Secondary structure and feature of mitochondrial tRNA genes of the Ussurian tube-nosed bat Murina ussuriensis (Chiroptera: Vespertilionidae).

The complete mitogenome (NC_021119) of the Ussurian tube-nosed bat Murina ussuriensis (Chiroptera: Vespertilionidae) was annotated and characterized in our recent publication (http://www.ncbi.nlm.nih.gov/nuccore/NC_021119). Here we provide additional information on methods in detail for obtaining the complete sequence of M. ussuriensis mitogenome. In addition, we describe characteristics of 22 tRNA genes and secondary structure and feature of 22 tRNAs of M. ussuriensis mitogenome.

Direct link to deposited data

http://www.ncbi.nlm.nih.gov/nuccore/NC_021119.

Experimental design, materials and methods

Sample collection and DNA extraction

Murina ussuriensis (Ussurian tube-nosed bat), a species of bats in family Vespertilionidae, is distributed in the Korean peninsula, Japan, and southeastern Siberia and Sakhalin of Russia [2]. An individual of M. ussuriensis was captured using Mist-net (Avinet, USA) in mountain forests (Hongchun-gun, Gangwon, South Korea) and a small tissue punched from wing membrane was stored at − 40 °C. Total genomic DNA was extracted from the tissue sample using the DNeasy® Blood & Tissue Kit (Qiagen, Valencia, CA, USA), according to the manufacturer-supplied protocols.

The complete mitochondrial genome of M. ussuriensis, which has described in recent our publication [1], was obtained using the 29 primer sets (Table 1), based on previously published mitochondrial genomes of Myotis formosus [3] and Rhinolophus ferrumequinum [4], [5]. The neighboring primers were designed so that some portions of 5′-terminal and 3′-terminal parts of the amplified-neighboring fragments could overlap each other (Table 1).

Table 1

Sequences of PCR primers used to amplify the complete Murina ussuriensis mitogenome.

Primer name	Primer sequence (5′ → 3′)	Amplification position	Reference
Bat_12SF1	GTAACAAGGTAAGTGTACTG	1–951	This study
Bat-12SR	AAAGCAAARCACTGAAAATG	724–1740	[12]
Bat-12SF	TTTCATCTTTTCCTTGCGGTAC	832–1857	[12]
Bat-16SF	CYGGAAAGTGTGCTTGGA	1719–2731	[12]
Bat-16SR	GCAATTACCGRRCTCTGCCA	2370–3308	[12]
L2985	CCTCGATGTTGGATCAGG	3123–4047	[13]
ND1R_957	TTATGTTTGGGGGGGAACACT	3447–4322	This study
ND1F_957	ATGTATTTTATTAATCTACTGGCAACA	3452–4343	This study
H4419	GTATGGGCCCGATAGCTT	3605–4488	[13]
Mu_ND1F(long)	GTATCTGGCTTCAATGTAGAATACGCAGGAGGC	4077–5731	This study
Mu_COIR	TGATTCTTTGGCCACCCAGAA	5418–6337	This study
Mu_COIR_500	TCCAGCAGGATCAAAGAAGG	6176–6629	This study
Mu_COIF_500	TCACTGCCCATGCTTTTGTA	6208–7227	This study
Mu_D-COIF1	AGCTACTATAATTATTGCTATTCC	6955–7928	This study
Mu_D-cLR1	CGGCAGGTAAGACAACTC	7267–8090	This study
Mu_c-LR	ACTGTACCAGCCCAAAGG	7863–8904	This study
L8929	GGACAATGCTCAGAAATCTGCGG	8649–9367	[14]
Mu_c-L1	CTGTTTATTCAGCCAATAGCC	9091–10,119	This study
Mu_c-L2	CTCCATGTTATTATTGGCTC	9957–11,695	This study
Mu_B1-L4	CCGCTCTATGGACTCCAC	11,514–12,545	This study
Mu_B1-cytbH3	TGTTTTCGTTGATTAATACAAGG	12,704–13,709	This study
Mu_B1-L5	ACTGCTAATTCATGCGCC	12,355–13,309	This study
Mu_B1-L6	TATAGAAGGTCCCACACC	13,171–14,240	This study
Mu_B1-cytbH2	GGAGCAGTATCCTGAGTC	13,521–14,486	This study
Mu_B1-CytbH1	CTGTTGCTATAACAGCAAAG	14,357–15,322	This study
Mu_CytbH	GGCTTTATCAGCTGAGAATCCTCCTCAGATTCC	14,875–15,244	This study
H6	TCTCCATTTCTGGTTTACAAGAC	15,135–15,974	[15]
Mu_CytbF	AATAACAACCCTAATAGCACTAGT	15,577–16,525	This study
Mu_A2-CytbF1	TACAATTTAAACGAGTACATAATAC	16,331–17,286	This study

PCR amplification and DNA sequencing

PCR amplification was performed in a final reaction volume of 20 μL, which contains 10 mM Tris–HCl (pH 8.4), 50 mM KCl, 4 mM MgCl2, 200 mM each dNTP, 50 pmol each primer, 2 U ExTaq polymerase, and 1 μL of DNA sample, under the following conditions: 94 °C for 5 min (initial denaturation); then 94 °C for 1 min (denaturation), 46–62 °C for 30 s (annealing), and 72 °C for 2 min (extension) for 35 cycles; and a final extension at 72 °C for 10 min. The PCR products were resolved by electrophoresis with a 1.0% agarose gel, extracted using a DNA Gel Extraction Kit (Qiagen, Valencia. CA, USA), and sent to Biomedic Co., Ltd. (Bucheon, South Korea) for sequencing from both directions by using a primer-walking strategy.

Identification and secondary structure of mitochondrial tRNA genes

Complete sequence of mitochondrial genome of M. ussuriensis was aligned with the mitochondrial genomes of M. formosus [3] and R. ferrumequinum [4] using ClustalW implemented in Geneious Pro 5.5.9 (Auckland, New Zealand), and then positions of 22 mitochondrial tRNA gene sequences were identified using the two mitochondrial genomes as references for annotation and characterization.

Gene organization and nucleotide composition of transfer RNA genes

Composition skewing of nucleotides was calculated according to the formulas: AT skew = [A − T] / [A + T] and GC skew = [G − C] / [G + C] [6].

Mitochondrial 22 tRNA genes were interspersed on mitogenome (Table 2). The tRNA genes included two leucine-tRNA genes (tRNA and tRNA) and two serine-tRNA genes (tRNA and tRNA). The combined size of 22 tRNA genes is 1516 bp and their average length is 68.9 ± 2.70 bp (n = 22), ranging in size from 62 bp in tRNA to 74 bp in tRNA and tRNA (Table 2).

Table 2

Nucleotide composition in the 22 tRNA of Murina ussuriensis mitogenome.

Gene	Position on mitogenome		Length (bp)	Nucleotide composition (bp)					AT skew	GC skew
Start	Stop	A	T	C	G	AT (%)
tRNAPhe	1	71	71	30	17	12	12	47 (66.2)	0.28	0.00
tRNAVal	1044	1112	69	26	19	13	11	45 (65.2)	0.16	− 0.08
tRNALeu(UUR)	2671	2744	74	24	22	12	16	46 (62.2)	0.04	0.14
tRNAIle	3706	3774	69	24	24	9	12	48 (69.6)	0.00	0.14
tRNAGln	3772	3845	74	26	23	17	8	49 (66.2)	0.06	− 0.36
tRNAMet	3846	3914	69	21	17	18	13	38 (55.1)	0.11	− 0.16
tRNATrp	4957	5023	67	22	21	13	11	43 (64.2)	0.02	− 0.08
tRNAAla	5028	5096	69	27	17	16	9	44 (63.8)	0.23	− 0.28
tRNAAsn	5098	5170	73	28	18	16	11	46 (63.0)	0.22	− 0.19
tRNACys	5203	5268	66	20	18	15	13	38 (57.6)	0.05	− 0.07
tRNATyr	5269	5336	68	18	23	16	11	41 (60.3)	− 0.12	− 0.19
tRNASer(UCN)	6892	6960	69	22	18	18	11	40 (58.0)	0.10	− 0.24
tRNAAsp	6968	7034	67	22	23	9	13	45 (67.2)	− 0.02	0.18
tRNALys	7722	7788	67	25	22	11	9	47 (70.1)	0.06	− 0.10
tRNAGly	9415	9481	67	25	23	11	8	48 (71.6)	0.04	− 0.16
tRNAArg	9829	9898	70	30	28	6	6	58 (82.9)	0.03	0.00
tRNAHis	11,568	11,636	69	30	22	10	7	52 (75.4)	0.15	− 0.18
tRNASer(AGY)	11,637	11,698	62	19	15	15	13	34 (54.8)	0.12	− 0.07
tRNALeu(CUN)	11,699	11,769	71	27	21	10	13	48 (67.6)	0.13	0.13
tRNAGlu	14,096	14,164	69	23	21	14	11	44 (63.8)	0.05	− 0.12
tRNAThr	15,311	15,380	70	24	20	14	12	44 (62.9)	0.09	− 0.08
tRNAPro	15,380	15,445	66	25	16	16	9	41 (62.1)	0.22	− 0.28
Concatenated length			1516	538	448	291	239	986	0.1	− 0.1
Average			68.9	24.5	20.4	13.2	10.9	44.8	0.1	− 0.1

The number in parenthesis indicates percentage of AT content.

Overall nucleotide composition of the combined 22 tRNA genes is AT bias with nucleotide composition of 33.5% A, 29.6% T, 19.2% C and 15.8% G, showing pattern of A > T > C > G. Among 22 tRNA genes, the most common pattern is A > T ≧ C ≧ G which is observed in 16 tRNA genes. The pattern of A ≧ T > G > C is observed in tRNA, tRNA and tRNA, pattern of T > A > C > G in tRNA and pattern of T > A > G > C in tRNA, and pattern of A > C > T > G in tRNA, respectively. As expected by the nucleotide composition, average AT skew value of 22 tRNA genes and AT skew value of the concatenated 22 tRNA genes were positive, while GC skew was negative values, indicating existence of more ‘A’ residues on the strand than ‘T’ and more ‘C’ residues than ‘G’, respectively (Table 2). Among 22 tRNA genes, AT skew of 19 tRNA genes is positive, while the negative value is shown in tRNA and tRNA and zero value in tRNA, which the frequencies of A and T is same. In case of GC skew, the positive value is shown in tRNA, tRNA, tRNA and tRNA, zero value in tRNA and tRNA, and the negative value in the other 16 tRNA genes. The two leucine tRNA genes (tRNAand tRNA) have positive value in both AT skew and GC skew.

Secondary structure and feature of transfer RNA genes

Both the tRNA scan-SE search server and Arwen web server with default parameters were used for the confirmation of tRNA gene sequences and potential stem-loop secondary structures within these tRNAs deduced from the tRNA genes [7], [8].

Canonical cloverleaf secondary structure is observed in all the other the tRNAs except tRNASer(AGY) without DHU in its secondary structure. Such deletion of DHU arm in secondary structure of tRNASer(AGY) was considered a common condition in the metazoan mitogenome [9], [10]. The lengths of amino acid acceptor stem and anticodon stem are 7 bp and 5 bp, respectively, in the 21 tRNAs except for tRNASer(AGY), which has 6 bp in the anticodon stem. The CCA 3′-terminal group used to attach the amino acid was added during processing and therefore did not appear in all the tRNAs.

Multiple non-Watson–Crick base pairs appear in the amino acceptor stems of tRNAVal (U·G), tRNALeu(UUR) (G·U), tRNAGln (A·A), tRNAMet (A·G), tRNAAla (G·U), tRNAAsn (U·U), tRNACys (U·G, U·G), tRNASer(UCN) (G·U), tRNAHis (C·A), tRNAGlu (A·U), and tRNAThr (A·A), the anticodon stems of tRNALeu(UUR) (U·U, G·U), tRNAAla (U·U, U·U), tRNAAsn (U·C), tRNASer(UCN) (G·U, U·G), tRNAAsp (U·G), tRNAHis (C·A) and tRNASer(AGY) (A·A), and the TΨC arm of tRNAVal (C ∙ A), tRNAGln (U·G), tRNAMet (U·U, U·U), tRNAAla (U·G), tRNAAsn (G·U), tRNASer(UCN) (G·U, G·U), tRNAAsp (U·G), tRNALeu(CUN) (U·G), tRNAGlu (G·A), tRNAThr (A·C) and tRNAPro (G·U) (Fig. 1). The most common non-Watson–Crick base pair was G·U (or U·G) wobble base pairs, followed by U·U base pairs. Since the G·U (or U·G) base pair has been known to provide comparable thermodynamic stability to Watson–Crick base pairs and is nearly isomorphic to them, they would be likely to substitutes for G·U or A·U base pairs, as observed in other metazoan animals [11].

Fig. 1

Secondary structure of 22 tRNAs of Murina ussuriensis.

Anticodon loop of tRNAs is well conserved (Table 3). The first Y-position in the 5′ side-anticodon (5′ side of anticodon) consists of only pyrimidine nucleotide ‘C’ or ‘U’ and in the second Y-position of the 5′ side-anticodon highly conserved ‘U’ is observed in 21 tRNAs except tRNAMet with ‘C’. Only purine nucleotide ‘A’ or ‘G’ is observed in the R-position in the 3′ side-anticodon. All four nucleotides are found in the N-position, but most common nucleotide is ‘A’, which is present in N-position of 15 tRNAs. A pyrimidine nucleotide ‘C’ is observed in N-position of only tRNAMet. Conserved sequences of anticodon loop could be classified into seven motifs (Table 3). Most common motif is CU-ANT-AA, which is found in 10 tRNAs. The motif CC-ANT-AC and UU-ANT-AG are shown only in tRNAMet and tRNAIle, respectively, and CT-ANT-GA is observed in two leucine-tRNAs.

Table 3

Motifs of nucleotide composition in anticodon loop of tRNA genes.

Motif	tRNAs	5′-Anticodon loop-3′
Y	Y	Anticodon			R	N
CC-ANT-AC	tRNAMet	C	C	·	·	·	A	C
CU-ANT-AA	tRNAPhe	C	U	·	·	·	A	A
tRNAGln	C	U	·	·	·	A	A
tRNATrp	C	U	·	·	·	A	A
tRNAAsn	C	U	·	·	·	A	A
tRNATyr	C	U	·	·	·	A	A
tRNASer(UCN)	C	U	·	·	·	A	A
tRNALys	C	U	·	·	·	A	A
tRNAGly	C	U	·	·	·	A	A
tRNASer(AGY)	C	U	·	·	·	A	A
tRNAThr	C	U	·	·	·	A	A
CU-ANT-GA	tRNALeu(UUR)	C	U	·	·	·	G	A
tRNALeu(CUN)	C	U	·	·	·	G	A
UU-ANT-AA	tRNACys	U	U	·	·	·	A	A
tRNAAsp	U	U	·	·	·	A	A
tRNAHis	U	U	·	·	·	A	A
UU-ANT-AC	tRNAVal	U	U	·	·	·	A	C
tRNAArg	U	U	·	·	·	A	C
UU-ANT-AG	tRNAIle	U	U	·	·	·	A	G
UU-ANT-GU	tRNAAla	U	U	·	·	·	G	U
tRNAGlu	U	U	·	·	·	G	U
tRNAPro	U	U	·	·	·	G	U

ANT indicates ‘anticodon’.

Discussion

We described here characteristics of mitochondrial 22 tRNA genes and 22 tRNAs of the Ussurian tube-nosed bat M. ussuriensis (Chiroptera: Vespertilionidae). Main contents of the present study include gene organization and nucleotide composition of mitochondrial 22 tRNA genes, description of secondary structure and feature of mitochondrial 22 tRNAs, and sequence motifs in anticodon loop. We also provide primer information and PCR condition for PCR amplification of the complete mitogenome of M. ussuriensis. Sequence dataset of the 22 tRNA genes used in the present study is chosen from recently published M. ussuriensis mitogenome.

Conflict of interest

The authors have no conflicts of interest.

Specifications
Organism/cell line/tissue	Murina ussuriensis/wing membrane
Sex	Male
Sequencer or array type	Applied Biosystems 3730 DNA Analyzer
Data format	Processed
Experimental factors	Whole mitochondrial genome of bat wing membrane
Experimental features	Secondary structure of 22 mitochondrial tRNA genes
Consent	n/a
Sample source location	Hongchun-gun, Gangwon Province, Republic of Korea