 tRNAs described for Culex species. In contrast, the trnR and trnS1 genes could not be folded into cloverleaf-like structure. In the trnS1, several similar cases were reported in previously sequenced metazoan mitochondrial genomes because of the replacement of the DHU (dihydrouridine) arm by a DHU-loop [43, 44]. The absence of a secondary structure in the trnS1 has been reported for Collembola species [39]. Similar to the mitochondrial genome of other metazoan species [32-37], the rrnL is located between trnL1 and trnV ribosomal genes, and the rrnS is situated between the trnV gene and the AT-rich region. In all species, the rrnL and rrnS are 2,124 base pairs long (Additional file 1). The AT content was 82 %, a value that is slightly higher than the overall content, however, similar to that observed in the 3rd codon position (Table 3). Both tRNAs and rRNAs genes are more conserved than the PCGs, with only 10 variable sites in tRNAs (throughout 1,462pb - 1,463 bp) and 11 substitutions among 2,124 bp of the two rRNAs genes. Evolutionary studies relative to the tRNA and rRNA in Drosophila and Anopheles showed signatures of negative selection, because non-pairing substitutions such as G-C to G-U can affect the secondary structure of these genes [41, 45].

Intergenic spacer sequences

A total of 52 bp to 56 bp non-coding nucleotides were found in the mitochondrial sequences of the species included in this study (Table 2). The length of each spacer mostly varies from 1 to 5 bp, except for two spacers: one located between the trnk and the tranD genes (12 bp in Cx. coronator, and 11 bp in the remaining species); and the other between trnS2 and NAD1 genes with 19 bp in all samples. Although those spacers account for only 0.3 % of the whole mitochondrial genomes, they are composed almost exclusively of adenine and thymine, with an AT content that is higher than that observed in the AT-control region, reaching 94.5 % in Cx. usquatissimus from Acre (Table 3).

AT-rich control region

The size variation, ranging from 719 bp in Cx. usquatus to 724 bp in Cx. coronator (Table 2) is within the range variation observed in the mitochondrial genomes reported for other Culicidae (from 531 bp in Anopheles gambiae to 731 bp in Culex quinquefasciatus). Those differences in length were caused by several indels of one to three nucleotides distributed throughout the AT regions of the mitochondrial genomes. Considering both indels and nucleotide substitutions, 34 variable sites were observed in Culex species. Similar to nuclear noncoding DNA, the AT-control region is subjected to a high level of polymorphisms that lead to variation in size and base composition. However, in species of the Anopheles gambiae complex, there is evidence that this region change more slowly than the 3rd codon position of PCGs [46]. Additionally, among different subgenera of Anopheles, there are conservative poly-T regions of 15 to 18 bp [34]. Comparing the control region of the four Culex species studied, we observed 4 conservative T-stretch regions of 6 to 15 bp. This was likely caused because this region contains several regulatory elements, including the origin of replication and transcription of the major strand of the mitochondrial genome [37] and, consequently, has a functional role, which is conserved among genera.

Sliding window analysis

Mitochondrial DNA is largely employed in phylogeny and evolutionary studies because it has a high mutation rate, maternal inheritance, high number of copies, and intraspecific polymorphisms [47]. Herein, we conducted a sliding window analysis using the alignment of the entire mitochondrial genome of Culex species to verify regions with high nucleotide divergence and thus, identified potential markers that can be employed for future studies focusing on Culex species. Results of the sliding window analysis showed low nucleotide diversity (Pi), ranging from 0.0 to 0.035 (Fig. 3) among species of the Coronator Group. However, nucleotide substitution rates varied across both mitochondrial genomes and within individual genes. Remarkably, the 5′ end of the NADH5 fragment showed the highest nucleotide diversity (0.035) among all mitochondrial genes. The COX1 presented low variation, mainly in its 5′ proximal half. This region is largely employed in studies focusing in Culicidae species, and it is considered as the universal barcode for species identification [48]. Notwithstanding, other descriptive studies focusing on the mitochondrial genome showed that the COX1 is a conserved gene [49-53]. Consequently its utility as a universal barcode needs to be reviewed.
Fig. 3

Graphics showing the nucleotide diversity of the mitochondrial genome of the four species. Nucleotide diversity of Cx. coronator, Cx. usquatus, Cx. camposi and Cx. usquatissimus was calculated using a sliding window analytical procedure (window of 200 base pairs with step size of 25 base pairs). Gene boundaries are indicated above the graph as follows: black vertical bars indicate tRNA genes, whereas the white boxes represent both protein-coding genes and ribosomal RNA genes. The featured rectangle shows the AT-rich control region

Graphics showing the nucleotide diversity of the mitochondrial genome of the four species. Nucleotide diversity of Cx. coronator, Cx. usquatus, Cx. camposi and Cx. usquatissimus was calculated using a sliding window analytical procedure (window of 200 base pairs with step size of 25 base pairs). Gene boundaries are indicated above the graph as follows: black vertical bars indicate tRNA genes, whereas the white boxes represent both protein-coding genes and ribosomal RNA genes. The featured rectangle shows the AT-rich control region The rrnL and rrnS demonstrated to be the most conserved genes within the mitochondrial genomes of species of the Coronator Group, showing low nucleotide diversity. Although rrnL usually shows high variability among some groups, i.e., Taeniidae [49], Nematoda [50], and Octopodus [54], herein, the highest nucleotide diversity found in the rrnL was 0.02. Per se, the rrnL and rrnS genes seem not to be good markers for taxonomy and evolutionary studies focusing on species of the Coronator Group. Considering both the epidemiological importance of Cx. coronator and the problematic identification of females based on morphological characters, the development of molecular markers can facilitate species identification as well as establish phylogenetic relationships within the group and other closely related species. Taken together, results of the sliding window analysis and the dN/dS ratios indicate that the NADH5, ATP8 and ATP6 genes represent potential markers for future investigations regarding species of the Coronator Group, primarily because they retain high variations among PCGs with an elevated proportion of non-synonymous substitutions. Notwithstanding, the low levels of diversity shown herein, demonstrates that the utility of sequences of the mitochondrial gene needs further evaluation in future studies employing a larger sample size and other species of the subgenus Culex as well as other Culex (Culex) species. Best-fit models selected by the Akaike Information Criterion are showed in Additional file 3. The Bayesian topology generated employing the concatenated PCGs (Fig. 4) yielded two strongly supported (100 % posterior probability) monophyletic clades with the Coronator Group as the sister clade of the lineage composed of species of the Cx. pipiens complex. Within the clade formed by species of the Coronator Group, the placement of Cx. coronator as sister of the lineage leading to Cx. camposi plus Cx. usquatus plus Cx. usquatissimus was strongly supported (100 % Bayesian posterior probability). Additionally, divergence among species from this group under Maximum Composite Likelihood (MCL) was low (Table 5), ranging from 0.2 % between Cx. usquatus and Cx. camposi to 1.4 % between Cx. coronator and Cx. usquatissimus (from Acre and Rondônia). The low nucleotide divergence observed among the mitochondrial genes of species of the Coronator Group supports the close phylogenetic relationships observed in previous studies [3-5]. As hypothesized by Lloyd et al. 2012 [55], the high statistical support for the clades suggests that many other species can be included in the PCGs analyses of species of the subgenus Culex. However, if more species were included in the study, likely the phylogenetic signal of the mitochondrial genes would be changed. For instance, studies based on morphological phylogeny [56] and COX1 barcode sequence data of several species of the genus Culex [4] were not capable of supporting phylogenetic relationships among species of the Coronator Group and other closely related species such as Cx. surinamensis and Cx. maxi. Those results suggest that Cx. surinamensis and Cx. maxi may share their ancestor with current species included in Coronator Group and as such, they should be included in the group. However, further studies need to be developed to address this hypothesis.
Fig. 4

Bayesian topology generated from the analysis using 13 protein-coding genes of four species of the Coronator Group plus Cx. quinquefasciatus and Cx. pipiens. Numbers placed above the branches indicate the values of Bayesian posterior probabilities. Aedes albopictus and Anopheles darlingi were employed as outgroups. Complete mitochondrial genomes of Cx. quinquefasciatus, two specimens of Cx. pipens, Ae. albopictus and An. darlingi were downloaded from the GenBank

Table 5

Average of nucleotide divergence under Maximum Composite Likelihood of 13 protein-coding genes of the mitochondrial genome of Cx. coronator, Cx. usquatus, Cx. camposi, and Cx. usquatissimus and four specimens obtained from GenBank. The averages are expressed as percentages; GenBank accession numbers are indicated between brackets

12345678
1. Cx. pipiens Greece [HQ724615]
2. Cx. pipiens Turkey [HQ724616]0.3
3. Cx. quinquefasciatus USA [HQ724617]0.10.3
4. Cx. usquatissimus AC3.94.13.8
5. Cx. usquatissimus RO4.04.13.90.3
6. Cx. usquatus 3.94.03.80.30.3
7. Cx. camposi 3.83.93.70.30.40.2
8. Cx. coronator 4.04.23.91.41.41.31.3
Bayesian topology generated from the analysis using 13 protein-coding genes of four species of the Coronator Group plus Cx. quinquefasciatus and Cx. pipiens. Numbers placed above the branches indicate the values of Bayesian posterior probabilities. Aedes albopictus and Anopheles darlingi were employed as outgroups. Complete mitochondrial genomes of Cx. quinquefasciatus, two specimens of Cx. pipens, Ae. albopictus and An. darlingi were downloaded from the GenBank Average of nucleotide divergence under Maximum Composite Likelihood of 13 protein-coding genes of the mitochondrial genome of Cx. coronator, Cx. usquatus, Cx. camposi, and Cx. usquatissimus and four specimens obtained from GenBank. The averages are expressed as percentages; GenBank accession numbers are indicated between brackets In order to address the effectiveness of the ATP6, ATP8 and NADH5 for reconstructing phylogenetic relationships within the Coronator Group, a Bayesian analysis was performed only with these genes (Fig. 5). Within the Coronator Group, the topology yielded was the same of that performed with all genes, demonstrating the potential of those genes for further evolutionary studies with this group. Interestingly, for Cx. pipiens complex species, results of Bayesian analysis recovered a polytomy between Cx. quinquefasciatus and Cx. pipiens. Those results are important to show how evolutionary behavior of the genes are different among groups of species, even within the same subgenus, and how carefully researchers need to be when selecting a molecular marker.
Fig. 5

Bayesian topology generated from the analysis using ATP6, ATP8 and NADH5 protein-coding genes of four species of the Coronator Group plus two species of Cx. pipiens complex. Numbers placed at the branches indicate Bayesian posterior probabilities. Aedes albopictus and Anopheles darlingi were employed as outgroups. Mitochondrial genomes of Cx. quinquefasciatus, two specimens of Cx. pipens, Ae. albopictus and An. darlingi were downloaded from the GenBank

Bayesian topology generated from the analysis using ATP6, ATP8 and NADH5 protein-coding genes of four species of the Coronator Group plus two species of Cx. pipiens complex. Numbers placed at the branches indicate Bayesian posterior probabilities. Aedes albopictus and Anopheles darlingi were employed as outgroups. Mitochondrial genomes of Cx. quinquefasciatus, two specimens of Cx. pipens, Ae. albopictus and An. darlingi were downloaded from the GenBank

Conclusions

The complete mitochondrial genomes of Cx. usquatus, Cx. usquatissimus, Cx. coronator, and Cx. camposi share the same gene order and gene content of other Culicidae species with the mitochondrial genome reported to date. The overall length and the AT content of the four Culex species are within the range observed in species of the Anopheles albitarsis complex, Cx. quinquefasciatus, and Ae. aegypti. Except for trnR and trnS1, the tRNAs were folded into the typical cloverleaf-like structure. Similar to other metazoan and species of the family Culicidae, the control region presented some conservative poly T- stretches, which seems to be involved in the functional roles of mitochondrial genome. Results of the Bayesian phylogeny corroborated the monophyly of the Coronator Group. Nevertheless, new insights on the evolution of the group can be addressed using a larger species sampling, including morphologically similar species and species of other Culex subgenera, for example, Lutzia, Phenacomyia and Phytothelmatomyia species. Probably because of the functional roles played in the respiratory chain by the mitochondrial genome, PCGs showed high purifying selection and low nucleotide divergence among the species investigated here.
  47 in total

1.  Phylogenetic relationships of Culex (Culex) species (Diptera, Culicidae) from Argentina based on morphological characters.

Authors:  Magdalena Laurito; Walter R Almirón
Journal:  Zootaxa       Date:  2013       Impact factor: 1.091

2.  DnaSP v5: a software for comprehensive analysis of DNA polymorphism data.

Authors:  P Librado; J Rozas
Journal:  Bioinformatics       Date:  2009-04-03       Impact factor: 6.937

3.  jModelTest: phylogenetic model averaging.

Authors:  David Posada
Journal:  Mol Biol Evol       Date:  2008-04-08       Impact factor: 16.240

4.  Clustal W and Clustal X version 2.0.

Authors:  M A Larkin; G Blackshields; N P Brown; R Chenna; P A McGettigan; H McWilliam; F Valentin; I M Wallace; A Wilm; R Lopez; J D Thompson; T J Gibson; D G Higgins
Journal:  Bioinformatics       Date:  2007-09-10       Impact factor: 6.937

5.  Intragenomic variation in the second internal transcribed spacer of the ribosomal DNA of species of the genera Culex and Lutzia (Diptera: Culicidae).

Authors:  Fabiana Tavares Vesgueiro; Bruna Demari-Silva; Rosely dos Santos Malafronte; Maria Anice Mureb Sallum; Mauro Toledo Marrelli
Journal:  Mem Inst Oswaldo Cruz       Date:  2011-02       Impact factor: 2.743

6.  Comparative genomics of Drosophila mtDNA: Novel features of conservation and change across functional domains and lineages.

Authors:  Kristi L Montooth; Dawn N Abt; Jeffrey W Hofmann; David M Rand
Journal:  J Mol Evol       Date:  2009-06-16       Impact factor: 2.395

7.  Complete mitochondrial genomes of Taenia multiceps, T. hydatigena and T. pisiformis: additional molecular markers for a tapeworm genus of human and animal health significance.

Authors:  Wan-Zhong Jia; Hong-Bin Yan; Ai-Jiang Guo; Xing-Quan Zhu; Yu-Chao Wang; Wan-Gui Shi; Hao-Tai Chen; Fang Zhan; Shao-Hua Zhang; Bao-Quan Fu; D Timothy J Littlewood; Xue-Peng Cai
Journal:  BMC Genomics       Date:  2010-07-22       Impact factor: 3.969

8.  The complete mitochondrial genome of the bag-shelter moth Ochrogaster lunifer (Lepidoptera, Notodontidae).

Authors:  Paola Salvato; Mauro Simonato; Andrea Battisti; Enrico Negrisolo
Journal:  BMC Genomics       Date:  2008-07-15       Impact factor: 3.969

9.  Complete mitochondrial genome sequences of two parasitic/commensal nemerteans, Gononemertes parasita and Nemertopsis tetraclitophila (Nemertea: Hoplonemertea).

Authors:  Wen-Yan Sun; Dong-Li Xu; Hai-Xia Chen; Wei Shi; Per Sundberg; Malin Strand; Shi-Chun Sun
Journal:  Parasit Vectors       Date:  2014-06-19       Impact factor: 3.876

10.  KaKs_Calculator: calculating Ka and Ks through model selection and model averaging.

Authors:  Zhang Zhang; Jun Li; Xiao-Qian Zhao; Jun Wang; Gane Ka-Shu Wong; Jun Yu
Journal:  Genomics Proteomics Bioinformatics       Date:  2006-11       Impact factor: 7.691

View more
  12 in total

1.  Phylogeny of Anophelinae using mitochondrial protein coding genes.

Authors:  Peter G Foster; Tatiane Marques Porangaba de Oliveira; Eduardo S Bergo; Jan E Conn; Denise Cristina Sant'Ana; Sandra Sayuri Nagaki; Silvio Nihei; Carlos Einicker Lamas; Christian González; Caio Cesar Moreira; Maria Anice Mureb Sallum
Journal:  R Soc Open Sci       Date:  2017-11-08       Impact factor: 2.963

2.  Mitochondrial genomes of the hoverflies Episyrphus balteatus and Eupeodes corollae (Diptera: Syrphidae), with a phylogenetic analysis of Muscomorpha.

Authors:  De-Qiang Pu; Hong-Ling Liu; Yi-Yun Gong; Pei-Cheng Ji; Yue-Jian Li; Fang-Sheng Mou; Shu-Jun Wei
Journal:  Sci Rep       Date:  2017-03-09       Impact factor: 4.379

3.  Complete mitogenome of Anopheles sinensis and mitochondrial insertion segments in the nuclear genomes of 19 mosquito species.

Authors:  Yi-Ran Ding; Bo Li; Yu-Juan Zhang; Qi-Meng Mao; Bin Chen
Journal:  PLoS One       Date:  2018-09-27       Impact factor: 3.240

4.  First record of translocation in Culicidae (Diptera) mitogenomes: evidence from the tribe Sabethini.

Authors:  Camila Lorenz; João Marcelo Pereira Alves; Peter Gordon Foster; Maria Anice Mureb Sallum; Lincoln Suesdek
Journal:  BMC Genomics       Date:  2019-09-27       Impact factor: 3.969

5.  Phylogeny of certain members of Hyrcanus group (Diptera: Culicidae) in China based on mitochondrial genome fragments.

Authors:  Hui-Min Zhu; Shu-Han Luo; Man Gao; Feng Tao; Jing-Peng Gao; Han-Ming Chen; Xiang-Yu Li; Heng Peng; Ya-Jun Ma
Journal:  Infect Dis Poverty       Date:  2019-10-23       Impact factor: 4.520

6.  Culicidae evolutionary history focusing on the Culicinae subfamily based on mitochondrial phylogenomics.

Authors:  Alexandre Freitas da Silva; Laís Ceschini Machado; Marcia Bicudo de Paula; Carla Júlia da Silva Pessoa Vieira; Roberta Vieira de Morais Bronzoni; Maria Alice Varjal de Melo Santos; Gabriel Luz Wallau
Journal:  Sci Rep       Date:  2020-11-02       Impact factor: 4.379

7.  Sequencing and analysis of the complete mitochondrial genome in Anopheles sinensis (Diptera: Culicidae).

Authors:  Kai Chen; Yan Wang; Xiang-Yu Li; Heng Peng; Ya-Jun Ma
Journal:  Infect Dis Poverty       Date:  2017-10-02       Impact factor: 4.520

8.  Mitochondrial genome sequencing and phylogeny of Haemagogus albomaculatus, Haemagogus leucocelaenus, Haemagogus spegazzinii, and Haemagogus tropicalis (Diptera: Culicidae).

Authors:  Fábio Silva da Silva; Ana Cecília Ribeiro Cruz; Daniele Barbosa de Almeida Medeiros; Sandro Patroca da Silva; Márcio Roberto Teixeira Nunes; Lívia Carício Martins; Jannifer Oliveira Chiang; Poliana da Silva Lemos; Gabriel Muricy Cunha; Renato Freitas de Araujo; Hamilton Antônio de Oliveira Monteiro; Joaquim Pinto Nunes Neto
Journal:  Sci Rep       Date:  2020-10-12       Impact factor: 4.379

9.  First Description of the Mitogenome and Phylogeny of Culicinae Species from the Amazon Region.

Authors:  Bruna Laís Sena do Nascimento; Fábio Silva da Silva; Joaquim Pinto Nunes-Neto; Daniele Barbosa de Almeida Medeiros; Ana Cecília Ribeiro Cruz; Sandro Patroca da Silva; Lucas Henrique da Silva E Silva; Hamilton Antônio de Oliveira Monteiro; Daniel Damous Dias; Durval Bertram Rodrigues Vieira; José Wilson Rosa; Roberto Carlos Feitosa Brandão; Jannifer Oliveira Chiang; Livia Carício Martins; Pedro Fernando da Costa Vasconcelos
Journal:  Genes (Basel)       Date:  2021-12-14       Impact factor: 4.096

10.  Characterization of the First Complete Mitochondrial Genome of Cyphonocerinae (Coleoptera: Lampyridae) with Implications for Phylogeny and Evolution of Fireflies.

Authors:  Xueying Ge; Lilan Yuan; Ya Kang; Tong Liu; Haoyu Liu; Yuxia Yang
Journal:  Insects       Date:  2021-06-22       Impact factor: 2.769

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.