Literature DB >> 26484533

Prevalence of Naegleria fowleri in Environmental Samples from Northern Part of India.

Ashutosh Panda1, Shehla Khalil1, Bijay Ranjan Mirdha1, Yogita Singh1, Samander Kaushik2.   

Abstract

Naegleria fowleri the causative agent of Primary Amoebic Meningoencephalitis, is ubiquitously distributed worldwide in various warm aquatic environments and soil habitats. The present study reports on the presence of Naegleria spp. in various water bodies present in Rohtak and Jhajjar district, of state Haryana, India. A total of 107 water reservoirs were screened from summer till autumn (2012 and 2013). In order to isolate Naegleria spp. from the collected water samples, the water samples were filtered and the trapped debris after processing were transferred to non-nutrient agar plates already seeded with lawn culture of Escherichia coli. Out of total 107 water samples, 43 (40%) samples were positive by culture for free living amoeba after incubation for 14 days at 37°C. To identify the isolates, the ITS1, 5.8SrDNA and ITS2 regions were targeted for PCR assay. Out of total 43 positive samples, 37 isolates were positive for Naegleria spp. using genus specific primers and the most frequently isolated species was Naegleria australiensis. Out of 37 Naegleria spp. positive isolates, 1 isolate was positive for Naegleria fowleri. The sequence analysis revealed that the Naegleria fowleri strain belonged to Type 2.

Entities:  

Mesh:

Year:  2015        PMID: 26484533      PMCID: PMC4618853          DOI: 10.1371/journal.pone.0137736

Source DB:  PubMed          Journal:  PLoS One        ISSN: 1932-6203            Impact factor:   3.240


Introduction

Free-living amoebae (FLA) such as Naegleria, Acanthamoeba, Vahlkampfia and Hartmannella are ubiquitously distributed worldwide in various aquatic and soil habitats. Many species of the genera Naegleria are known based on the analysis of their small subunit ribosomal deoxyribonucleic acid (SSU rDNA), large subunit ribosomal deoxyribonucleic acid (LSU rDNA) and the internal transcribed spacer (ITS) regions, including 5.8S rDNA [1]. Naegleria fowleri (N. fowleri) is the only species pathogenic to humans; it causes primary amoebic meningoencephalitis (PAM) [2-4]. PAM is rare but almost always fatal disease of the central nervous system (CNS) [4-7] often reported in healthy children and young adults after exposure to contaminated recreational, domestic or environmental water sources [4-6]. N. fowleri is thermophilic organism and can tolerate temperatures up to 45°C. Hence, these amoebae proliferate during warmer months of the year when the ambient temperature is likely to be high. N. fowleri has been isolated from various aquatic habitats such as swimming pools, lakes, rivers, hot springs and tap water. Distribution of FLA including N. fowleri has been reported to range between 23% and 89% in some geographical locations [8-18]. Accidental exposure and infections occur primarily in children and young adults–as they are more active in aquatic activities (diving, jumping into water and underwater swimming) and are likely to come into direct contact with free living amoebae in contaminated water. The organism enters the nasal cavity and migrates through the olfactory neuro-epithelium to the central nervous system and causes a fatal infection that exhibits symptoms similar to acute bacterial meningitis. There are at least 235 reported PAM cases worldwide [19], so the disease can be viewed extremely rare. But as it is almost always fatal, only about 5% of patients survive. Nearly two third cases of PAM have been reported from the United States of America (USA) alone and rest from the other parts of the world. So far, there are only 16 reported cases of PAM in India [20-35]. Out of 16 cases only 4 patients survived, of which 3 had no history of exposure to recreational water bodies, which makes it again suspicious whether these cases truly were N. fowleri infections. Of remaining 12 patients, 11 patients expired due to the disease, of which 4 were infants below 6 months of age. No conclusive information could be established for one patient as it was lost to follow up [31]. The presence of N. fowleri in swimming pools [36], pond water [37] and sewage canals [38] in India has been confirmed. It is believed that neurological infections by these free-living amoebas are misdiagnosed as well as under reported in India, probably due to inadequate information regarding their pathology or due to a very low autopsy rate. It is also intriguing to note that above mentioned Indian reports are primarily case reports based on direct demonstration of N. fowleri in the CSF of the infected individual. However, no information was available on the source of infection as well as molecular detection of Naegleria species in environmental samples. In view of this the aim of the present study was to investigate the distribution of FLA with special reference to N. fowleri in selected water bodies in Rohtak and Jhajjar, of state Haryana, India. These two sites of the state were judiciously selected because of the fact that most of the clinical cases in North India were reported from these parts of the state.

Material and Methods

No ethical permission was required to carry out the study. The samples which were collected from the various water bodies didn't require any prior permission from civic agencies of the state. One of the co-author, Dr. Samander Kasuhik of Maharishi Dayanand University, Rohtak, Haryana had taken prior permission from the local leaders of the various villages for this study.

Sampling sites and sample collection

Collection of samples from selected water bodies in Rohtak and Jhajjar of state Harayana were done every 14 days from summer till autumn during the year 2012 and 2013. A total of 107 water reservoirs including ponds and lakes were screened. 5 samples from each of the 107 sites were collected by immersion of a 100 ml Schott Duran bottle into the upper 2 cm of the respective water body. Prior to sample collection, temperature and pH of the sampling sites were measured for each sample taken. The water samples were transported to the laboratory at ambient temperature to maintain the thermophilic amoeba in natural conditions and were processed within 2–4 hrs after sampling.

Isolation and culturing of trophozoites

In order to isolate free living amoeba Naegleria spp. from the collected water samples, further processing of the samples were done. The five, 100 ml volumes that were collected from different parts of a single source was composited to make a 500 ml volume for the analysis. The samples were further filtered through a nitrocellulose membrane (pore size, 0.22 μm, Millipore, Fisher Scientific) [39]. Two to Eight nitrocellulose membranes were used to filter 500ml of water. The number of nitrocellulose membrane used for each sample varied on the basis of turbidity of the water sample. After filtration, the nitrocellulose membranes containing the trapped debris were flushed carefully in situ with 10 ml of sterile distilled water [40]. The water containing the debris after flushing was not possible to examine microscopically due to heavy content of the trapped soil and other impurities. However, it was further processed by centrifugation for 15mins at 1200 rpm. The pellet obtained was further re-suspended in 100 μl of supernatant. Re-suspended pellets were gently pipetted onto a non-nutrient agar (NNA) plates prepared from PAGE amoeba saline overlaid with a lawn culture of Escherichia coli. The culture plates were sealed with parafilm and incubated at 37°C for upto 14 days [40, 41]. A temperature of 42–45°C is preferably used for the isolation of Naegleria species. However, to avoid the possible prohibitive effect of higher temperatures on the growth of certain non thermotolerant free-living amoebae a temperature of 37°C was selected in the present study [42].

Detection of Naegleria species

Daily examinations of all the culture plates were done up to 14 days using a light microscope (Olympus CX31). Cultures lacking morphological features of amoeba within 14 days were deemed negative and discarded. On initial observation it was found that the culture plates were colonized with mixed organisms and FLA like organisms. The culture plates which were suspected to be positive based on morphological characters were further subjected to clone establishment of the trophozoites by means of migration method [43]. Briefly, a block of agar containing small numbers of amoeba was transferred to a fresh NNA plate prepared from PAGE amoeba saline overlaid with a lawn culture of Escherichia coli. For documentation morphological characteristics were photographed.

PCR assays and DNA sequencing

The trophozoites were gently scraped from agar plates, re-suspended in PBS and subsequently pelleted by sedimentation at 1000g for 10 min. Total genomic DNA was extracted from amoeba trophozoites using the QIAamp DNA mini kit (Qiagen, Hilden, Germany). The positive control for the standardization of the PCR assay was isolated from N. fowleri culture obtained from American Type Culture Collection (ATCC no. 30894). Fwl, (5'-GTGAAAACCTTTTTTCCATTTACA-3') and RV1, (5'-AAATAAAAGATTGACCATTTGAAA-3') were used as forward and reverse primers respectively for N. fowleri. Fw2, (5’- GAACCTGCGTAGGGATCATTT -3’) and RV2, (5’- TTTCTTTTCCTCCCCTTATTA -3’) were used as forward and reverse primers respectively for genus Naegleria. These primers are located respectively in the ITS1 and ITS2 regions [44]. Amplification was carried out with a PCR buffer containing 10 mMTrisHCl pH 9, 50 mM KCI, 1.5 mMMgCl2, 0.1% Triton X 100 and 0.24 mM of each dNTPs, 0.4 μM of each primer, 1 unit of Taq DNA polymerase and 50–100 ng of genomic DNA in a final volume of 25μl. The PCR conditions comprised of initial denaturation for 3 min at 94°C, followed by 30 cycles at 94°C for 30 s, 55°C for 30 s and 72°C for 30 s with a final elongation step at 72°C for 5 min. The expected PCR amplified product for Naegleria genus was 408–457 bp and for N. fowleri it was 310bp. The product was analysed by electrophoresis on 1.5% agarose stained with ethidium bromide and was visualized on a UV transilluminator. For the PCR assay described in this study a positive reaction was obtained with 9pg of purified DNA but not with the subsequent dilution tested of 0.9pg. The specificity of the primers was checked with BLAST for other meningitis causing organisms like Cryptococcus neoformans, Haemophilus influenzae, Neisseria meningitidis, Staphylococcus aureus, Escherichia coli, Mycobacterium tuberculosis, Candida albicans and Acanthamoeba castellanii . No cross reactivity was observed with any of the above mentioned organisms.

Nucleotide Sequencing

The amplicons from 10 randomly selected isolates were gel purified using the QIAquick gel extraction kit (Qiagen, Hilden, Germany). These were directly sequenced in both directions using respective forward and reverse primers using the BigDye Terminator sequencing v3.1 kit and an ABI 3130 XL genetic analyzer (Applied Biosystems, Foster City, CA, USA). DNA chromatograms were examined using the BioEdit software version 7.1.3. The forward and reverse sequences were pair-wise aligned using ClustalW software and were manually refined to obtain a better consensus sequence. For nucleotide similarities a homology search was performed with BLAST against all eukaryotic nucleotide sequences archived in the GenBank database. Nucleotide residues corresponding to primer regions were excluded from the similarities search analyses.

Nucleotide Sequence Accession Number

The nucleotide sequences determined from this study were submitted to the Genbank and were assigned accession numbers KF700040, KF709528, KF709529, KF709530, KF709531, KF709532, KF709533, KF709534, KF709535 and KF709536.

Phylogenetic analysis

Phylogenetic analysis was carried out based on the internal transcribed spacers (ITS) and 5.8S sequences using the Molecular Evolutionary Genetics Analysis (MEGA) software. Phylogenetic trees were constructed using the neighbour joining with molecular distances estimated by the Kimura two-parameter model. The bootstrap procedure was then used to evaluate the robustness of each node.

Results

Microscopy and PCR assay result

A total of 107 water reservoirs including ponds and lakes were screened. The temperature, pH of these water reservoirs ranged between 24–31°C and 5.8–7.2 pH respectively (Table 1). Out of total 107 water samples tested, 43 (40%) samples were positive for free living amoeba by culture. Cultures were examined microscopically for the presence of morphological forms in all 43 isolates (Fig 1). These positive isolates were further subjected to PCR assay for detection of genus (Naegleria) as well as species (N. fowleri). Out of total 43 microscopically suspected positive samples, 37 (86%) isolates showed positive amplicons for genus Naegleria; where as 1 out of 37 (3%) amplicons was positive for N. fowleri (Fig 2).
Table 1

Overview of geographic sites sampled for Naegleria spp.

MonthSample IDGeographical Coordinates of Sampling SitesTemperaturepHPCR for Naegleria
MarchR1CV29003’27”N 76032’18”E29°C7.6-
R2CV29003’43”N 76031’46”E30°C7.1+
R3LKM29002’19”N 76028’34”E28°C7.5-
R4LKM29002’38”N 76028’26”E29°C7.3-
R5LKM29002’43”N 76028’40”E29°C7.1-
R6CHV29001’37”N 76030’01”E27°C7.4-
R7CHV29001’53”N 76030’17”E26°C7.6-
R8CHV29001’59”N 76030’09”E27°C7.1-
R9BHW28059’13”N 76030’49”E29°C5.8+
R10BHW28059’10”N 76031’05”E30°C5.9+
R11BHW28059’06”N 76031’10”E29°C5.8-
R12KIL28056’54”N 76042’44”E30°C6.2-
R13KIL28056’44”N 76042’38”E29°C6.5-
R14KIL28056’54”N 76043’14”E29°C6.3-
R15KIL28056’30”N 76042’57”E29°C6.7-
AprilR16BHT28054’25”N 76042’19”E30°C5.9+
R17BHT28054’24”N 76041’57”E29°C6.0+
R18BHT28054’11”N 76041’56”E29°C5.8-
R19RHC28054’14”N 76034’25”E28°C7.1-
R20RHC28054’37”N 76034’11”E29°C7.2-
R21RHC28054’01”N 76034’01”E28°C6.8-
R22MOK28053’09”N 76025’50”E28°C6.4+
R23MOK28053’22”N 76025’45”E29°C6.7+
R24MOK28053’29”N 76025’45”E29°C5.9+
R25BOH28053’38”N 76038’42”E28°C6.2-
R26BOH28053’50”N 76039’37”E29°C6.4-
R27BAL28052’48”N 76041’09”E29°C6.7+
R28BAL28052’02”N 76041’28”E30°C6.9-
R29BAL28052’35”N 76041’33”E29°C6.7-
R30BAL28052’32”N 76041’25”E29°C6.3-
R31SKK28051’43”N 76034’10”E28°C6.6-
R32SKK28051’42”N 76033’54”E30°C6.8-
R33SKK28051’30”N 76034’22”E29°C5.9-
MayR34KSV28051’30”N 76040’43”E29°C6.8+
R35KSV28051’42”N 76040’16”E30°C6.9+
R36KSV28051’18”N 76039’58”E30°C6.1+
R37MAV28051’01”N 76036’17”E29°C6.4-
R38MAV28050’38”N 76036’13”E29°C6.3-
R39GRW28049’12”N 76033’46”E28°C6.1+
R40KAL28049’40”N 76023’22”E29°C5.9-
R41KRT28048’11”N 76037’23”E30°C6.9+
R42KRT28048’11”N 76036’53”E30°C7.1+
R43KRT28047’48”N 76037’01”E29°C7.0+
R44KRT28047’50”N 76037’25”E30°C6.8-
R45SAP28046’28”N 76046’31”E30°C6.5-
R46SAP28046’47”N 76046’33”E30°C6.7+
R47SAP28046’40”N 76045’41”E31°C6.8-
R48SAP28046’06”N 76046’08”E30°C6.5+
R49SAP28046’09”N 76046’25”E31°C6.8+
JuneR50GRI28045’44”N 76046’17”E30°C6.3-
R51GRI28045’30”N 76046’20”E30°C6.3+
J52DIG28046’12”N 76037’43”E29°C5.9-
J53DIG28046’17”N 76038’03”E30°C5.8-
J54DIG28045’57”N 76037’36”E29°C6.0+
J55DIG28045’50”N 76038’10”E29°C6.2-
J56DIG28045’43”N 76038’03”E30°C5.9+
J57DIG28045’33”N 76037’42”E30°C6.7+
J58DHA28045’22”N 76037’12”E30°C6.1-
J59DHA28045’14”N 76037’20”E31°C6.3-
J60DHA28045’10”N 76037’12”E30°C6.6-
J61GOC28044’02”N 76035’41”E31°C5.9+
J62GOC28044’05”N 76036’00”E30°C5.8+
J63SHE28043’17”N 76036’34”E31°C6.5+
J64SHE28043’12”N 76036’34”E29°C6.0-
J65SHE28043’05”N 76036’30”E29°C6.1-
J66SHE28043’14”N 76037’03”E30°C6.3+
J67SHE28042’47”N 76036’37”E29°C6.6+
J68SHE28042’59”N 76037’02”E31°C6.4+
JulyJ69MAN28042’35”N 76039’02”E29°C5.9-
J70MAN28042’46”N 76038’34”E28°C5.8-
J71MAN28043’04”N 76038’39”E29°C6.0-
J72MAN28043’03”N 76039’06”E29°C6.3-
J73CHC28043’38”N 76040’20”E30°C6.1-
J74CHC28043’42”N 76040’30”E31°C5.9-
J75CHC28043’36”N 76040’40”E30°C6.3-
J76CHC28043’34”N 76040’46”E29°C6.2-
J77CHC28043’27”N 76040’31”E30°C6.7-
J78CHC28041’01”N 76036’56”E30°C6.4-
J79CHC28040’40”N 76037’25”E29°C5.9-
J80BER28041’56”N 76034’55”E30°C6.0+
J81BER28041’41”N 76034’39”E31°C5.8+
J82BER # 28041’55”N 76034’26”E31°C6.3+
J83BER28042’16”N 76034’28”E30°C6.7-
J84BER28042’25”N 76034’49”E31°C6.2+
J85BER28042’34”N 76034’31”E29°C6.4+
J86BER28041’42”N 76034’06”E30°C6.8-
J87BAG28041’30”N 76031’51”E27°C7.1-
J88BAG28041’18”N 76033’42”E27°C7.0-
J89WAZ28040’53”N 76034’21”E28°C7.2-
J90WAZ28040’51”N 76034’35”E27°C6.9+
J91WAZ28040’59”N 76034’33”E27°C7.0+
AugustJ92MAJ28040’51”N 76027’06”E24°C7.2-
J93MAJ28040’14”N 76027’01”E25°C7.0+
J94MAJ28040’13”N 76027’08”E24°C7.1-
J95MAJ28040’18”N 76027’08”E25°C7.1-
J96MAJ28040’21”N 76027’16”E24°C6.9-
J97MAJ28040’15”N 76027’32”E24°C6.9-
J98MAJ28040’25”N 76027’12”E25°C7.2-
J99MAJ28040’28”N 76027’59”E24°C7.0-
J100MAJ28040’42”N 76027’18”E26°C6.5-
J101MAJ28039’49”N 76026’54”E24°C6.6-
J102DUD28041’08”N 76029’25”E25°C7.0-
J103DUD28040’55”N 76029’04”E25°C7.2-
J104JHT28035’52”N 76039’07”E26°C6.9+
J105SIL28032’52”N 76041’07”E24°C7.1-
J106SIL28032’40”N 76040’52”E24°C6.8-
J107SIL28032’53”N 76040’45”E25°C7.2-

Sample was positive for

Fig 1

Morphological observation of Naegleria -like cyst at 100X magnification.

Zone of Escherichia coli clearing progressed and the number of cysts increased markedly.

Fig 2

Amplicon bands revealed by genus and species specific primers against Naegleria isolates for representative samples.

Genus Naegleria specific amplification (Lane 1–13), Lane 1 Ladder 100bp, Lane 2 Negative control, Lane 3 Positive control, Lane 4–13 Positive samples. N. fowleri specific amplification (14–17), Lane 14. Ladder 100bp, Lane 15 Negative control, Lane 16 Positive control, Lane 17 Positive sample.

Morphological observation of Naegleria -like cyst at 100X magnification.

Zone of Escherichia coli clearing progressed and the number of cysts increased markedly.

Amplicon bands revealed by genus and species specific primers against Naegleria isolates for representative samples.

Genus Naegleria specific amplification (Lane 1–13), Lane 1 Ladder 100bp, Lane 2 Negative control, Lane 3 Positive control, Lane 4–13 Positive samples. N. fowleri specific amplification (14–17), Lane 14. Ladder 100bp, Lane 15 Negative control, Lane 16 Positive control, Lane 17 Positive sample. Sample was positive for

Sequence analysis

The sequences of 10 randomly selected amplicons (ITS1-5.8S-ITS2) were analysed using ClustalW programme (Fig 3 and Table 2). Isolate no. 1 to 9 showed 99% homology with Naegleria australiensis (N. australiensis) except for isolate no. 3 and 9 which had shown 98% homology with N. australiensis. Isolate no. 10 had shown 99% homology with N. fowleri. The lengths (in bp) and differences in the ITS1, 5.8S, ITS2 and 28S rDNA sequences of representative isolates have been summarized in Table 3 and Fig 3.
Fig 3

Multiple sequence alignment for amplicons NGES1-NGES10 using ClustalW program.

Black colour dash (—-) indicates gap, red colour fonts base substitution or base insertion, forward and reverse primers are underlined.

Table 2

Result of DNA sequencing of the selected amplicons (NGES1-NGES10).

IsolateAccession No.Closest phylogenetic speciesMaximum identityReference Strain Accession No.
NGES 1KF700040 Naegleria australiensis 99%GU597030
NGES 2KF709528 Naegleria australiensis 99%GU597034
NGES 3KF709529 Naegleria australiensis 98%GU597032
NGES 4KF709530 Naegleria australiensis 99%GU597035
NGES 5KF709531 Naegleria australiensis 99%GU597030
NGES 6KF709532 Naegleria australiensis 99% GU597031
NGES 7KF709533 Naegleria australiensis 99%GU597034
NGES 8KF709534 Naegleria australiensis 99%GU597039
NGES 9KF709535 Naegleria australiensis 98%GU597038
NGES 10 KF709536 Naegleria fowleri 99% AY033619
Table 3

Length and position of base in the ITS-5.8S-ITS2-28S sequence of the selected isolates (NGES1- NGES10).

IsolateAccession No.Length and position of ITS1 sequence (in bp)Length and position of 5.8S sequence (in bp)Length and position of ITS2 sequence (in bp)Length and position of 28S sequence (in bp)Reference Strain Accession No.
NGES 1KF70004034(1–34)174(35–209)99(210–309)44(310–354)GU597030
NGES 2KF70952834(1–34)174(35–209)100(210–310)44(311–355)GU597034
NGES 3KF70952942(1–42)173(43–216)98(217–315)44(316–360)GU597032
NGES 4KF70953035(1–35)172(36–208)100(209–309)44(310–354)GU597035
NGES 5KF70953135(1–35)173(36–209)100(210–310)44(311–355)GU597030
NGES 6KF70953232(1–32)173(33–206)99(207–306)43(307–350)GU597031
NGES 7KF70953335(1–35)173(36–209)97(210–307)47(308–355)GU597034
NGES 8KF70953435(1–35)173(36–209)98(210–308)44(309–353)GU597039

Multiple sequence alignment for amplicons NGES1-NGES10 using ClustalW program.

Black colour dash (—-) indicates gap, red colour fonts base substitution or base insertion, forward and reverse primers are underlined. The representative and reference isolates NGES 9, NGES 6, NGES 3 and N. australiensis GU597032 with similar sequences and length in the 5.8S (173 bp) were grouped together. NGES 4, NGES 5, NGES 7 and NGES 8 formed a clade to each other and showed similarity to the ITS1 (35bp). NGES 10 and N. fowleri (AY033619) formed a clade with each other showing similar sequences (Fig 4).
Fig 4

Neighbour-joining tree depicting the relationships between test isolates with amplicons (NGES1-NGES10) and reference strains of Naegleria.

Numbers at the notes are percentage-bootstrapping values on 1000 replicates, and only values of > 50% are shown. GenBank accession numbers for reference sequences are indicated at the ends of the species designations.

Neighbour-joining tree depicting the relationships between test isolates with amplicons (NGES1-NGES10) and reference strains of Naegleria.

Numbers at the notes are percentage-bootstrapping values on 1000 replicates, and only values of > 50% are shown. GenBank accession numbers for reference sequences are indicated at the ends of the species designations.

Discussion and Conclusions

Present study has primarily focussed to detect and identify the presence of pathogenic N. fowleri in the different water bodies in Rohtak and Jhajjar of state Harayana. Initially, identification of all the isolates of Naegleria -like species was based on the examination of morphological forms of the organism. The trophozoites of all the isolates showed erupted pseudopodia or lobopodia that actively moved in unidirectional manner while the cysts had uniform smooth thick double walls. All theses isolate exhibited flagella in distilled water except for four isolates. The detection of the flagellate stage was one of the important indicators for differentiation of Naegleria species from that of other FLA. All the 43 isolates showed luxuriant growth at 37°C. In this study we used the PCR based detection in order to confirm the Naegleria species that were present in our environment. N. fowleri culture obtained from American Type Culture Collection (ATCC no. 30894) was used as the positive control for the standardization of the PCR assay. Two primer sets i.e. the N. fowleri specific and Naegleria genus specific were designed from the ITS1-ITS2 regions as already described by Pélandakis et al. [44]. The ribosomal ITS sequence has been reported to be a useful tool for detecting both inter- and intra-species differences of various microorganisms, such as Cryptosporidium parvum [45], Naegleria spp. [46] and Vahlkampfia spp. [47]. Within Naegleria spp. the differences between genus (inter-species) and species (intra-species of N. fowleri) are due to the sequence polymorphisms that occur at the ITS2 and ITS1 regions [40]. The ITS region has also been used for the identification of the new Naegleria isolates [11, 44]. In the current study Naegleria genus specific primer set successfully amplified the DNA template from 37 isolates, while the species specific primer set could amplify only one isolate of N. fowleri out of 37 isolates. The species specific primer set produced the amplicon consisting of 308bp, while the genus specific primer set produced amplicon consisting of 408–410 bp. Upon sequence analysis, N. fowleri (NGES10) identified in the study belonged to Type 2. Presence of the Pathogenic N. fowleri has been detected on all continents, except in Antarctica. So far, seven types have been reported in Europe, three in American and two in Asian continents [48]. Both type 3 and type 2 were common to Asian, American and European continents [19]. The other most frequently isolated species in this study was N. australiensis. It is pathogenic in mice but has not been isolated from human cases [49]. N. australiensis is also the closest phylogenetic relative of N. fowleri (Fig 4) other than N. lovaniensis [1, 19]. It has been reported that N. lovaniensis is usually the most dominant species of Naegleria in warm water [50]. The data in the present study reveals that N. australiensis is the most frequently encountered species in the northern part of India especially Haryana. The reason for this feature observed warrants further investigation. Naegleria spp. were most frequently isolated during the summer season (April to July) (Fig 5), with the onset of monsoon the isolation rate reduced. The isolation frequency was high for water bodies with temperature ranging between 29–31°C (Table 1 and Fig 5). These were the noteworthy findings in the study.
Fig 5

Graph depicting the association between temperature of the sampling sites and isolation frequency of Naegleria spp.

Y axis denotes the number of isolation and X axis denotes minimum and maximum temperature range of the sampling sites during the entire season (March to August).

Graph depicting the association between temperature of the sampling sites and isolation frequency of Naegleria spp.

Y axis denotes the number of isolation and X axis denotes minimum and maximum temperature range of the sampling sites during the entire season (March to August). In summary, our study is the first to use a PCR-based approach to screen and document the presence of Naegleria spp., in a variety of water bodies in the Northern state of India. Our results provide the evidence that N. fowleri is present in these natural water bodies. These FLA poses health risks to those people who use these aquatic systems for recreational activity and their day to day use. Considering the limited understanding of the ecology of N. fowleri in India, practical measures have to be taken for prevention and control of Naegleria infections. It includes better awareness of the disease within the medical community and educating general public with the help of civic authorities.
  46 in total

1.  PCR-based diagnosis of Naegleria sp. infection in formalin-fixed and paraffin-embedded brain sections.

Authors:  Marc Schild; Christian Gianinazzi; Bruno Gottstein; Norbert Müller
Journal:  J Clin Microbiol       Date:  2006-11-22       Impact factor: 5.948

2.  Primary amebic meningoencephalitis.

Authors:  S L Tungikar; A G Kulkarni; A D Deshpande; V S Gosavi
Journal:  J Assoc Physicians India       Date:  2006-04

3.  Acanthamoeba isolates belonging to T1, T2, T3, T4 and T7 genotypes from environmental freshwater samples in the Nile Delta region, Egypt.

Authors:  Jacob Lorenzo-Morales; Antonio Ortega-Rivas; Enrique Martínez; Messaoud Khoubbane; Patricio Artigas; María Victoria Periago; Pilar Foronda; Néstor Abreu-Acosta; Basilio Valladares; Santiago Mas-Coma
Journal:  Acta Trop       Date:  2006-10-31       Impact factor: 3.112

4.  Prevalence of Acanthamoeba and other naked amoebae in South Florida domestic water.

Authors:  M E Shoff; A Rogerson; K Kessler; S Schatz; D V Seal
Journal:  J Water Health       Date:  2008-03       Impact factor: 1.744

5.  Survey of Naegleria from Taiwan recreational waters using culture enrichment combined with PCR.

Authors:  Shih-Wei Huang; Bing-Mu Hsu
Journal:  Acta Trop       Date:  2011-05-27       Impact factor: 3.112

6.  Youngest survivor of naegleria meningitis.

Authors:  Dinesh Yadav; Satinder Aneja; Renu Dutta; Anu Maheshwari; Anju Seth
Journal:  Indian J Pediatr       Date:  2012-04-28       Impact factor: 1.967

7.  Isolation and identification of pathogenic Naegleria australiensis (Amoebida, Vahlkampfiidae) from a spa in northern Italy.

Authors:  M Scaglia; M Strosselli; V Grazioli; S Gatti; A M Bernuzzi; J F de Jonckheere
Journal:  Appl Environ Microbiol       Date:  1983-12       Impact factor: 4.792

8.  Primary amebic meningoencephalitis.

Authors:  Ruchi Rai; D K Singh; A K Srivastava; Anudita Bhargava
Journal:  Indian Pediatr       Date:  2008-12       Impact factor: 1.411

Review 9.  Pathogenic and opportunistic free-living amoebae: Acanthamoeba spp., Balamuthia mandrillaris, Naegleria fowleri, and Sappinia diploidea.

Authors:  Govinda S Visvesvara; Hercules Moura; Frederick L Schuster
Journal:  FEMS Immunol Med Microbiol       Date:  2007-04-11

10.  Sequence Variation in the Ribosomal Internal Transcribed Spacers, Including the 5.8S rDNA, of Naegleria spp.

Authors:  J F De Jonckheere
Journal:  Protist       Date:  2009-07-13
View more
  7 in total

1.  Death From Primary Amebic Meningoencephalitis After Recreational Water Exposure During Recent Travel to India-Santa Clara County, California, 2020.

Authors:  Glenn R Harris; Ellora N Karmarkar; Rebecca Quenelle; Lyndsey Chaille; Jai Madhok; Vivian Tien; Jyoti Gupta; Seema Jain; Maria Liu; Shantanu Roy; Supriya Narasimhan; Akiko Kimura; Jennifer R Cope; Ibne Karim M Ali
Journal:  Open Forum Infect Dis       Date:  2021-07-27       Impact factor: 3.835

2.  Genotyping and Molecular Identification of Acanthamoeba Genotype T4 and Naegleria fowleri from Cerebrospinal Fluid Samples of Patients in Turkey: Is it the Pathogens of Unknown Causes of Death?

Authors:  Mehmet Aykur; Derya Dirim Erdogan; Nur Selvi Gunel; Ayse Guler; Cigir Biray Avci; Nese Celebisoy; Cumhur Gunduz; Hande Dagci
Journal:  Acta Parasitol       Date:  2022-07-21       Impact factor: 1.534

3.  Isolation, molecular characterization and phylogeny of Naegleria species in water bodies of North-Western Province, Sri Lanka.

Authors:  Nuwan Gunarathna; Anjalie Amarasinghe; Sunil Wijesundara; Devika Iddawela; Susiji Wickramasinghe
Journal:  PLoS One       Date:  2021-03-11       Impact factor: 3.240

4.  Evaluation of molecular characterization and phylogeny for quantification of Acanthamoeba and Naegleria fowleri in various water sources, Turkey.

Authors:  Mehmet Aykur; Hande Dagci
Journal:  PLoS One       Date:  2021-08-26       Impact factor: 3.240

5.  Naegleria fowleri from Pakistan Has Type-2 Genotype.

Authors:  Muhammad Aurongzeb; Yasmeen Rashid; Syed Habib Ahmed Naqvi; Ambrina Khatoon; Sadia Abdul Haq; Mohammad Kamran Azim; Imdad Kaleem; Shahid Bashir
Journal:  Iran J Parasitol       Date:  2022 Jan-Mar       Impact factor: 1.217

6.  A case report: primary amoebic meningoencephalitis in a young Zambian adult.

Authors:  Mashina Chomba; Luchenga A Mucheleng'anga; Sombo Fwoloshi; Joseph Ngulube; Mable M Mutengo
Journal:  BMC Infect Dis       Date:  2017-08-01       Impact factor: 3.090

7.  Naegleria species population found in pond water of parks in Mashhad city, Can the physicochemical factors affect it?

Authors:  Ali Asghar Najafpoor; Hossein Zarrinfar; Shiva Ghaderifar; Hossein Alidadi; Habibolah Esmaily; Elham Hajialilo; Bibi Razieh Hosseini Farash; Elahe Ahmadi
Journal:  MethodsX       Date:  2018-10-24
  7 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.