Wieneke Dijk1, Markus Heine2, Laurent Vergnes3,4, Mariëtte R Boon5,6, Gert Schaart7, Matthijs K C Hesselink7, Karen Reue3,4, Wouter D van Marken Lichtenbelt8, Gunilla Olivecrona9, Patrick C N Rensen5,6, Joerg Heeren2, Sander Kersten1. 1. Nutrition, Metabolism and Genomics group, Division of Human Nutrition, Wageningen University, Wageningen, The Netherlands. 2. Department of Biochemistry and Molecular Cell Biology, University Medical Center Hamburg-Eppendorf, Hamburg, Germany. 3. Department of Human Genetics, David Geffen School of Medicine, University of California, Los Angeles, Los Angeles, United States. 4. Molecular Biology Institute, University of California, Los Angeles, Los Angeles, United States. 5. Department of Medicine, Division of Endocrinology, Leiden University Medical Center, Leiden, The Netherlands. 6. Einthoven Laboratory for Experimental Vascular Medicine, Leiden Univeristy Medical Center, Leiden, The Netherlands. 7. Department of Human Movement Sciences, Maastricht University, Maastricht, The Netherlands. 8. Department of Human Biology, Maastricht University Medical Centre, Maastricht, The Netherlands. 9. Department of Medical Biosciences/Physiological Chemistry, Umeå University, Umeå, Sweden.
Abstract
Brown adipose tissue (BAT) activation via cold exposure is increasingly scrutinized as a potential approach to ameliorate cardio-metabolic risk. Transition to cold temperatures requires changes in the partitioning of energy substrates, re-routing fatty acids to BAT to fuel non-shivering thermogenesis. However, the mechanisms behind the redistribution of energy substrates to BAT remain largely unknown. Angiopoietin-like 4 (ANGPTL4), a protein that inhibits lipoprotein lipase (LPL) activity, is highly expressed in BAT. Here, we demonstrate that ANGPTL4 is part of a shuttling mechanism that directs fatty acids derived from circulating triglyceride-rich lipoproteins to BAT during cold. Specifically, we show that cold markedly down-regulates ANGPTL4 in BAT, likely via activation of AMPK, enhancing LPL activity and uptake of plasma triglyceride-derived fatty acids. In contrast, cold up-regulates ANGPTL4 in WAT, abolishing a cold-induced increase in LPL activity. Together, our data indicate that ANGPTL4 is an important regulator of plasma lipid partitioning during sustained cold.
Brown adipose tissue (BAT) activation via cold exposure is increasingly scrutinized as a potential approach to ameliorate cardio-metabolic risk. Transition to cold temperatures requires changes in the partitioning of energy substrates, re-routing fatty acids to BAT to fuel non-shivering thermogenesis. However, the mechanisms behind the redistribution of energy substrates to BAT remain largely unknown. Angiopoietin-like 4 (ANGPTL4), a protein that inhibits lipoprotein lipase (LPL) activity, is highly expressed in BAT. Here, we demonstrate that ANGPTL4 is part of a shuttling mechanism that directs fatty acids derived from circulating triglyceride-rich lipoproteins to BAT during cold. Specifically, we show that cold markedly down-regulates ANGPTL4 in BAT, likely via activation of AMPK, enhancing LPL activity and uptake of plasma triglyceride-derived fatty acids. In contrast, cold up-regulates ANGPTL4 in WAT, abolishing a cold-induced increase in LPL activity. Together, our data indicate that ANGPTL4 is an important regulator of plasma lipid partitioning during sustained cold.
Entities:
Keywords:
angiopoietin-like 4; brown adipose tissue; energy metabolism; human biology; lipoprotein lipase; medicine; mouse; triglyceride-rich lipoproteins; white adipose tissue
Adipose tissue can be classified into white adipose tissue (WAT) and brown adipose tissue (BAT). Whereas WAT represents the main energy storage organ in the body, BAT is dedicated to the generation of heat via the burning of lipids. BAT is activated during cold exposure, when additional heat production is needed to maintain core body temperature. Heat production by BAT is stimulated via release of norepinephrine by the sympathetic nervous system, causing activation of β-adrenergic signalling and subsequent uncoupling of ATP production from mitochondrial respiration (Cannon and Nedergaard, 2004). Uncoupling in BAT is mediated by the uncoupling protein UCP1, which is highly abundant specifically in BAT (Cannon and Nedergaard, 2004). Studies in the last decade have shown the presence of BAT in humans and have provided preliminary evidence for an inverse relationship between BAT activity and parameters of obesity (van Marken Lichtenbelt et al., 2009; Virtanen et al., 2009; Wang et al., 2011). As a consequence, interest in BAT function and the possible targeting of BAT for treatment or prevention of metabolic diseases has surged.Upon cold exposure, oxidation of fuels by BAT is dramatically increased. In addition to circulating glucose and free fatty acids, fatty acids derived from circulating triglyceride-rich lipoproteins (TRLs) represent a major fuel source for BAT (Cannon and Nedergaard, 2004). The liberation of fatty acids from TRLs is catalyzed by the enzyme lipoprotein lipase (LPL), which is highly abundant in BAT (Bartelt et al., 2011; Kersten, 2014). Cold exposure markedly stimulates LPL activity in BAT, causing a concomitant increase in TRL-derived fatty acid uptake and even uptake of whole lipoprotein particles (Bartelt et al., 2011; Khedoe et al., 2014; Klingenspor et al., 1996). The increase in fatty acid uptake upon cold exposure, which can be mimicked by pharmacological ß3-adrenergic receptor activation, is highly specific for BAT, suggesting that the body may specifically re-direct lipid fuels to BAT during cold exposure (Bartelt et al., 2011; Berbée et al., 2015; Khedoe et al., 2014). Both transcriptional and (post-)translational regulation has been implicated in the increased LPL activity in BAT upon cold exposure. However, the specific underlying mechanisms have remained elusive (Carneheim et al., 1988; Giralt et al., 1990; Mitchell et al., 1992).Angiopoietin-like 4 (ANGPTL4) has previously been identified as an inhibitor of LPL activity in muscle and WAT. Alterations of Angptl4 expression in these tissues mediate the changes in LPL activity observed during exercise and fasting, respectively (Catoire et al., 2014; Kroupa et al., 2012). In the initial paper describing the cloning of Angptl4, we had seen high expression of Angptl4 mRNA in BAT (Kersten et al., 2000). Since the exact mechanisms behind regulation of LPL activity in BAT upon cold exposure are currently unclear, we hypothesized that ANGPTL4 may act as an important regulator of LPL-mediated fatty acid uptake into BAT. Accordingly, in the present paper we studied the role of ANGPTL4 in lipid metabolism during cold exposure, taking advantage of Angptl4-deficient (Angptl4-/-) mice and Angptl4-overexpressing (Angptl4-Tg) mice.
Results
ANGPTL4 expression in BAT is down-regulated upon sustained cold exposure
ANGPTL4 and LPL protein are co-expressed in BAT (Figure 1A), suggesting a possible role for ANGPTL4 in regulating LPL in BAT. The specificity of the antibody used in the immunoblotting for ANGPTL4 was demonstrated by the lack of observable signal in BAT of Angptl4-/- mice (Figure 1B - left panel). Interestingly, we detected bands for ANGPTL4 at a molecular weight of ∼52 kDa and ∼45 kDa. The expected molecular weight of ANGPTL4 protein is 45 kDa, with a predicted glycosylation site at amino acid Asparagine-177 (in humans) or Asparagine 181 (in mice) (Ge et al., 2004; Kim et al., 2000; Yang et al., 2008; Yoon et al., 2000). Consistent with the notion that these bands represent glycosylated (∼52 kDa) and non-glycosylated forms (∼45 kDa) of ANGPTL4, the 52 kDa band disappeared following treatment of BAT lysates with the endoglycosidase PGNase, while the 45 kDa band became more intense (Figure 1B – right panel). These data indicate that ANGPTL4 protein is present in BAT in glycosylated and non-glycosylated forms. Immunofluorescent staining on sections from human BAT obtained during surgery (as qualified based on UCP1 staining) showed that ANGPTL4 is also expressed in human BAT (Figure 1C). In agreement with high ANGPTL4 expression levels in BAT, Angptl4 mRNA increased markedly upon differentiation of a mouse brown adipocyte cell line (Figure 1D).
Figure 1.
ANGPTL4 expression in BAT is down-regulated upon sustained cold exposure.
(A) Immunoblot for mouse ANGPTL4 and mouse LPL in lysates of kidney, spleen, heart, muscle, gonodal WAT, inguinal WAT and BAT of a C57BL/6J wild-type mouse. (B) Validation of anti-mANGPTL4 antibody in BAT lysates of Angptl4-/-, wild-type and Angptl4-Tg mice (left panel). Detection of glycosylated and non-glycosylated mANGPTL4 following treatment of BAT homogenate of a wild-type mouse with PGNase (right panel). (C) Immunofluorescent staining of UCP1 (upper panel; UCP1 = green, DAPI = blue), DAPI only (middle panel) and hANGPTL4 (lower panel; hANGPTL4 = green, DAPI = blue) in frozen sections (5 μm) of human BAT. (D) Angptl4 mRNA in T37i cells after 0, 3, 6 or 9 days of differentiation. (E) Angptl4 mRNA in BAT lysates of wild-type mice exposed to 4°C or 28°C for 1 or 10 days. (F) Immunoblot for ANGPTL4 in BAT homogenates of wild-type mice exposed to 4°C or 28°C for 10 days, following treatment with or without PGNase. (G) Lpl mRNA in BAT lysates of wild-type mice exposed to 4°C or 28°C for 1 or 10 days. * Statistically significant compared to control wells or compared to mice exposed to 28°C according to Student’s t-test (p<0.05). Error bars represent ± SEM. n = 8–10 mice per group.
DOI:
http://dx.doi.org/10.7554/eLife.08428.003
ANGPTL4 expression in BAT is down-regulated upon sustained cold exposure.
(A) Immunoblot for mouseANGPTL4 and mouseLPL in lysates of kidney, spleen, heart, muscle, gonodal WAT, inguinal WAT and BAT of a C57BL/6J wild-type mouse. (B) Validation of anti-mANGPTL4 antibody in BAT lysates of Angptl4-/-, wild-type and Angptl4-Tgmice (left panel). Detection of glycosylated and non-glycosylated mANGPTL4 following treatment of BAT homogenate of a wild-type mouse with PGNase (right panel). (C) Immunofluorescent staining of UCP1 (upper panel; UCP1 = green, DAPI = blue), DAPI only (middle panel) and hANGPTL4 (lower panel; hANGPTL4 = green, DAPI = blue) in frozen sections (5 μm) of human BAT. (D) Angptl4 mRNA in T37i cells after 0, 3, 6 or 9 days of differentiation. (E) Angptl4 mRNA in BAT lysates of wild-type mice exposed to 4°C or 28°C for 1 or 10 days. (F) Immunoblot for ANGPTL4 in BAT homogenates of wild-type mice exposed to 4°C or 28°C for 10 days, following treatment with or without PGNase. (G) Lpl mRNA in BAT lysates of wild-type mice exposed to 4°C or 28°C for 1 or 10 days. * Statistically significant compared to control wells or compared to mice exposed to 28°C according to Student’s t-test (p<0.05). Error bars represent ± SEM. n = 8–10 mice per group.DOI:
http://dx.doi.org/10.7554/eLife.08428.003We next explored the possible impact of cold on ANGPTL4 expression in BAT. Intriguingly, whereas 1 day of cold exposure did not affect Angptl4 expression, 10 days of cold exposure led to a marked reduction in Angptl4 mRNA (Figure 1E). The reduction in Angptl4 mRNA was paralleled by a marked decrease in ANGPTL4 protein, particularly the glycosylated form of ANGPTL4 (Figure 1F). In contrast, expression of Lpl was mildly elevated after both 1 and 10 days of cold exposure (Figure 1G).
Down-regulation of ANGPTL4 expression promotes BAT LPL activity upon sustained cold exposure.
To investigate a possible role for ANGPTL4 in BAT function, we exposed Angptl4-/-, wild-type and Angptl4-Tgmice to a cold (4°C) or thermo-neutral (28°C) environment for 10 days in order to activate and recruit BAT (Figure 2A). The Angptl4-Tgmice overexpress Angptl4 under its own promoter and show elevated Angptl4 expression in a variety of tissues, including BAT (Mandard et al., 2006). The sustained cold exposure resulted in pronounced changes in BAT morphology, food intake, body weight, weights of BAT and WAT, and body temperature, but no clear differences between the genotypes could be observed (Figure 2B–F). Likewise, expression of the key thermogenic genes Ucp1 and Elovl3 was significantly increased upon cold exposure but not affected by Angptl4 genotype (Figure 2G).
Figure 2.
Down-regulation of ANGPTL4 in BAT upon sustained cold exposure affects plasma TG levels.
(A) Schematic representation of cold exposure experiment with Angptl4-/-, wild-type and Angptl4-Tg mice. (B) Haematoxylin & Eosin staining on BAT sections (5 μm) of Angptl4-/-, wild-type and Angptl4-Tg mice exposed to 4°C or 28°C for 10 days. (C) Food intake of Angptl4-/-, wild-type and Angptl4-Tg mice exposed to 4°C for 10 days. (D) Weight gain of Angptl4-/-, wild-type and Angptl4-Tg mice exposed to 4°C during 10 days. (E) BAT and WAT tissue weights and (F) body temperature of Angptl4-/-, wild-type and Angptl4-Tg mice exposed to 4°C or 28°C for 10 days. (G) Elovl3 and Ucp1 mRNA expression levels of Angptl4-/-, wild-type and Angptl4-Tg mice exposed to 4°C or 28°C for 10 days. (H) Plasma glucose, (I) plasma free fatty acids, and (J) plasma glycerol levels of Angptl4-/-, wild-type and Angptl4-Tg mice exposed to 4°C or 28°C for 10 days. (K) Glycerol levels in medium of differentiated primary white adipocytes from Angptl4-/-, wild-type and Angptl4-Tg mice, serum-starved and treated with 10 μM isoproterenol for 3 hr. (J) plasma TG levels of Angptl4-/-, wild-type and Angptl4-Tg mice exposed to 4°C or 28°C for 10 days. (K) Fast protein liquid chromatography (FPLC) on pooled plasma samples of Angptl4-/-, wild-type and Angptl4-Tg mice exposed to 4°C for 10 days, followed by analysis of TG levels in all fractions. *Statistically significant compared to mice of equal genotype at 28°C or between groups as indicated by bars according to two-way ANOVA followed by a post-hoc Tukey HSD test (p<0.05). Error bars represent ± SEM. n = 8–10 mice per group.
DOI:
http://dx.doi.org/10.7554/eLife.08428.004
Down-regulation of ANGPTL4 in BAT upon sustained cold exposure affects plasma TG levels.
(A) Schematic representation of cold exposure experiment with Angptl4-/-, wild-type and Angptl4-Tgmice. (B) Haematoxylin & Eosin staining on BAT sections (5 μm) of Angptl4-/-, wild-type and Angptl4-Tgmice exposed to 4°C or 28°C for 10 days. (C) Food intake of Angptl4-/-, wild-type and Angptl4-Tgmice exposed to 4°C for 10 days. (D) Weight gain of Angptl4-/-, wild-type and Angptl4-Tgmice exposed to 4°C during 10 days. (E) BAT and WAT tissue weights and (F) body temperature of Angptl4-/-, wild-type and Angptl4-Tgmice exposed to 4°C or 28°C for 10 days. (G) Elovl3 and Ucp1 mRNA expression levels of Angptl4-/-, wild-type and Angptl4-Tgmice exposed to 4°C or 28°C for 10 days. (H) Plasma glucose, (I) plasma free fatty acids, and (J) plasma glycerol levels of Angptl4-/-, wild-type and Angptl4-Tgmice exposed to 4°C or 28°C for 10 days. (K) Glycerol levels in medium of differentiated primary white adipocytes from Angptl4-/-, wild-type and Angptl4-Tgmice, serum-starved and treated with 10 μM isoproterenol for 3 hr. (J) plasma TG levels of Angptl4-/-, wild-type and Angptl4-Tgmice exposed to 4°C or 28°C for 10 days. (K) Fast protein liquid chromatography (FPLC) on pooled plasma samples of Angptl4-/-, wild-type and Angptl4-Tgmice exposed to 4°C for 10 days, followed by analysis of TG levels in all fractions. *Statistically significant compared to mice of equal genotype at 28°C or between groups as indicated by bars according to two-way ANOVA followed by a post-hoc Tukey HSD test (p<0.05). Error bars represent ± SEM. n = 8–10 mice per group.DOI:
http://dx.doi.org/10.7554/eLife.08428.004Following cold exposure, the energy requirements of BAT increase dramatically. Two major fuel sources for BAT are plasma glucose and free fatty acids, both of which were unaltered by cold and Angptl4 genotype (Figure 2H,I). Also, plasma glycerol, which is perhaps a better indicator of adipose tissue lipolysis than free fatty acids, was not different between the three genotypes (Figure 2J). Additionally, ex vivo treatment of differentiated primary white adipocytes with the non-selective β-adrenergic receptor agonist isoproterenol indicated a lack of effect of Angptl4 genotype on adipose tissue lipolysis (Figure 2K). Besides glucose and free fatty acids, circulating TG represent a major fuel for BAT during cold (Cannon and Nedergaard, 2004). Based on the marked decrease in Angptl4 mRNA levels in BAT upon prolonged cold exposure, we hypothesized that ANGPTL4 might play a role in the metabolism of circulating TG in BAT during cold. In line with this notion, the reduction in plasma TG visible in wild-type and Angptl4-/- mice in response to cold was greatly attenuated in Angptl4-Tgmice (Figure 2L). Lipoprotein profiling by fast protein liquid chromatography (FPLC) supported markedly augmented plasma TRL levels in cold-exposed Angptl4-Tgmice (Figure 2M).It is well-established that cold-induced reductions in plasma TG levels are mediated by increased LPL activity in BAT (Bartelt et al., 2011; Kersten, 2014; Klingenspor et al., 1996). Accordingly, we tested whether ANGPTL4 levels influence changes in BAT LPL activity upon prolonged cold exposure. Whereas wild-type mice respond to cold with a reduction in BAT ANGPTL4 mRNA and protein levels, Angptl4-Tgmice maintain higher ANGPTL4 mRNA and protein levels (Figure 3A,B). Mirroring the levels of ANGPTL4, the cold-induced changes in LPL activity in BAT exhibited a gradient across the three Angptl4 genotypes, with highest LPL activity observed in Angptl4-/- mice and lowest LPL activity in Angptl4-Tgmice (Figure 3C). Furthermore, the marked increase in LPL activity during cold observed in the wild-type mice was significantly blunted in Angptl4-Tgmice (Figure 3C). Interestingly, the two-fold increase in LPL activity by cold in Angptl4-/- mice indicates that part of the induction of LPL activity in BAT is independent of ANGPTL4 (Figure 3C), possibly via an increase in Lpl mRNA, which was observed in all three genotypes (Figure 3D) (Bartelt et al., 2011; Klingenspor et al., 1996). Overall, the marked gradient in LPL activity between Angptl4-/-, wild-type, and Angptl4-Tgmice strongly suggests that ANGPTL4 acts as an inhibitor of LPL activity in BAT.
Figure 3.
Down-regulation of ANGPTL4 in BAT upon sustained cold exposure promotes an increase in BAT LPL activity.
(A) Angptl4 mRNA in BAT of Angptl4-/-, wild-type and Angptl4-Tg mice exposed to 4°C or 28°C for 10 days. (B) Immunoblot for ANGPTL4 and LPL in BAT homogenates from Angptl4-/-, wild-type and Angptl4-Tg mice exposed to 4°C or 28°C for 10 days. (C) Total LPL activity and (D) Lpl mRNA in BAT of Angptl4-/-, wild-type and Angptl4-Tg mice exposed to 4°C or 28°C for 10 days. * Statistically significant compared to mice of equal genotype at 28°C or between groups as indicated by bars, according to two-way ANOVA followed by a post-hoc Tukey HSD test (p<0.05). Error bars represent ± SEM. n = 8–10 mice per group.
DOI:
http://dx.doi.org/10.7554/eLife.08428.005
Down-regulation of ANGPTL4 in BAT upon sustained cold exposure promotes an increase in BAT LPL activity.
(A) Angptl4 mRNA in BAT of Angptl4-/-, wild-type and Angptl4-Tgmice exposed to 4°C or 28°C for 10 days. (B) Immunoblot for ANGPTL4 and LPL in BAT homogenates from Angptl4-/-, wild-type and Angptl4-Tgmice exposed to 4°C or 28°C for 10 days. (C) Total LPL activity and (D) Lpl mRNA in BAT of Angptl4-/-, wild-type and Angptl4-Tgmice exposed to 4°C or 28°C for 10 days. * Statistically significant compared to mice of equal genotype at 28°C or between groups as indicated by bars, according to two-way ANOVA followed by a post-hoc Tukey HSD test (p<0.05). Error bars represent ± SEM. n = 8–10 mice per group.DOI:
http://dx.doi.org/10.7554/eLife.08428.005
Down-regulation of ANGPTL4 expression promotes uptake of TRL-derived fatty acids by BAT upon sustained cold exposure
To investigate the role of ANGPTL4 in plasma TG clearance by BAT, we injected cold-exposed Angptl4-/-, wild-type and Angptl4-Tgmice with radiolabelled VLDL-like emulsion particles containing glycerol tri[3H]oleate (hydrolysable by LPL; TRL-derived fatty acids) and [14C]cholesteryl-oleate (not hydrolysable by LPL; TRL-Chol) (see Figure 4—figure supplement 1 for experimental set-up) (Rensen et al., 1995). After 15 min, the mice were sacrificed and the tissue distribution of 3H and 14C activity was determined. As expected, cold exposure markedly increased the rate of clearance of the injected VLDL-like particles from the plasma (Figure 4A,B). However, after cold exposure, plasma clearance of glycerol tri[3H]oleate (TRL FA), but not [14C]cholesteryl-oleate (TRLChol), was significantly slower in Angptl4-Tgmice, indicating that Angptl4-overexpression inhibits LPL-mediated plasma TG clearance in the cold (Figure 4C,D). Cold exposure caused a marked increase in TRL-derived fatty acid uptake into BAT in all three genotypes, indicating that part of the increase in fatty acid uptake is independent of ANGPTL4 (Figure 4E). However, similar to LPL activity, a clear gradient in TRL-derived fatty acid uptake into BAT was observed between the three genotypes, with lowest uptake in Angptl4-Tgmice (Figure 4E). Similar results were obtained for [14C]cholesteryl-oleate, showing a marked decrease in BAT uptake in the Angptl4-Tgmice (Figure 4F). We repeated the plasma TG clearance studies using radiolabelled lipoprotein particles with a larger diameter, resembling postprandial chylomicrons. Again, Angptl4-overexpression markedly reduced uptake into BAT of the TRL-derived fatty acids and the core label cholesteryl-oleyloleate (Figure 4G,H). To visualize the TRL uptake process, we injected hydrophobic fluorescent nanocrystals embedded in lipoprotein particles (QD-TRLs) into cold-exposed Angptl4-/-, wild-type and Angptl4-Tgmice (Bruns et al., 2009). In agreement with a role for ANGPTL4 in TRL processing in BAT, increased accumulation of QD-TRLs was observed after cold exposure of wild-type mice, but not of Angptl4-Tgmice (Figure 4I). Furthermore, Angptl4-/- mice show an accumulation of QD-TRLs in BAT even when maintained at 28°C (Figure 4I). Together, these data are supportive of a major role for ANGPTL4 as a regulator of LPL activity and concomitant uptake of fatty acids into BAT upon prolonged cold exposure.
Figure 4—figure supplement 1.
(A,B) Schematic representation of clearance studies in Angptl4-/-, wild-type and Angptl4-Tg mice, consisting of 10 days of cold exposure or thermo-neutrality, followed by measurement of triglyceride clearance via injection of either radiolabelled VLDL-like particles or chylomicron-like particles.
Mice were sacrificed 20 min post-injection to analyze the distribution of the radioactive labels.
DOI:
http://dx.doi.org/10.7554/eLife.08428.007
Figure 4.
Down-regulation of ANGPTL4 in BAT upon sustained cold exposure promotes an increase in TRL-derived fatty acid uptake by BAT.
(A,B) Plasma 3H (A) and 14C (B) activity in wild-type mice exposed to 4°C or 28°C for 10 days intravenously injected with VLDL-like particles labelled with glycerol tri[3H]oleate (TRL FA) and [14C]cholesteryl-oleate (TRL Chol). (C,D) Plasma 3H (C) and 14C (D) activity in Angptl4-/-, wild-type and Angptl4-Tg mice intravenously injected with VLDL-like emulsion particles labelled with glycerol tri[3H]oleate (TRL FA) and [14C]cholesteryl-oleate (TRL Chol), following exposure to 4°C for 10 days. (E,F) 3H activity (E) and 14C activity (F) in interscapular BAT of Angptl4-/-, wild-type and Angptl4-Tg mice exposed to 4°C or 28°C for 10 days and intravenously injected with VLDL-like particles labelled with glycerol tri[3H]oleate (TRL FA) and [14C]cholesteryl-oleate (TRL Chol). (G,H) 14C and 3H activity in interscapular BAT of Angptl4-/-, wild-type and Angptl4-Tg mice exposed to 4°C or 28°C for 10 days and intravenously injected with chylomicron-like particles labelled with glycerol tri[14C]oleate (TRL FA) (G) and [3H]cholesteryl-oleyloleate (TRL Chol). (I) Fluorescent image of uptake of intravenously injected QD-TRLs into BAT of Angptl4-/-, wild-type and Angptl4-Tg mice exposed to 4°C or 28°C for 9 days. Image was taken 12 min post-injection. n = 2 mice per group.* Statistically significant compared to mice of equal genotype at 28°C or between groups as indicated by bars, according to two-way ANOVA followed by a post-hoc Tukey HSD test (p<0.05). Error bars represent ± SEM. n = 7 mice per group, unless otherwise indicated.
DOI:
http://dx.doi.org/10.7554/eLife.08428.006
Mice were sacrificed 20 min post-injection to analyze the distribution of the radioactive labels.
DOI:
http://dx.doi.org/10.7554/eLife.08428.007
Down-regulation of ANGPTL4 in BAT upon sustained cold exposure promotes an increase in TRL-derived fatty acid uptake by BAT.
(A,B) Plasma 3H (A) and 14C (B) activity in wild-type mice exposed to 4°C or 28°C for 10 days intravenously injected with VLDL-like particles labelled with glycerol tri[3H]oleate (TRL FA) and [14C]cholesteryl-oleate (TRLChol). (C,D) Plasma 3H (C) and 14C (D) activity in Angptl4-/-, wild-type and Angptl4-Tgmice intravenously injected with VLDL-like emulsion particles labelled with glycerol tri[3H]oleate (TRL FA) and [14C]cholesteryl-oleate (TRLChol), following exposure to 4°C for 10 days. (E,F) 3H activity (E) and 14C activity (F) in interscapular BAT of Angptl4-/-, wild-type and Angptl4-Tgmice exposed to 4°C or 28°C for 10 days and intravenously injected with VLDL-like particles labelled with glycerol tri[3H]oleate (TRL FA) and [14C]cholesteryl-oleate (TRLChol). (G,H) 14C and 3H activity in interscapular BAT of Angptl4-/-, wild-type and Angptl4-Tgmice exposed to 4°C or 28°C for 10 days and intravenously injected with chylomicron-like particles labelled with glycerol tri[14C]oleate (TRL FA) (G) and [3H]cholesteryl-oleyloleate (TRLChol). (I) Fluorescent image of uptake of intravenously injected QD-TRLs into BAT of Angptl4-/-, wild-type and Angptl4-Tgmice exposed to 4°C or 28°C for 9 days. Image was taken 12 min post-injection. n = 2 mice per group.* Statistically significant compared to mice of equal genotype at 28°C or between groups as indicated by bars, according to two-way ANOVA followed by a post-hoc Tukey HSD test (p<0.05). Error bars represent ± SEM. n = 7 mice per group, unless otherwise indicated.DOI:
http://dx.doi.org/10.7554/eLife.08428.006
(A,B) Schematic representation of clearance studies in Angptl4-/-, wild-type and Angptl4-Tg mice, consisting of 10 days of cold exposure or thermo-neutrality, followed by measurement of triglyceride clearance via injection of either radiolabelled VLDL-like particles or chylomicron-like particles.
Mice were sacrificed 20 min post-injection to analyze the distribution of the radioactive labels.DOI:
http://dx.doi.org/10.7554/eLife.08428.007
ANGPTL4 expression and LPL activity are oppositely regulated in WAT and BAT upon sustained cold exposure.
Whereas BAT utilizes lipids to fuel thermogenesis, WAT provides lipid fuels to be used by BAT. Accordingly, lipid uptake and LPL activity are expected to be regulated differently in BAT as compared to WAT. Indeed, whereas in wild-type miceLPL activity in BAT increased dramatically during cold, LPL activity in WAT remained unchanged, at least in wild-type and Angptl4-Tgmice (Figure 5A). However, LPL activity was increased by cold in Angptl4-/- mice, indicating that ANGPTL4prevents LPL activity in WAT from going up during cold (Figure 5A). In support of this function for ANGPTL4, cold exposure caused a marked increase in Angptl4 mRNA and protein levels in WAT (Figure 5B,C). In contrast to Angptl4, Lpl mRNA levels were not significantly altered in WAT upon sustained cold exposure (Figure 5D). Interestingly, exposure of human subjects to mild cold (16°C) for 48 hr significantly increased plasma ANGPTL4 levels in obese subjects, but not in lean subjects. Considering the higher adipose tissue mass in obese individuals, these data suggest that the increase in ANGPTL4 production in WAT dominates ANGPTL4 levels in human plasma (Figure 5—figure supplement 1).
Figure 5.
Up-regulation of ANGPTL4 in WAT upon sustained cold exposure suppresses WAT LPL activity and TRL-derived fatty acid uptake.
(A) Total LPL activity levels and (B) Angptl4 mRNA in WAT of Angptl4-/-, wild-type and Angptl4-Tg mice exposed to 4°C or 28°C for 10 days. (C) Immunoblot for ANGPTL4 and LPL in WAT homogenates of wild-type mice exposed to 4°C or 28°C for 10 days. (D) Lpl mRNA in WAT of Angptl4-/-, wild-type and Angptl4-Tg mice exposed to 4°C or 28°C for 10 days. (E–H) Activity of 3H and 14C radiolabels in WAT of Angptl4-/-, wild-type and Angptl4-Tg mice exposed to 4°C or 28°C for 10 days and intravenously injected with radiolabelled VLDL-like (E,G) and chylomicron-like particles (F,H). TRL FA uptake (E,F) reflects uptake of glycerol tri[3H/14C]oleate, whereas TRL Chol uptake (G,H) reflects uptake of the core labels [14C]cholesteryl-oleate or [3H]cholesteryl-oleyloleate. (I) Fluorescent image of uptake of intravenously injected QD-TRLs into WAT of Angptl4-/-, wild-type and Angptl4-Tg mice exposed to 4°C or 28°C for 9 days. Image was taken after perfusion of mice with PBS containing 50 IU/mL heparin and upon cryosectioning of tissues. n = 2 mice per group. * Statistically significant compared to mice of equal genotype at 28°C or between groups as indicated by bars, according to two-way ANOVA followed by a post-hoc Tukey HSD test (p<0.05). Error bars represent ± SEM. n = 7–10 mice per group, unless otherwise indicated.
DOI:
http://dx.doi.org/10.7554/eLife.08428.008
Differences between mild cold and baseline were statistically significant in the obese group (paired Student’s t-test (p<0.05)). n = 10 individuals per group.
DOI:
http://dx.doi.org/10.7554/eLife.08428.009
*Statistically significant compared to mice of equal genotype at 28°C or between groups as indicated by bars, according to two-way ANOVA followed by a post-hoc Tukey HSD test (p<0.05). Error bars represent ± SEM. n = 7–10 mice per group.
DOI:
http://dx.doi.org/10.7554/eLife.08428.010
Figure 5—figure supplement 1.
(A,B) Plasma ANGPTL4 levels in 10 obese (A) and 10 lean (B) individuals before and after exposure to a mild cold (16°C) for 48 hr (Wijers et al., 2010).
Differences between mild cold and baseline were statistically significant in the obese group (paired Student’s t-test (p<0.05)). n = 10 individuals per group.
DOI:
http://dx.doi.org/10.7554/eLife.08428.009
Up-regulation of ANGPTL4 in WAT upon sustained cold exposure suppresses WAT LPL activity and TRL-derived fatty acid uptake.
(A) Total LPL activity levels and (B) Angptl4 mRNA in WAT of Angptl4-/-, wild-type and Angptl4-Tgmice exposed to 4°C or 28°C for 10 days. (C) Immunoblot for ANGPTL4 and LPL in WAT homogenates of wild-type mice exposed to 4°C or 28°C for 10 days. (D) Lpl mRNA in WAT of Angptl4-/-, wild-type and Angptl4-Tgmice exposed to 4°C or 28°C for 10 days. (E–H) Activity of 3H and 14Cradiolabels in WAT of Angptl4-/-, wild-type and Angptl4-Tgmice exposed to 4°C or 28°C for 10 days and intravenously injected with radiolabelled VLDL-like (E,G) and chylomicron-like particles (F,H). TRL FA uptake (E,F) reflects uptake of glycerol tri[3H/14C]oleate, whereas TRLChol uptake (G,H) reflects uptake of the core labels [14C]cholesteryl-oleate or [3H]cholesteryl-oleyloleate. (I) Fluorescent image of uptake of intravenously injected QD-TRLs into WAT of Angptl4-/-, wild-type and Angptl4-Tgmice exposed to 4°C or 28°C for 9 days. Image was taken after perfusion of mice with PBS containing 50 IU/mL heparin and upon cryosectioning of tissues. n = 2 mice per group. * Statistically significant compared to mice of equal genotype at 28°C or between groups as indicated by bars, according to two-way ANOVA followed by a post-hoc Tukey HSD test (p<0.05). Error bars represent ± SEM. n = 7–10 mice per group, unless otherwise indicated.DOI:
http://dx.doi.org/10.7554/eLife.08428.008
(A,B) Plasma ANGPTL4 levels in 10 obese (A) and 10 lean (B) individuals before and after exposure to a mild cold (16°C) for 48 hr (Wijers et al., 2010).
Differences between mild cold and baseline were statistically significant in the obese group (paired Student’s t-test (p<0.05)). n = 10 individuals per group.DOI:
http://dx.doi.org/10.7554/eLife.08428.009
(A) Total LPL activity levels, (B) Angptl4 mRNA, and (C) Lpl mRNA in inguinal WAT (iWAT) of Angptl4-/-, wild-type and Angptl4-Tg mice exposed to 4°C or 28°C for 10 days.
*Statistically significant compared to mice of equal genotype at 28°C or between groups as indicated by bars, according to two-way ANOVA followed by a post-hoc Tukey HSD test (p<0.05). Error bars represent ± SEM. n = 7–10 mice per group.DOI:
http://dx.doi.org/10.7554/eLife.08428.010To determine if the suppressive effect of ANGPTL4 on LPL activity had any impact on uptake of TRL-derived fatty acids in WAT during cold, we measured fatty acid uptake following injection of radiolabelled VLDL-like and chylomicron-like emulsion particles. Even though the uptake behaviour of the two types of TRL-particles was somewhat different, ANGPTL4 expression caused a clear dose-dependent reduction in uptake of TRL-derived fatty acids and the core labels cholesteryl-oleate/cholesteryl-oleyloleate (Figure 5E–H). In addition, inhibition of TRL processing by ANGPTL4 in WAT was visually confirmed by injection of QD-TRLs, showing increased accumulation of QD-TRLs in WAT of Angptl4-/- mice, as compared to wild-type and Angptl4-Tgmice (Figure 5I).It is noteworthy that in the inguinal fat depot, cold-induced changes in Lpl mRNA, Angptl4 mRNA and LPL activity were similar to the changes observed in the gonadal fat depot described above, whereas changes in uptake of TRL-derived fatty acids upon cold exposure were quite distinct, most likely due to marked activation of browning in inguinal fat (Figure 6A,B; Figure 5—figure supplement 2). In contrast to BAT and WAT, uptake of TRL-derived fatty acids or cholesteryl-oleate/cholesteryl-oleyloleate from VLDL-like particles and chylomicron-like particles was minimally different between Angptl4-/-, wild-type and Angptl4-Tgmice in liver, skeletal muscle and spleen (Figure 6A,B). Taken together, our data indicate that in BAT down-regulation of ANGPTL4 promotes uptake of plasma TRL-derived fatty acids via enhanced LPL activity, whereas in WAT up-regulation of ANGPTL4 suppresses uptake of plasma TRL-derived fatty acids via inhibition of LPL activity, thereby directing plasma TG to BAT to be used as fuel.
Figure 6.
Uptake of TRL-like particles in liver, spleen and muscle is not affected by Angptl4 genotype.
(A) 3H and 14C activity in liver, spleen, muscle, inguinal WAT (iWAT) and subscapular BAT (sBAT) of Angptl4-/-, wild-type and Angptl4-Tg mice exposed to 4°C or 28°C for 10 days and intravenously injected with VLDL-like emulsion particles labelled with glycerol tri[3H]oleate (TRL FA) and [14C]cholesteryloleate (TRL Chol). (B) 3H and 14C activity in liver, spleen, muscle, iWAT and sBAT of Angptl4-/-, wild-type and Angptl4-Tg mice exposed to 4°C or 28°C for 10 days and intravenously injected with chylomicron-like particles labelled with glycerol tri[14C]oleate (TRL FA) and [3H]cholesteryl-oleyloleate (TRL Chol). *Statistically significant compared to values of wild-type mice according to Student’s t-test (p<0.05). Error bars represent ± SEM. n = 7 mice per group.
DOI:
http://dx.doi.org/10.7554/eLife.08428.011
Figure 5—figure supplement 2.
(A) Total LPL activity levels, (B) Angptl4 mRNA, and (C) Lpl mRNA in inguinal WAT (iWAT) of Angptl4-/-, wild-type and Angptl4-Tg mice exposed to 4°C or 28°C for 10 days.
*Statistically significant compared to mice of equal genotype at 28°C or between groups as indicated by bars, according to two-way ANOVA followed by a post-hoc Tukey HSD test (p<0.05). Error bars represent ± SEM. n = 7–10 mice per group.
DOI:
http://dx.doi.org/10.7554/eLife.08428.010
Uptake of TRL-like particles in liver, spleen and muscle is not affected by Angptl4 genotype.
(A) 3H and 14C activity in liver, spleen, muscle, inguinal WAT (iWAT) and subscapular BAT (sBAT) of Angptl4-/-, wild-type and Angptl4-Tgmice exposed to 4°C or 28°C for 10 days and intravenously injected with VLDL-like emulsion particles labelled with glycerol tri[3H]oleate (TRL FA) and [14C]cholesteryloleate (TRLChol). (B) 3H and 14C activity in liver, spleen, muscle, iWAT and sBAT of Angptl4-/-, wild-type and Angptl4-Tgmice exposed to 4°C or 28°C for 10 days and intravenously injected with chylomicron-like particles labelled with glycerol tri[14C]oleate (TRL FA) and [3H]cholesteryl-oleyloleate (TRLChol). *Statistically significant compared to values of wild-type mice according to Student’s t-test (p<0.05). Error bars represent ± SEM. n = 7 mice per group.DOI:
http://dx.doi.org/10.7554/eLife.08428.011
The opposite regulation of ANGPTL4 expression in BAT and WAT may be mediated by differential activation of AMPK
We next explored the mechanism accounting for the inverse regulation of ANGPTL4 expression in BAT and WAT. Since many of the cold-induced adaptations are triggered by β-adrenergic signalling, we examined the effect of β-adrenergic activation on ANGPTL4 expression in BAT and WAT using murine BAT (T37i cells) and WAT (3T3-F442a) cell lines and primary cells (Zennaro et al., 1998). In both BAT and WAT cells, treatment with the non-selective β-receptor agonist isoproterenol consistently resulted in a marked increase in expression of Angptl4 mRNA (Figure 7A,B). Induction of ANGPTL4 by β-adrenergic stimulation was confirmed at the protein level (Figure 7C). From these data, it is evident that activation of β-adrenergic signalling may contribute to the cold-induced up-regulation of ANGPTL4 in WAT, but cannot explain the down-regulation of ANGPTL4 observed in BAT. Levels of Lpl mRNA and protein in white and brown adipocytes were only mildly affected by treatment with β-adrenergic agonists (Figure 7C,D).
Figure 7.
AMPK is activated in BAT, but not WAT, upon sustained cold exposure.
(A) Angptl4 mRNA in differentiated mouse white adipocytes (primary adipocytes and 3T3F442a adipocytes) upon treatment with 10 μM isoproterenol (ISO) or control (CTRL) for 3 hr. (B) Angptl4 mRNA in differentiated brown adipocytes (primary adipocytes and T37i adipocytes) treated with 10 μM isoproterenol (ISO) orcontrol (CTRL) for 3 hr. (C) Immunoblot for ANGPTL4 and LPL protein in differentiated 3T3F422a cells treated with 10 μM isoproterenol (ISO) or control (CTRL) for 3 hr. (D) Lpl mRNA in differentiated mouse primary white or brown adipocytes upon treatment with 10 μM isoproterenol (ISO) or control (CTRL) for 3 hr. (E) Immunoblot for AMPKα1,2 and phospho-AMPK Thr172, AMPKα1, AMPKα2, AMPKβ1 and AMPKβ2 in tissue lysates of kidney, spleen, heart, muscle, liver, inguinal WAT, gonodal WAT and BAT. Homogenates are identical to the homogenates presented in Figure 1A. (F) Immunoblot for AMPKα1,2 and phospho-AMPK Thr172 in BAT and WAT lysates of wild-type mice exposed to 4°C or 28°C for 10 days. *Statistically significant compared to control samples or between indicated treatments according to Student’s t-test (p<0.05). Error bars represent ± SEM.
DOI:
http://dx.doi.org/10.7554/eLife.08428.012
AMPK is activated in BAT, but not WAT, upon sustained cold exposure.
(A) Angptl4 mRNA in differentiated mouse white adipocytes (primary adipocytes and 3T3F442a adipocytes) upon treatment with 10 μM isoproterenol (ISO) or control (CTRL) for 3 hr. (B) Angptl4 mRNA in differentiated brown adipocytes (primary adipocytes and T37i adipocytes) treated with 10 μM isoproterenol (ISO) orcontrol (CTRL) for 3 hr. (C) Immunoblot for ANGPTL4 and LPL protein in differentiated 3T3F422a cells treated with 10 μM isoproterenol (ISO) or control (CTRL) for 3 hr. (D) Lpl mRNA in differentiated mouse primary white or brown adipocytes upon treatment with 10 μM isoproterenol (ISO) or control (CTRL) for 3 hr. (E) Immunoblot for AMPKα1,2 and phospho-AMPKThr172, AMPKα1, AMPKα2, AMPKβ1 and AMPKβ2 in tissue lysates of kidney, spleen, heart, muscle, liver, inguinal WAT, gonodal WAT and BAT. Homogenates are identical to the homogenates presented in Figure 1A. (F) Immunoblot for AMPKα1,2 and phospho-AMPKThr172 in BAT and WAT lysates of wild-type mice exposed to 4°C or 28°C for 10 days. *Statistically significant compared to control samples or between indicated treatments according to Student’s t-test (p<0.05). Error bars represent ± SEM.DOI:
http://dx.doi.org/10.7554/eLife.08428.012We therefore considered mechanisms that are clearly different between BAT and WAT. Previously, it had been shown that 5’AMP-activated protein kinase (AMPK) is progressively activated with prolonged cold exposure and that AMPK expression is significantly higher in BAT compared to WAT (Mulligan et al., 2007). Consistent with this finding, we found that the catalytic α-subunits of AMPK, as well as phosphorylation of AMPK at Threonine-172 – indicative of AMPK activity – are barely detectable in WAT in the basal state (Figure 7E) (Viollet et al., 2009, 2010). Previously, differential tissue expression of isoforms of the α, β, and γ subunits of the AMPK heterotrimer was suggested to determine cellular and systemic responses to different metabolic stressors (Viollet et al., 2009, 2010). Intriguingly, we detected large differences in basal AMPK α- and β-subunit isoform distribution between BAT and WAT and, more specifically, found a high expression of the AMPKα2 catalytic subunit and the AMPKβ1 regulatory subunit in BAT compared to WAT (Figure 7E). The differences in total AMPK expression and subunit distribution may explain why WAT AMPK levels remain weak following sustained cold exposure, whereas a strong increase in AMPK and phospho-AMPK is observed in BAT (Figure 7F).In muscle cells, we found that AMPK activation strongly down-regulates ANGPTL4 mRNA and protein levels (Catoire et al., 2014). To examine the consequences of AMPK activation in BAT, we treated differentiated T37i brown adipocytes with multiple AMPK activators, including AICAR, A769662, metformin, and phenformin hydrochloride. Without exception, AMPK activation markedly down-regulated Angptl4 mRNA expression (Figure 8A). To further confirm the down-regulation of ANGPTL4 by AMPK, we treated different in vitro model systems for BAT with the AMPK activator AICAR. AICAR treatment of differentiated T37i adipocytes, BA adipocytes (Uldry et al., 2006) or murine primary brown adipocytes resulted in a marked decrease in ANGPTL4 mRNA and protein levels (Figure 8B,C). Part of the inhibitory effect of AMPK activation on Angptl4 expression in differentiated T37i adipocytes could be rescued by siRNA-mediated knock-down of AMPKα1 and AMPKα2, corroborating the suppressive effect of AMPK on Angptl4 expression (Figure 8D–F). Consistent with the notion that the negative regulation of ANGPTL4 by AMPK is specific for BAT, AICAR treatment markedly reduced ANGPTL4 mRNA and protein levels in BAT explants, but not WAT explants (Figure 8G,H). Based on these data, we propose that the different amount and activation of AMPK between BAT and WAT may be the critical factor in the differential regulation of ANGPTL4 between the two tissues during sustained cold.
Figure 8.
Activation of AMPK down-regulates ANGPTL4 expression specifically in brown adipocytes.
(A) Angptl4 mRNA in differentiated T37i adipocytes treated for 6 hr with 1 mM AICAR, 100 μM A769662, 1 mM metformin or 250 μM phenformin hydrochloride. (B) Angptl4 mRNA in differentiated primary brown adipocytes, BA adipocytes, or T37i adipocytes treated for indicated times with 1 mM AICAR. (C) Immunoblot for ANGPTL4, LPL, AMPKα1,2 and phospho-AMPK Thr172 in differentiated T37i cells treated with control (CTRL) or 1 mM AICAR for 3 hr. (D) Angptl4 mRNA in differentiated T37i adipocytes treated with CTRL siRNA or siRNA against AMPKα1 and AMPKα2 for 48 hr, followed by incubation with control (CTRL) or 1 mM AICAR for 3 hr. (E) Angptl4 mRNA in differentiated T37i adipocytes treated with CTRL siRNA or siRNA against AMPKα1 and AMPKα2 for 48 hr, followed by incubation with H2O control medium (CTRL) or 100 μM A769662 for 6 hr. (E) Ampkα1 and Ampkα2 mRNA in differentiated T37i adipocytes treated with CTRL siRNA or siRNA against AMPKα1 and AMPKα2 for 48 hr. (F) Angptl4 mRNA levels in BAT and WAT explants from C57BL/6J wild-type mice (∼50 μg) treated with H2O control medium (CTRL) or 1 mM AICAR for 3 hr. (G) Immunoblot for ANGPTL4 in BAT and WAT explants from C57BL/6J wild-type mice (∼50 mg) treated with H2O control medium (CTRL) or 1 mM AICAR for 3 hr. *Statistically significant compared to control samples or between indicated treatments, according to Student’s t-test (p<0.05). Error bars represent ± SEM.
DOI:
http://dx.doi.org/10.7554/eLife.08428.013
Activation of AMPK down-regulates ANGPTL4 expression specifically in brown adipocytes.
(A) Angptl4 mRNA in differentiated T37i adipocytes treated for 6 hr with 1 mM AICAR, 100 μM A769662, 1 mM metformin or 250 μM phenformin hydrochloride. (B) Angptl4 mRNA in differentiated primary brown adipocytes, BA adipocytes, or T37i adipocytes treated for indicated times with 1 mM AICAR. (C) Immunoblot for ANGPTL4, LPL, AMPKα1,2 and phospho-AMPKThr172 in differentiated T37i cells treated with control (CTRL) or 1 mM AICAR for 3 hr. (D) Angptl4 mRNA in differentiated T37i adipocytes treated with CTRL siRNA or siRNA against AMPKα1 and AMPKα2 for 48 hr, followed by incubation with control (CTRL) or 1 mM AICAR for 3 hr. (E) Angptl4 mRNA in differentiated T37i adipocytes treated with CTRL siRNA or siRNA against AMPKα1 and AMPKα2 for 48 hr, followed by incubation with H2O control medium (CTRL) or 100 μM A769662 for 6 hr. (E) Ampkα1 and Ampkα2 mRNA in differentiated T37i adipocytes treated with CTRL siRNA or siRNA against AMPKα1 and AMPKα2 for 48 hr. (F) Angptl4 mRNA levels in BAT and WAT explants from C57BL/6J wild-type mice (∼50 μg) treated with H2O control medium (CTRL) or 1 mM AICAR for 3 hr. (G) Immunoblot for ANGPTL4 in BAT and WAT explants from C57BL/6J wild-type mice (∼50 mg) treated with H2O control medium (CTRL) or 1 mM AICAR for 3 hr. *Statistically significant compared to control samples or between indicated treatments, according to Student’s t-test (p<0.05). Error bars represent ± SEM.DOI:
http://dx.doi.org/10.7554/eLife.08428.013
AMPK may act through PPAR to regulate ANGPTL4 levels
We further pursued the mechanism behind the down-regulation of ANGPTL4 by AMPK. Treatment of brown adipocytes with AICAR and the transcriptional inhibitor actinomycin D showed that both compounds reduced Angptl4 gene expression by nearly the same extent. Co-treatment of brown adipocytes with actinomycin D and AICAR did not result in an additive effect, suggesting that AMPK activation almost completely inhibited Angptl4 gene transcription (Figure 9A).
Figure 9.
Down-regulation of Angptl4 expression by AMPK is likely mediated via inhibition of PPARγ-mediated transcription of Angptl4.
(A) Angptl4 mRNA in differentiated T37i adipocytes pre-incubated with 0.5 μg/mL actinomycin D (ActD) or DMSO control for 1 hr and treated with 1 mM AICAR or control for 3 hr. (B) Angptl4 mRNA in differentiated T37i or BA adipocytes treated with DMSO control, 5 μM rosiglitazone, 10 μM Wy14643, or 5 μM GW742 (BA adipocytes) or 5 μM GW501516 (T37i adipocytes) for 6 hr. (C) Immunoblot for ANGPTL4 in differentiated T37i adipocytes treated with 5 μM rosiglitazone (Rosi), 10 μM Wy14643 (Wy), and 5 μM GW501516 for 24 hr. (D) Angptl4 mRNA in differentiated T37i cells treated with DMSO control, 5 μM rosiglitazone (Rosi), 1 mM AICAR or both rosiglitazone and AICAR for 6 hr. (E) Relative luciferase activity of HepG2 cells transfected with pGL3-Angptl4, pSG5-Pparγ, pSG5-Rxr, pcDNA-P300HA vectors, as indicated and treated 16 hr post-transfection with 5 μM rosiglitazone, 1 mM AICAR or both compounds for 9 hr. Data are represented as ± SD. (F) Immunoblot of P300 and phospho-P300 (Ser-89) in differentiated T37i brown adipocytes treated with control or 1 mM AICAR for 3 hr. *Statistically significant compared to control samples or between indicated samples according to Student’s t-test (p<0.05). Error bars represent ± SEM, unless otherwise specified.
DOI:
http://dx.doi.org/10.7554/eLife.08428.014
Down-regulation of Angptl4 expression by AMPK is likely mediated via inhibition of PPARγ-mediated transcription of Angptl4.
(A) Angptl4 mRNA in differentiated T37i adipocytes pre-incubated with 0.5 μg/mL actinomycin D (ActD) or DMSO control for 1 hr and treated with 1 mM AICAR or control for 3 hr. (B) Angptl4 mRNA in differentiated T37i or BA adipocytes treated with DMSO control, 5 μM rosiglitazone, 10 μM Wy14643, or 5 μM GW742 (BA adipocytes) or 5 μM GW501516 (T37i adipocytes) for 6 hr. (C) Immunoblot for ANGPTL4 in differentiated T37i adipocytes treated with 5 μM rosiglitazone (Rosi), 10 μM Wy14643 (Wy), and 5 μM GW501516 for 24 hr. (D) Angptl4 mRNA in differentiated T37i cells treated with DMSO control, 5 μM rosiglitazone (Rosi), 1 mM AICAR or both rosiglitazone and AICAR for 6 hr. (E) Relative luciferase activity of HepG2 cells transfected with pGL3-Angptl4, pSG5-Pparγ, pSG5-Rxr, pcDNA-P300HA vectors, as indicated and treated 16 hr post-transfection with 5 μM rosiglitazone, 1 mM AICAR or both compounds for 9 hr. Data are represented as ± SD. (F) Immunoblot of P300 and phospho-P300 (Ser-89) in differentiated T37i brown adipocytes treated with control or 1 mM AICAR for 3 hr. *Statistically significant compared to control samples or between indicated samples according to Student’s t-test (p<0.05). Error bars represent ± SEM, unless otherwise specified.DOI:
http://dx.doi.org/10.7554/eLife.08428.014Expression of ANGPTL4 is under sensitive control of peroxisome proliferator-activated receptors (PPARs) in many tissues, with PPARγ being the dominant regulator of ANGPTL4 in adipose tissue (Kersten et al., 2000; Mandard et al., 2004; Yoon et al., 2000). We found that PPARγ agonists and to a lesser extent agonists for PPARα and PPARδ highly induce ANGPTL4 mRNA and protein in BA and T37i brown adipocytes (Figure 9B,C).Previous studies have shown that AMPK may inhibit PPARα and PPARγ transcriptional activity (Leff, 2003; Sozio et al., 2011). Indeed, we observed that AMPK activation almost completely blocked the induction of Angptl4 mRNA following treatment with the PPARγ agonist rosiglitazone (Figure 9D). Accordingly, we hypothesized that activation of AMPK following prolonged cold exposure may inhibit PPARγ-mediated transcription of the Angptl4 gene. To examine this possibility, a luciferase construct was prepared containing the three conserved PPAR response elements (PPREs) of intron 3 of the murineAngptl4 gene. These three PPREs have previously been shown to be responsible for PPAR-mediated up-regulation of Angptl4 (Kaddatz et al., 2010; Mandard et al., 2004). In HepG2 cells transfected with the Angptl4PPRE construct , rosiglitazone treatment significantly induced luciferase activity, which was further increased upon co-transfection with Pparγ/Retinoid X receptor (Rxr). By contrast, co-treatment with AICAR blunted the increase in luciferase activity (Figure 9E). Interestingly, whereas co-transfection of the PPARγ co-activator P300 (Gelman et al., 1999) further stimulated luciferase activity in the absence of AICAR, it failed to do so in the presence of AICAR, suggesting that regulation of P300 may be part of the mechanism of inhibition of ANGPTL4 by AMPK (Figure 9E). In support of this possibility, treatment of brown adipocytes with AICAR resulted in phosphorylation of P300 at serine residue 89, which is known to reduce the capacity of P300 to co-activate nuclear transcription factors, whereas no change in total P300 protein levels was observed (Figure 9F). Collectively, these data suggest that the negative regulation of ANGPTL4 in BAT upon cold exposure may be mediated by the inhibition of PPARγ transcriptional activity by AMPK.
Discussion
The energy requirements of BAT increase manifold during cold exposure. The increased energy demands coincide with a marked increase in LPL activity, stimulating uptake of TRL-derived fatty acids (Bartelt et al., 2011; Bertin et al., 1985; Khedoe et al., 2014; Klingenspor et al., 1989, 1996). Increased LPL activity has been shown to be essential for the lipid-lowering effect of cold exposure, as injection of heparin or tetrahydrolipstatin compromises LPL-dependent uptake of TRLs and TRL-derived fatty acids (Bartelt et al., 2011). Since Lpl mRNA in BAT is only moderately increased upon prolonged cold exposure, it has been suggested that the pronounced increase in LPL activity in BAT occurs at the post-translational level (Giralt et al., 1990; Klingenspor et al., 1996). Our data demonstrate that a substantial part of the increase in LPL activity in BAT during prolonged cold exposure is mediated by down-regulation of ANGPTL4.Overall, our findingsreveal a major role for ANGPTL4 in the regulation of lipid partitioning during sustained cold. Specifically, the data implicate ANGPTL4 as an important mediator of preferential shuttling of TRL-derived fatty acids to BAT during cold exposure. Via direct effects on local LPL activity and subsequent fatty acid uptake, the reciprocal regulation of ANGPTL4 in BAT and WAT assures an adequate fuel delivery to BAT during cold exposure. The differential regulation of ANGPTL4 and LPL between BAT and WAT leads to corresponding changes in fatty acid uptake from TRLs, with our data showing a clear dose-dependent and causal relationship between ANGPTL4 expression and TRL-derived fatty acid uptake into both tissues. The importance of ANGPTL4 in the regulation of LPL activity during cold complements the already established role of ANGPTL4 in regulation of LPL during fasting and exercise in WAT and skeletal muscle, respectively (Catoire et al., 2014; Kroupa et al., 2012). ANGPTL4 can thus be viewed as the master regulator of tissue LPL activity and fatty acid uptake during physiological conditions such as fasting, exercise and cold exposure.Our data suggest that the opposite regulation of ANGPTL4 expression during prolonged cold between BAT and WAT may be explained by the differential expression and activation of AMPK between the two tissues. Heterotrimeric AMPK has one catalytic (α), and two regulatory (β and γ) subunits, each having distinctive isoforms with a tissue-specific distribution (Viollet et al., 2009, 2010). Tissue-specific combinations of different subunit isoforms may confer tissue-specific properties to AMPK by determining subcellular localization and substrate targeting, thereby controlling cellular and systemic responses to metabolic stressors, including sustained cold (Viollet et al., 2009, 2010). Indeed, with prolonged cold exposure, AMPK becomes progressively activated in BAT and only to a minor extent in WAT (Bauwens et al., 2011; Mulligan et al., 2007).Systemic activation of AMPK has been previously shown to increase the activity of LPL in both heart and muscle and to lower plasma TG levels (An et al., 2005; Bergeron et al., 2001; Buhl et al., 2002; Catoire et al., 2014; Geerling et al., 2014; Ohira et al., 2009). Furthermore, AMPK activation was found to cause a pronounced reduction in ANGPTL4 expression in muscle cells (Catoire et al., 2014). Similar to muscle and heart, we found the AMPKα2 catalytic subunit to be abundantly present in BAT, but not WAT (Viollet et al., 2009). Together, the increased AMPK activation and different AMPK subunit expression in BAT as compared to WAT may explain why the repressive effect of cold-induced AMPK activation on ANGPTL4 expression is much more pronounced in BAT than in WAT. We suggest that regulation of ANGPTL4 in WAT during cold may be dominated by activation of β-adrenergic signalling, which may explain the increase in ANGPTL4 expression observed in WAT during sustained cold exposure.We provide evidence that regulation of ANGPTL4 by AMPK occurs at the transcriptional level, affecting PPARγ-mediated transcription of the Angptl4 gene. ANGPTL4 has been repeatedly shown to be a highly sensitive target of all PPAR transcription factors in a variety of tissues and cells and following a variety of physiological stimuli (Dijk and Kersten, 2014; Georgiadi et al., 2010; Kersten et al., 2000; Mandard et al., 2004). Previously, PPARγ-mediated transcription has been shown to be inhibited by activation of AMPK (Cheang et al., 2014; Namgaladze et al., 2013; Sozio et al., 2011). A potential link between PPARγ and AMPK may be the modulation of co-activator recruitment to PPARγ by AMPK. A well-established co-activator of PPARγ that has been shown to be regulated by AMPK is P300 (Gelman et al., 1999; Leff, 2003; Yang et al., 2001). P300 is a key regulator of the assembly and mobilization of the transcriptional machinery by connecting transcription factors to the transcriptional machinery and enhancing DNA accessibility (Vo and Goodman, 2001). AMPK activation enhances P300 degradation and causes phosphorylation of P300 at serine residue 89, thereby blocking the interaction of P300 with PPARγ and reducing PPARγ transcriptional activity (Leff, 2003; Lim et al., 2012; Yang et al., 2001). Although our in vitro data suggest an involvement of P300 and PPARγ in the suppression of ANGPTL4 by AMPK activation, whether P300 is also involved in in vivo regulation of ANGPTL4 during cold exposure remains to be determined.Despite the unmistakable dependency of BAT LPL activity on ANGPTL4 expression, a modest cold-induced increase in LPL activity and TRL-derived fatty acid uptake is observed in BAT of Angptl4 -/- mice, which may be (partially) explained by the moderate increase in Lpl mRNA in BAT in the cold. Alternatively, there may be a role for another, yet to be identified, cold-induced post-translational modulator of LPL. It may be hypothesized that this post-translational modulator is also involved in the rapid increase in LPL activity during acute cold exposure (Klingenspor et al., 1996).No overt abnormalities in cold-tolerance were observed in the Angptl4-/- or Angptl4-Tgmice as compared to wild-type mice. This observation, however, does not refute the importance of ANGPTL4 in fuel delivery to BAT during cold exposure. BAT is a well-conserved organ that is postulated to have conferred to mammals the evolutionary advantage to survive cold stressors such as birth or low environmental temperatures (Cannon and Nedergaard, 2004). It is likely that differential uptake of TG in other organs and altered uptake of other available fuels (free fatty acids, glucose) compensate for the reduced uptake of TRL-derived fatty acids by BAT in Angptl4-Tgmice. Strikingly, adipose tissue-specific deletion of LPL in mice does not result in an overt phenotype (Bartelt et al., 2012; Garcia-Arcos et al., 2013). While plasma TG levels are elevated in these mice, no other parameters were altered, indicating that even in mice completely lacking LPL in adipose tissue, alternative mechanisms exist to fuel BAT and WAT (Bartelt et al., 2012; Garcia-Arcos et al., 2013).In conclusion, our data show that regulation of ANGPTL4 is an important factor in directing lipid fuels towards BAT and away from WAT during prolonged cold exposure. Better understanding of the mechanisms underlying fuel re-distribution may pave the way for new strategies to combat metabolic diseases, such as cardiovascular disease and diabetes type 2, in which a mismatch in regulation of lipid uptake and usage by tissues is an important feature (Klop et al., 2013; Young and Zechner, 2013).
Materials and methods
Mice
Three- to four-month old Angptl4-/-, wild-type and Angptl4-Tgmice were either placed at a thermo-neutral temperature (∼28°C) (n = 7/8, as indicated in figures) or at a cold temperature (∼4°C) (n = 7–10, as indicated in figures) for a period of 10 days. All animals are backcrossed on a pure C57Bl/6J background for multiple generations (>10). Wild-type and Angptl4-Tgmice are littermates. Angptl4-/- mice have been obtained via homologous recombination of embryonic stem cells and lack part of the Angptl4 gene, resulting in a non-functional ANGPTL4 protein (Köster et al., 2005; Lichtenstein et al., 2010). Angptl4-Tgmice over-express the Angptl4 gene in various tissues under its own promoter (Mandard et al., 2006). Food intake, body weight and body temperature were monitored daily. Body temperature of cold-exposed mice was monitored via read-out of transponders (IPTT-300) that were injected subcutaneously prior to the experiment (Bio Medic Data Systems, Seaford, USA). The Animal Ethics Committees of Wageningen University and University Medical Center Hamburg-Eppendorf approved all experiments.
TRL labelling
Radiolabelled VLDL-like emulsion particles were essentially prepared as described previously (Rensen et al., 1995). Briefly, 100 mg of lipids (triolein, egg yolk phosphatidylcholine, lysophosphatidylcholine, cholesteryl-oleate and cholesterol) were mixed with glycerol tri[3H]oleate and [14C]cholesteryl-oleate (GE Healthcare, Little Chalfont, UK) and sonicated (Soniprep 150, MSE Scientific Instruments, UK). The emulsion was fractionated by consecutive density gradient ultracentrifugation (Beckman, California, USA) to yield VLDL-like particles with a diameter of ∼80 nm.Radiolabelled chylomicron-like particles with a diameter of ∼250 nm were prepared from lipids derived from humanTRLs of apoCII-deficient subjects (approved by Ärtzekammer Hamburg, Germany) as described previously (Bruns et al., 2009). Briefly, 10 mg of isolated lipid was mixed with glycerol tri[14C]oleate and [3H]cholesteryl-oleyloleate (Perkin Elmer, Rodgau, Germany) in chloroform, after which solvent was removed and TRL particles were formed by sonication in 1 mL of PBS for 10 min at 60°C. Aggregates were removed by filtration through a 450 nm filter (Millipore). TRL particles used for intravital microscopy were prepared similarly, but radiolabels were replaced by hydrophobic fluorescent nanocrystals (QD-TRLS).
TG clearance experiments
To study the clearance of radiolabelled TRL-like particles (80 and 250 nm), Angptl4-/-, wild-type and Angptl4-Tgmice were exposed to cold or thermo-neutral temperature for 10 days (see Figure 4—figure supplement 1 for an overview). Prior to the experiment, animals were fasted for 4 hr. To asses TG clearance, mice were injected intravenously with 200 μL radiolabelled TRL-like particles (0.2 mg TG for VLDL-like particles, 2 mg TG for chylomicron-like particles). Lipid turnover was determined for VLDL-like particles from plasma taken at 2,5,10, and 15 min following injection. Total plasma volumes were calculated as 0.04706 x body weight (g) (Jong et al., 2001). 15 min after injection, mice were sacrificed and perfused via the heart with ice-cold PBS containing 50 IU/mL heparin. Multiple organs were collected, weighed and solubilized in Tissue Solubilizer (Amersham Biosciences, Roosendaal, the Netherlands; for VLDL-like particles) or Solvable (Perkin Elmer; for chylomicron-like particles) overnight. 3H and 14Cradioactivity was determined via liquid scintillation counting. Uptake of radioactivity derived from TRL-like particles was calculated as % uptake of the injected radiolabel per gram tissue.
Intravital microscopy
For intravital microscopy, interscapular BAT was exposed in anesthetized Angptl4-/-, wild-type and Angptl4-Tgmice and visualized by a confocal microscope with resonant scanner (Nikon A1R). QD-TRLs were injected via a tail vein catheter in anesthetized mice, followed by recording of 30 confocal images per second of the interscapular BAT were recorded for a period of 15 min. The acquired data were edited in Nikon NIS Elements. After recording, mice were perfused with PBS containing 50 IU/mL heparin. Then, BAT, gWAT and iWAT were taken for subsequent cryosectioning, to assess the uptake of QD-TRLs via confocal microscopy.
Plasma measurements
Plasma concentrations of glucose (Sopachem, Ochten, the Netherlands), triglycerides (TG), cholesterol (Instruchemie, Delfzijl, the Netherlands), glycerol (Sigma-Aldrich, Houten, the Netherlands) and free fatty acids (Wako Chemicals, Neuss, Germany; HR(2) Kit) were determined following the manufacturers’ instructions.
LPL activity measurements
LPL activity in whole tissue homogenates from BAT, WAT and inguinal adipose tissue was measured as described previously (Ruge et al., 2004). Briefly, extracts of frozen tissue samples were prepared in 9 ml lysis buffer/g tissue (0.025 M NH3, 5 mM Na2EDTA, and per ml: 1 mg bovineserum albumin, 10 mg Triton X-100, 1 mg SDS, 5 IU heparin, and Complete protease inhibitors [Roche]) by homogenization with a Polytron homogenizer. Homogenates were spun down for 15 min at 3000 × g to obtain the supernatant used to measure LPL activity. 2 μl of supernatant was assayed, in a total volume of 200 μL, with a 3H-oleic acid-labelled triolein containing substrate emulsion having 100 mg soybeantriglycerides and 10 mg egg yolk phospholipids per mL. Incubation was at 25°C for 30–100 min, dependent on the expected level of LPL activity. One milliunit (mU) of enzyme activity corresponds to 1 nmol of fatty acid released per min.
RNA isolation and qPCR
Total RNA was isolated using TRIzol reagent (Life Technologies Europe BV, Bleiswijk, the Netherlands). RNA from WAT depots was purified using the Qiagen RNeasy Micro kit (Qiagen, Venlo, the Netherlands). RNA was reverse transcribed using a First-Strand cDNA Synthesis Kit (Thermo Scientific, Landsmeer, the Netherlands) (for cells) or iScript cDNA Synthesis Kit (Bio-Rad, Veenendaal, the Netherlands) (for tissues). Real-time PCR was carried out using SensiMiX (Bioline, GC Biotech, Alphen aan de Rijn, the Netherlands) on a CFX 384 Bio-Rad thermal cycler (Bio-Rad). TBP and 36B4 were used as housekeeping genes. Primer sequences can be found in Table 1.
Table 1.
Primer sequences.
DOI:
http://dx.doi.org/10.7554/eLife.08428.015
Gene
Forward primer
Reverse primer
m36b4
ATGGGTACAAGCGCGTCCTG
GCCTTGACCTTTTCAGTAAG
mAngptl4
GTTTGCAGACTCAGCTCAAGG
CCAAGAGGTCTATCTGGCTCTG
mLpl
GGGAGTTTGGCTCCAGAGTTT
GGGAGTTTGGCTCCAGAGTTT
mUcp1
CCTGCCTCTCTCGGAAACAA
TGTAGGCTGCCCAATGAACA
mPgc1α
AGTCCCATACACAACCGCAGTCGCAACATG
CCCTTTCTTGGTGGAGTGGCTGCCTTGG
mCidea
TGACATTCATGGGATTGCAGAC
GGCCAGTTGTGATGACTAAGAC
mElovl3
TTCTCACGCGGGTTAAAAATGG
GAGCAACAGATAGACGACCAC
mPrdm16
CCACCAGCGAGGACTTCAC
GGAGGACTCTCGTAGCTCGAA
Primer sequences.DOI:
http://dx.doi.org/10.7554/eLife.08428.015
Tissue H&E staining
Fresh tissues (WAT and BAT) were fixed in 4% paraformaldehyde, dehydrated and embedded in paraffin. H&E staining was performed using standard protocols.
Tissue immunofluorescence
Frozen human BAT sections obtained during surgery (5 µm thick) were fixated during 15 min in 3.7% formaldehyde in PBS, followed by incubation for 45 min at room temperature with a primary antibody (polyclonal rabbithANGPTL4 or a polyclonal rabbitUCP1-antibody [kind gift of Dr. B. Cannon, Stockholm University]) (Vijgen et al., 2013; Wu et al., 2012) diluted in 0.05% Tween20 in PBS. After three washing steps with PBS, sections were incubated for 45 min at room temperature with the appropriate fluorescently labelled secondary antibodies. The specificity of the antibody for ANGPTL4 was demonstrated previously via immunoblot of human plasma using appropriate peptide controls and was validated by staining of ANGPTL4 in human heart, intestine and muscle (Alex et al., 2014; Catoire et al., 2014; Georgiadi et al., 2010).
Human cold exposure experiment and hANGPTL4 ELISA
Plasma ANGPTL4 levels were measured in plasma samples from a published study in which lean and obesehuman subjects were exposed to mild cold (16°C) for 48 hr (Wijers et al., 2010). Plasma hANGPTL4 levels were measured as described previously (Kersten et al., 2009). Briefly, 96-well plates were coated with anti-humanANGPTL4 polyclonal goat IgG antibody (AF3485; R&D Systems) and were incubated overnight at 4°C. After blocking, 100 μL of 20-fold diluted human plasma was applied to each well, followed by incubation at room temperature for 2 hr. Next, 100 μL of diluted biotinylated anti-humanANGPTL4 polyclonal goat IgG antibody (BAF3485; R&D Systems) was added and incubated for 2 hr. Subsequently, streptavidin-conjugated HRP was added for 20 min, followed by tetramethylbenzidine substrate reagent for 6 min. The reaction was stopped by adding 50 μL of 10% H2SO4. The absorbance was measured at 450 nm.
Western blot
Tissues were lysed in a mild RIPA-like lysis buffer (25 mM Tris-HCl pH 7.4, 150 mM NaCl, 1 mM EDTA, 1% NP-40 and 5% glycerol; Thermo Scientific) with protease and phosphatase inhibitors (Roche). Cells were lysed directly in 2x Laemmli sample buffer (LSB) with DTT. Protein lysates (20–30 μg protein per lane) were loaded on a denaturing gel (Bio-Rad) and separated by SDS gel electrophoresis. Proteins were transferred to a PVDF membrane by means of a Transblot Turbo System (Bio-Rad). The primary antibody [rabbit anti–phospho-AMPK antibody (Thr172), rabbit anti-AMPKα1,α2 antibody (Cell Signaling Technology, #2535 and #2532), rabbit anti-mouse/humanAMPKα1 (Cell Signaling Technology, #2795), rabbit anti-mouse/humanAMPKβ1 and AMPKβ2 (Cell Signaling Technology, #4148 and #4178), rabbit anti-mouseAMPKα2 antibody (Abcam, #ab3760), rat anti-mouseANGPTL4 antibody (Adipogen, #Kairos 142–2), goat anti-mouseLPL antibody (kind gift from André Bensadoun), rabbit anti-mouseHSP90 antibody (Cell Signaling Technology, #4874S), or mouse anti-mouse β-tubulin antibody (Santa-Cruz Biotechnology, #sc23949)] was used at a ratio of 1:1000 (AMPKα1,α2, AMPKα2, AMPKα1, AMPKβ1, AMPKβ2, ANGPTL4, HSP90, β-tubulin), 1:2000 (phospho–AMPK) or 1:5000 (LPL). Corresponding secondary antibodies (HRP-conjugated) (Sigma-Aldrich) were used at 1:5000 dilutions. All incubations were performed in Tris-buffered saline, pH 7.5, with 0.1% Tween-20 (TBS-T) and 5% dry milk, except for anti-AMPKα1,2 and anti-phospho-AMPKThr172 antibody, where 5% bovineserum albumin (BSA) was used instead of milk. All washing steps were in TBS-T without dry milk or BSA. Blots were visualized using the ChemiDoc MP system (Bio-Rad) and Clarity ECL substrate (Bio-Rad).
Cell culture
3T3-F442a cells (P8-P14, Sigma) were maintained in DMEM (Lonza), supplemented with 10% newborn calfserum and 1% penicillin/streptomycin (P/S) under 5% CO2 at 37°C. At confluency, cells were switched to DMEM (Lonza, Verviers, Belgium), supplemented with 10% fetal bovineserum (FBS), 1% P/S and 5 μg/mL insulin (Sigma-Aldrich) to stimulate differentiation. During differentiation, medium was changed every 2-3 days. After 10 days of differentiation, cells were switched back to regular medium for 2-3 days, after which experiments were performed.T37i cells (P31-36; kind gift of Marc Lombès) were cultured in DMEM/F-12 (Gibco, Life Technologies, Blijswijk, the Netherlands), supplemented with 10% FBS and 1% P/S. Two days post-confluency, cell culture medium was supplemented with 112 ng/mL insulin and 2 nM T3 (Sigma-Aldrich) to induce differentiation. After 7 days of differentiation, cells were switched back to regular medium and used for experiments 2-3 days after (Zennaro et al., 1998).HepG2 cells (passage unknown) were maintained in DMEM (Lonza) supplemented with 10% FBS and 1% P/S. At each passage, the cell pellet was filtered through a 40 μm filter to reduce cell clumping.Culture of BA adipocytes was performed as described previously (Uldry et al., 2006). Briefly, immortalized brown adipocytes are grown to confluence with differentiation medium (DMEM, 10% FBS, 20 nM insulin, 1 nM T3). Upon confluence, cells were treated with induction medium (differentiation medium supplemented with 0.5 mM IBMX, 0.5 μM dexamethasone, 0.125 mM indomethacin) for two days. After washing, cells were incubated in differentiation medium for another 5 to 7 days.
Isolation of primary adipocytes
WAT was dissected from C57Bl/6J mice and put in DMEM supplemented with 1% P/S and 1% BSA. Tissues of 3–4 mice were pooled, minced with scissors and digested for 1 hr at 37°C in collagenase-containing medium (DMEM with 3.2 mM CaCl2, 1.5 mg/mL Collagenase type II (Sigma-Aldrich), 10% FBS, 0.5% BovineSerum Albumin (Sigma-Aldrich) and 15 mM HEPES, filtered). After digestion, cell mixture was passed over a 100 μm cell strainer and centrifuged at 1600 rpm for 10 min. Supernatant was removed and the pellet containing the stromal vascular fraction was re-suspended in erythrocyte lysis buffer (155 mM NH4Cl, 12 mM NaHCO3, 0.1 mM EDTA) and incubated for 2–3 min at room temperature. Following neutralization, cells were centrifuged at 1200 rpm for 5 min. Cells were re-suspended in DMEM containing 10% FBS and 1% P/S and plated. Upon confluence, cells were differentiated following standard protocol of 3T3-L1 cells, as described previously (Alex et al., 2013).For isolation of primary brown adipocytes, BAT from 1-month-old pups was used. Tissues of 5–10 pups were pooled, minced with scissors and digested for 30 min in collagenase-containing medium at 37°C (DMEM w/o serum, 2 mg/mL Collagenase type II, 2% BSA, 25 mM HEPES). After digestion, cells were passed through a 70 or 100 μM filter, mature adipocytes were discarded and cells were centrifuged at 800*g for 5 min. Cells were re-suspended in differentiation medium (DMEM, 10% FBS, 20 nM insulin, 1 nM T3) and plated. Upon confluence, cells were treated with induction medium (differentiation medium supplemented with 0.5 mM IBMX, 0.5 μM dexamethasone, 0.125 mM indomethacin) for two days. After washing, cells were incubated in differentiation medium for another 5 to 7 days.
siRNA experiments
T37i cells were cultured and differentiated as described above. At day 10 of differentiation, mature adipocytes were trypsinized and replated at 70% density. 2 hr post-plating, siRNAs against AMPKα1 and AMPKα2, or non-target control (Dharmacon, via Thermo Fisher) complexed to Lipofectamine RNAimax reagent (Life Technologies) were added, according to the manufacturer’s protocol. 48 hr post-transfection, cells were washed and treated as indicated before harvesting for RNA analyses.
BAT and WAT explants
BAT and WAT tissues were dissected from male C57Bl/6J mice and transferred to DMEM supplemented with 1% P/S and 1% BSA. Tissues of 4 mice were pooled and minced finely with scissors. Approximately 50 mg of tissue was transferred to a well of a 24-wells tissue culture plate and equilibrated for 1 hr in DMEM, supplemented with 1% P/S. After 1 hr, explants were treated as indicated before being harvested for RNA and protein analyses.
Chemicals
Isoproterenol, AICAR, metformin, rosiglitazone, Wy14,643, GW510516, GW742, dexamethasone, insulin, 3-isobutyl-1-1methylxanthine (IBMX), actinomycin D were purchased from Sigma-Aldrich. A769662 was purchased from Abcam (Cambridge, United Kingdom), phenformin hydrochloride was purchased from Cayman Chemicals (via SanBio, Uden, the Netherlands).
mAngptl4 PPRE construct
A fragment of 1517 bp containing intron 3 of the mouseAngptl4 gene was amplified from DNA of the mouseAngptl4 gene using the primers: Fwd 5’-TTGCTGTCATCTGGCAACTC-3’ and Rev 3’-CACCTAAAGCCTACCCCACA-5’. The resulting fragment was gel-purified using QIAquick Gel Extraction Kit (Qiagen) and subjected to a second PCR to specifically amplify the three functional PPREs of Angptl4 and to introduce Xho1 and Kpn1 restriction sites. Amplification of the 565 bp fragment was done with the following primers: mouse Fwd 5'-atggtaccTTCACACCCTAAGGCTGC-3', and mouseRev 3'-atctcgagGGGGGAAGAGGAAGAAAA-5'. Following purification from gel, the fragment was subjected to restriction with Xho1 and Kpn1 enzymes and cloned into the Xho1 and Kpn1 sites of the pGL3 promoter vector (Promega, Leiden, the Netherlands). Presence of the correct insert was validated by sequencing (EZ-Seq, Macrogen, Amsterdam, the Netherlands) using a RV3 primer: ‘5-CTAGCAAAATAGGCTGTCCC-3’.
Transactivation assays
mAngptl4PPRE pGL3 reporter vector was transfected into the human hepatocellular cell line HepG2 (ATCC, Manassas, USA) in the presence or absence of pSG5 vectors expressing Pparγ and Rxr and pcDNA vector expressing HA-P300 (kind gift of Eric Kalkhoven, University Medical Centre Utrecht, the Netherlands). A vector expressing renilla luciferase under a SV40 promoter was co-transfected with all samples to determine transfection efficiency. Transfections were performed using polyethylenimine (PEI) (Polysciences Inc. via Qiagen). 16 hr post-transfection cells were incubated with rosiglitazone (5 μM) and/or AICAR (1 mM) for 9 hr. Firefly and renilla luciferase activity were determined using the Dual Glo Luciferase Assay system (Promega), according to manufacturer’s instructions, on a Fluoroskan Ascent apparatus (Thermo Scientific).
Statistics
Data are expressed as mean ± SEM, unless otherwise indicated. Differences were evaluated for statistical significance by student t-test or two-way ANOVA, followed by a post-hoc Tukey HSD test, and considered statistically significant when p<0.05.eLife posts the editorial decision letter and author response on a selection of the published articles (subject to the approval of the authors). An edited version of the letter sent to the authors after peer review is shown, indicating the substantive concerns or comments; minor concerns are not usually shown. Reviewers have the opportunity to discuss the decision before the letter is sent (see review process). Similarly, the author response typically shows only responses to the major concerns raised by the reviewers.[Editors’ note: this article was originally rejected after discussions between the reviewers, but the authors were invited to resubmit after an appeal against the decision.]Thank you for choosing to send your work entitled "ANGPTL4 mediates shuttling of lipid fuel to brown adipose tissue during sustained cold exposure" for consideration at eLife. Your full submission has been evaluated by Mark McCarthy (Senior Editor) and two peer reviewers, one of whom is a member of our Board of Reviewing Editors, and the decision was reached after discussions between the reviewers. Based on our discussions and the individual reviews below, we regret to inform you that your work will not be considered further for publication in eLife.The reason for the negative decision is that very substantial additional experiments would be necessary to solidify the direct involvement of AMPK in the mechanism of ANGPTL4 regulation. As it stands, this connection is weak and not substantiated with sufficient evidence. The literature on AMPKreveals the difficulty in relying on AICAR to document direct involvement on AMPK in biological pathways. There are other problematical issues such as the apparent inconsistencies in Figure 5 that contradict the title of that section of the paper. Although the manuscript presents an interesting story, the mechanistic information remains limited at this stage of the study. As you know, eLife's policy is not to make offers of resubmission that would be contingent on the generation of extensive additional data: rather it makes a judgement on the paper "as is", allowing relatively rapid resubmission elsewhere if the paper is not taken forward.Reviewer #1:Djik et al. present compelling evidence that ANGPTL4 mediates trafficking of lipids to brown adipose during cold exposure. The experiments outlined, and the models chosen to analyze convincingly demonstrate that alterations in the local levels of ANGPTL4 modulate LPL activity differentially between white and brown adipose depots. This work is performed well, is concise, and marks an interesting and unique finding explaining a previously undescribed physiological phenomenon. A few points that deserve further attention:1) The presumed physiological rationale for increased lipid delivery to BAT during cold exposure is for increased thermogenesis. However, the Angptl4transgenic mice have no alteration in core body temperature following cold exposure (Figure 2D). How do the authors rationalize this observation? And further, does decreased LPL activity in BAT and WAT during cold exposure in the Angptl4-TG alter weight balance upon cold exposure?2) While Figure 5 B nicely demonstrates that Angptl4 expression may limit increases in LPL activity in WAT following cold exposure, Figure 5I directly contradicts the title to this section (Angptl4 expression and LPL activity are oppositely regulated in WAT and BAT upon sustained cold exposure) as 5I and J clearly indicate increased LPL activity in IWAT following cold exposure. This is in stark contrast to Figure 5E and the message of the paper which indicates increased ANGPTL4 causes decreased lipid uptake. Finally, nowhere in this figure are the protein levels of ANGPTL4 demonstrated to be altered in WAT following cold exposure.While this does not alter the entire findings of the paper, and the following statement remains true – "Angptl4 expression caused a clear dose-dependent reduction in uptake of TRL-derived fatty acids" –, the authors must reconcile these findings, potentially by performing these experiments after a shorter cold exposure time before significant browning has taken place in the Inguinal WAT depot.3) The authors argue that "the opposite regulation of ANGPTL4 expression in BAT and WAT may be mediated by differential activation of AMPK"). However Figure 8F shows that cold exposure increases P-AMPK in both iWAT and BAT despite that these tissues display differential regulation of ANGPL4. Although the other experiments here support their claim as AiCAR treatment decreases ANGTPL4 expression, the purported mechanism of differential regulation via AMPK seems unlikely and further work is needed to elaborate this claim.4) ANGTPL4 protein is processed and can be released into circulation as both a paracrine and an endocrine factor. This has been shown to have important clinical implications (Arteriosclerosis, Thrombosis, and Vascular Biology. 2009; 29: 969-974). How are the levels of this protein altered during cold exposure, and do these alterations follow the authors' reported findings?5) Expand on LPL activity assay. This is a commonly misunderstood assay and it is imperative the reader be provided an accurate method of analysis.Reviewer #2:The issue addressed by this paper – how is fuel provided to BAT during cold exposure – is a critical question in adipose biology and of high interest in the field. The authors provide strong additional evidence that modulating LPL activity is a principal route by which lipid substrate is directed into BAT in the cold, consistent with previous work by this group and other laboratories. The concept that Angptl4 downregulation by cold exposure, specifically in BAT, is a key process in this pathway appears solid and does provide new information to the field.A major issue with the study at its present stage is the relatively weak data on mechanism, particularly with regards to the potential role of AMPK in this system. Definitive data showing AMPK mediates the effect of cold on Angptl4 transcription would bring this study up to the level of high significance. The use of AICAR is equivocal, as other effects of AICAR have been shown to be mediated by pathways independent of AMPK and it is not a fully definitive reagent to use to solidify a conclusion about AMPK. While the data with AICAR are instructive and suggestive, the authors need to provide genetic or other evidence that AMPK is directly mediating the effect of cold exposure on ANGPTL4 expression. Providing this one additional key piece of data would greatly enhance the impact of the paper.[Editors’ note: what now follows is the decision letter after the authors submitted for further consideration.]Thank you for resubmitting your work entitled "ANGPTL4 mediates shuttling of lipid fuel to brown adipose tissue during sustained cold exposure" for further consideration at eLife. Your revised article has been favorably evaluated by Mark McCarthy (Senior Editor) and a Reviewing Editor. The manuscript has been accepted in principle, but there are some remaining issues that need to be addressed before publication, as outlined below:Please include the data on iWAT (which was taken out of the original manuscript) and data on the human tissue (which you included in the rebuttal but not the manuscript) in the supplemental section, with reference to those data in the paper.[Editors’ note: the author responses to the first round of peer review follow.]Given the overall very positive response of the reviewers to our manuscript, we were surprised by the decision to reject it. The main stumbling block appeared to be the insufficient evidence for a direct involvement of AMPK in the mechanism of ANGPTL4 and LPL regulation during cold in white and brown adipose tissue. This issue was raised by both reviewers but no specific suggestions for experiments were raised, as both reviewers must have recognized the near impossibility of addressing that question via in vivo experiments, short of investing at least 2-3 years of intense work. Consequently, we further elaborated on the connection between AMPK and ANGPTL4 via in vitro experiments. We feel that in the revised manuscript, containing more extensive in vitro data confirming the involvement of AMPK in ANGPTL4 regulation, the issues raised by the reviewers have been largely resolved. The following major additions and changes were made to the paper:1) We added data on WAT and BAT weights as well as bodyweight gain during cold exposure;2) We have added immunoblots of various AMPK subunits in white and brown adipose tissue. The marked difference in abundance of various AMPK subunits between brown and white adipose tissue provides further insight into differences in AMPK activation and expression between the two tissues;3) We show that a down-regulation of Angptl4 mRNA expression in brown adipocytes is not exclusive to AICAR, but is also elicited by activation of AMPK by metformin, A-769662 and phenformin hydrochloride;4) We confirm the role of AMPK in the negative regulation of Angptl4 by treatment of brown adipocytes with siRNA against AMPKα1 and AMPKα2. The down-regulation of Angptl4 upon treatment with A-769662 and AICAR was greatly attenuated in siAMPK-treated adipocytes;5) We have added data showing that AMPK activation of BAT explants but not WAT explants causes down-regulation of Angptl4, highlighting the different responses of the two tissues upon AMPK activation;6) We mostly removed the data on inguinal white adipose tissue from the manuscript. Judging from the reviewers’ comments, the addition of inguinal white adipose tissue, a tissue with properties in between gonadal white adipose tissue and brown adipose tissue, was confusing rather than complementary and supportive for our mechanism;7) We leave open the possibility of adding new data showing an increase in plasma ANGPTL4 in obese individuals subjected to two days of mild cold (see response to last comment of reviewer 1);8) Finally, as requested, we have further expanded the protocol of the LPL activity measurements. Reviewer #1:Djik et al. present compelling evidence that ANGPTL4 mediates trafficking of lipids to brown adipose during cold exposure. The experiments outlined, and the models chosen to analyze convincingly demonstrate that alterations in the local levels of ANGPTL4 modulate LPL activity differentially between white and brown adipose depots. This work is performed well, is concise, and marks an interesting and unique finding explaining a previously undescribed physiological phenomenon. A few points that deserve further attention:1) The presumed physiological rationale for increased lipid delivery to BAT during cold exposure is for increased thermogenesis. However, the Angptl4transgenic mice have no alteration in core body temperature following cold exposure ( Angptl4-Tg alter weight balance upon cold exposure?Given the importance of cold-induced thermogenesis in mice, there is substantial redundancy in fuel supply to BAT. It is likely that Angptl4-Tgmice compensate for the lower lipid uptake by increased uptake of another fuel, e.g. glucose. It should be emphasized that very few mutant mice show a reproducible defect in cold-tolerance, including PPARa knock-out mice and adipose tissue-specific LPL knock-out mice. Compensatory mechanisms may also explain why after cold exposure we do not observe a difference in weight in Angptl4-Tgmice as compared to Angptl4-/- and Angptl4mice.Consistent with what would be expected, under thermoneutral conditions weight of WAT and BAT were highest in the Angptl4-Ko mice and lowest in the Angptl4-Tgmice. In all genotypes it was observed that weight of WAT was lower in cold-exposed mice as compared to mice kept at thermoneutral temperatures. In contrast, in all genotypes weight of BAT was higher in cold-exposed mice as compared to mice kept at thermoneutral temperatures. For reasons that are unclear, the relative difference in weight of WAT between cold-exposed and thermoneutral mice was lowest in the Angptl4-Tg group. The data have been added to Figure 2. Finally, in agreement with the lack of difference in food intake between the three genotypes, bodyweight gain during the 10 day cold exposure did not differ between the three genotypes. The data have been added to Figure 2.2) While Angptl4 expression may limit increases in LPL activity in WAT following cold exposure, Angptl4 expression and LPL activity are oppositely regulated in WAT and BAT upon sustained cold exposure) as 5I and J clearly indicate increased LPL activity in IWAT following cold exposure. This is in stark contrast to .While this does not alter the entire findings of the paper, and the following statement remains true – "Angptl4 expression caused a clear dose-dependent reduction in uptake of TRL-derived fatty acids" –, the authors must reconcile these findings, potentially by performing these experiments after a shorter cold exposure time before significant browning has taken place in the Inguinal WAT depot.We would like to emphasize that inguinal WAT is an atypical fat depot that displays substantial browning, in contrast to regular (gonadal) WAT. As a result, the response of iWAT to cold contains features of both BAT and regular WAT, consistent with the mixed cell population within iWAT following cold. We had felt that inclusion of iWAT in the paper would strengthen our mechanism, showing a continuum between different tissues with different amounts of ‘brown-like’ cells. However, we recognize that it may also create confusion by not presenting a uniform phenotype of WAT, as suggested by the section title and the Abstract. Based on this consideration, we decided to remove the data on iWAT to present a more black and white story comparing BAT with regular (gonadal) WAT. Protein levels of ANGPTL4 in BAT and WAT upon cold exposure can be found in Figure 5C, showing a clear decrease in ANGPTL4 protein in BAT and a clear decrease in ANGPTL4 protein in WAT by cold.3) The authors argue that "the opposite regulation of ANGPTL4 expression in BAT and WAT may be mediated by differential activation of AMPK". However .We agree that further elaboration on the mechanism would strengthen the manuscript. Consequently, in the revised manuscript several additions were made to specifically elaborate on the opposite regulation of ANGPTL4 in BAT and regular (gonadal) WAT is regulated via AMPK: 1) We have added immunoblots of various AMPK subunits in white and brown adipose tissue. The marked difference in abundance of various AMPK subunits between brown and white adipose tissue provides further insight into differences in AMPK activation and expression between the two tissues; 2) We show that a down-regulation of Angptl4 mRNA expression in brown adipocytes is not exclusive to AICAR, but is also elicited by activation of AMPK by metformin, A-769662 and phenformin hydrochloride; 3) We confirm the role of AMPK in the negative regulation of Angptl4 by treatment of brown adipocytes with siRNA against AMPKα1 and AMPKα2. The down-regulation of Angptl4 upon treatment with A-769662 and AICAR was greatly attenuated in siAMPK-treated adipocytes; 4) We have added data showing that AMPK activation of BAT explants but not WAT explants causes down-regulation of Angptl4, highlighting the different responses of the two tissues upon AMPK activation.With respect to the comment on p-AMPK in iWAT and BAT, we would like to emphasize that while P-AMPK is indeed slightly higher in iWAT upon cold exposure, this is not the case for gWAT (was Figure 8—figure supplement 1, now Figure 7F), which shows no change in p-AMPK. Accordingly, we believe that the increase of p-AMPK in iWAT is due to browning. As discussed above, iWAT exhibits a phenotype intermediate between gWAT and BAT. As suggested in our response to the second comment, we decided to remove iWAT from the paper to prevent any misunderstandings.4) ANGTPL4protein is processed and can be released into circulation as both a paracrine and an endocrine factor. This has been shown to have important clinical implications (Arteriosclerosis, Thrombosis, and Vascular Biology. 2009; 29: 969-974). How are the levels of this protein altered during cold exposure, and do these alterations follow the authors' reported findings?We thank the reviewer for this insightful comment. We have tested all commercial ELISAs for mouseANGPTL4 but unfortunately none allows detection of ANGPTL4 protein in mouse plasma. With respect to humans, we have measured plasma ANGPTL4 in human subjects exposed to 16ºC for 48 hours (Wijers et al., Obesity (Silver Spring) 2010). Interestingly, we found that mild cold caused a statistically significant increase in plasma ANGPTL4 in obese subjects but not in lean subjects. One possibility for the increase in plasma ANGPTL4 in obese but not in lean individuals is that obese individuals have more WAT and that the change in ANGPTL4 production in WAT dominates the amount of ANGPTL4 in plasma.However, since ANGPTL4 is expressed in many tissues and the origin of circulating ANGPTL4 is unclear, we are a bit uncomfortable using these data in our manuscript. For this reason, we did not add a figure to the manuscript, but we are willing to add it to our paper if the reviewers and editors would consider it worthwhile.5) Expand on LPL activity assay. This is a commonly misunderstood assay and it is imperative the reader be provided an accurate method of analysis.We have further expanded the description of the LPL activity assay.Reviewer #2:The issue addressed by this paper – how is fuel provided to BAT during cold exposure – is a critical question in adipose biology and of high interest in the field. The authors provide strong additional evidence that modulating LPL activity is a principal route by which lipid substrate is directed into BAT in the cold, consistent with previous work by this group and other laboratories. The concept that Angptl4 downregulation by cold exposure, specifically in BAT, is a key process in this pathway appears solid and does provide new information to the field. A major issue with the study at its present stage is the relatively weak data on mechanism, particularly with regards to the potential role of AMPK in this system. Definitive data showing AMPK mediates the effect of cold on Angptl4 transcription would bring this study up to the level of high significance. The use of AICAR is equivocal, as other effects of AICAR have been shown to be mediated by pathways independent of AMPK and it is not a fully definitive reagent to use to solidify a conclusion about AMPK. While the data with AICAR are instructive and suggestive, the authors need to provide genetic or other evidence that AMPK is directly mediating the effect of cold exposure on ANGPTL4 expression. Providing this one additional key piece of data would greatly enhance the impact of the paper.Although we recognize the appeal of demonstrating a direct in vivo role of AMPK in mediating the effect of cold exposure on ANGPTL4 expression, it must be realized that numerous confounding factors prevent us from addressing that question via in vivo experiments (although we are open to specific suggestions). One confounding factor is that the effects of AMPK on fuel use during cold are likely also mediated by factors other than ANGPTL4. Another confounding factor is that modulating AMPK in vivo is expected to alter plasma levels of FFA, which are very potent activators of ANGPTL4 production. The only way to study the direct impact of AMPK on ANGPTL4 is via additional in vitro experiments, as described in the revised manuscript. Specifically, the following new experiments were performed and added to the manuscript.1) We have added immunoblots of various AMPK subunits in white and brown adipose tissue. The marked difference in abundance of various AMPK subunits between brown and white adipose tissue provides further insight into differences in AMPK activation and expression between the two tissues. 2) We show that a down-regulation of Angptl4 mRNA expression in brown adipocytes is not exclusive to AICAR, but is also elicited by activation of AMPK by metformin, A-769662 and phenformin hydrochloride. 3) We confirm the role of AMPK in the negative regulation of Angptl4 by treatment of brown adipocytes with siRNA against AMPKα1 and AMPKα2. The down-regulation of Angptl4 upon treatment with A-769662 and AICAR was greatly attenuated in siAMPK-treated adipocytes. 4) We have added data showing that AMPK activation of BAT explants but not WAT explants causes down-regulation of Angptl4, highlighting the different responses of the two tissues upon AMPK activation.[Editors’ note: the author responses to the re-review follow.]Thank you for resubmitting your work entitled "ANGPTL4 mediates shuttling of lipid fuel to brown adipose tissue during sustained cold exposure" for further consideration at eLife. Your revised article has been favorably evaluated by Mark McCarthy (Senior Editor) and a Reviewing Editor. The manuscript has been accepted in principle, but there are some remaining issues that need to be addressed before publication, as outlined below: Please include the data on iWAT (which was taken out of the original manuscript) and data on the human tissue (which you included in the rebuttal but not the manuscript) in the supplemental section, with reference to those data in the paper.We have added data on plasma ANGPTL4 levels in lean and obese individuals exposed to a mild cold (16˚C) for 48h (Figure 5–figure supplement 1). Dr. Wouter van Marken Lichtenbelt, who provided us with these samples, has been included as a co-author on the manuscript. Descriptions of the human study, as well as of the method to measure plasma ANGPTL4 levels in human plasma have been added to the Materials and methods section.We have re-included the data on LPL activity, Angptl4 mRNA and Lpl mRNA (Figure 5–figure supplement 2) in inguinal white adipose tissue. Data on TRL clearance by inguinal adipose tissue are presented in Figure 6. Reference to these data is made in the text when describing Figure 5.We have added three additional headers to clarify the different sections of the manuscript.
Authors: Jake D Bauwens; Eric G Schmuck; Christopher R Lindholm; Rebecca L Ertel; Jacob D Mulligan; Ian Hovis; Benoit Viollet; Kurt W Saupe Journal: Am J Physiol Regul Integr Comp Physiol Date: 2011-05-18 Impact factor: 3.619
Authors: Margaret S Sozio; Changyue Lu; Yan Zeng; Suthat Liangpunsakul; David W Crabb Journal: Am J Physiol Gastrointest Liver Physiol Date: 2011-06-23 Impact factor: 4.052
Authors: Alexander Bartelt; Oliver T Bruns; Rudolph Reimer; Heinz Hohenberg; Harald Ittrich; Kersten Peldschus; Michael G Kaul; Ulrich I Tromsdorf; Horst Weller; Christian Waurisch; Alexander Eychmüller; Philip L S M Gordts; Franz Rinninger; Karoline Bruegelmann; Barbara Freund; Peter Nielsen; Martin Merkel; Joerg Heeren Journal: Nat Med Date: 2011-01-23 Impact factor: 53.440
Authors: Jun Wu; Pontus Boström; Lauren M Sparks; Li Ye; Jang Hyun Choi; An-Hoa Giang; Melin Khandekar; Kirsi A Virtanen; Pirjo Nuutila; Gert Schaart; Kexin Huang; Hua Tu; Wouter D van Marken Lichtenbelt; Joris Hoeks; Sven Enerbäck; Patrick Schrauwen; Bruce M Spiegelman Journal: Cell Date: 2012-07-12 Impact factor: 41.582
Authors: Antwi-Boasiako Oteng; Philip M M Ruppert; Lily Boutens; Wieneke Dijk; Xanthe A M H van Dierendonck; Gunilla Olivecrona; Rinke Stienstra; Sander Kersten Journal: J Lipid Res Date: 2019-08-13 Impact factor: 5.922
Authors: Danny Ben-Zvi; Ornella Barrandon; Stephanie Hadley; Barak Blum; Quinn P Peterson; Douglas A Melton Journal: Proc Natl Acad Sci U S A Date: 2015-11-30 Impact factor: 11.205