Literature DB >> 26460867

Pseudomonas aeruginosa RRALC3 Enhances the Biomass, Nutrient and Carbon Contents of Pongamia pinnata Seedlings in Degraded Forest Soil.

Parthasarathy Radhapriya1, Andimuthu Ramachandran1, Rangasamy Anandham2, Sundararajan Mahalingam3.   

Abstract

The study was aimed at assespan class="Chemical">sin>ng the efpan class="Chemical">fects of indigenous pan class="Chemical">Plant Growth Promoting Bacterium (PGPB) on the legume Pongamia pinnata in the degraded soil of the Nanmangalam Reserve Forest (NRF) under nursery conditions. In total, 160 diazotrophs were isolated from three different nitrogen-free semi-solid media (LGI, Nfb, and JMV). Amongst these isolates, Pseudomonas aeruginosa RRALC3 exhibited the maximum ammonia production and hence was selected for further studies. RRALC3 was found to possess multiple plant growth promoting traits such as nitrogen accumulation (120.6ppm); it yielded a positive amplicon with nifH specific primers, tested positive for Indole Acetic Acid (IAA; 18.3μg/ml) and siderophore production, tested negative for HCN production and was observed to promote solubilization of phosphate, silicate and zinc in the plate assay. The 16S rDNA sequence of RRALC3 exhibited 99% sequence similarity to Pseudomonas aeruginosa JCM5962. Absence of virulence genes and non-hemolytic activity indicated that RRALC3 is unlikely to be a human pathogen. When the effects of RRALC3 on promotion of plant growth was tested in Pongamia pinnata, it was observed that in Pongamia seedlings treated with a combination of RRALC3 and chemical fertilizer, the dry matter increased by 30.75%. Nitrogen, phosphorus and potassium uptake increased by 34.1%, 27.08%, and 31.84%, respectively, when compared to control. Significant enhancement of total sugar, amino acids and organic acids content, by 23.4%, 29.39%, and 26.53% respectively, was seen in the root exudates of P. pinnata. The carbon content appreciated by 4-fold, when fertilized seedlings were treated with RRALC3. From the logistic equation, the rapid C accumulation time of Pongamia was computed as 43 days longer than the control when a combination of native PGPB and inorganic fertilizer was applied. The rapid accumulation time of N, P and K in Pongamia when treated with the same combination as above was 15, 40 and 33 days longer, respectively, as compared to the control.

Entities:  

Mesh:

Substances:

Year:  2015        PMID: 26460867      PMCID: PMC4604145          DOI: 10.1371/journal.pone.0139881

Source DB:  PubMed          Journal:  PLoS One        ISSN: 1932-6203            Impact factor:   3.240


Introduction

Soil degradation is a serious worldwide pan class="Species">environmental problem that leads to poor soil health [1]. Soil degradation involves an alteration process that negatively impn>acts the characteristics of a forest, in particular, by reducing the value of its goods and services, and may vary in frequency, quality, extent, origin, and severity. It can be caused by various disturbances: natural or anthropogenic or a combination thereof [2]. Enhancing carbon sequestration in degraded forests is an important task in tropical countries. Reversing forest degradation through restoration has been observed to increase carbon stocks. However, natural regeneration and replantation are difficult tasks in tropical degraded forests [3] as soils have already lost their nutrient content, this adversely affects plant growth as well as the regeneration of new saplings [4]. Although the use of chemical fertilizers and manures in forests and forest nursery production is insignificant when compared with the agricultural sector, adoption of this practice could lead to nutrient deficiency and severe environmental damage in degraded forests [5]. Moreover, the use of such additives to enhance the soil nutrient status and crop yield can lead to pollution of forest soil and put the complex system of biogeochemical cycles under pressure [6]. Environmental degradation occurs when the leachate of added nutrients, like nitrogen and phosphorus, mixes with the runoff [7, 8]. Therefore, there is an increasing interest in the development of eco-friendly plant growth promoting bacterium (PGPB), which is known to improve growth in agricultural crops, to help enhance plant growth in an ecologically sustainable manner in degraded forests [9, 10]. Several studies have confirmed the popan class="Chemical">sitive efpan class="Chemical">fect of PGPB on the yields of different agricultural crops in varying climatic conditions and soils [11-15]. PGPB stimulates plant growth by direct as well as indirect mechanisms such as nitrogen fixation, mineral solubilization, phytohormone production and antagonistic activities [16]. It is hypothesized that PGPB may facilitate improvement in the soil health and productivity of forests and forest nursery plants. However, PGPB have not yet been studied in afforestation processes like repopulation of native plants, restoration after forest fire, prevention of soil erosion, soil reclamation in mining regions and reforestation [17]. Bashan et al. [18] reported that the inoculation of Prosopis articulata, Parkinsonia microphylla, Parkinsonia florida with native PGPB enhanced the development of plant shoot and root, increased the number of branches and improved the survival rate in forest seedlings. PGPB inoculation along with fertilizer has been reported to increase dry matter accumulation and nutrient uptake in the Fraxinus americana forest seedlings [19]. The study area, Nanmangalam Reserve Forest (NRF), is located in the southern part of Chennai, Tamil Nadu, India. It covers an area of 321ha, with latitudinal extension from 12°55’5” N to 12°56’13” N and longitudinal extension from 80°9’46” E to 80°10’57” E. NRF is a degraded reserve forest and its soil is reported to be deficient in nutrients such as total nitrogen, organic carbon, available potassium, calcium, magnesium, iron, and zinc [20]. The trees exhibit stunted growth with a maximum height of 2 m and the crown cover is less than 30% with very low biomass. The tree population was found to be highly scattered and no regeneration of tree species was observed. The soil of this locality seemed to be completely eroded, devoid of significant topsoil and most of the forest was exposed to the weathering of rocks. To the best of our knowledge, the potential of native pan class="Chemical">PGPB to enhance the biomass of forest seedlings has not yet been studied in India. Therefore, in the present study, a novel attempt has been made to isolate an indigenous n>an class="Chemical">bacterium from a degraded forest and to understand its influence on the growth, biomass and nutrient content of Pongamia pinnata.

Materials and Methods

Isolation of PGPB from NRF

pan class="Chemical">Since NRF is a reserve forest, official permispan class="Chemical">sion to conduct experiments was acquired from the Principle Chief Conservator of Forest, Department of Forest, pan class="Chemical">Tamil Nadu, India. We confirm that the field studies carried out did not involve any endangered or protected species. For systematic soil sampling, the entire area was divided into 40 grids of 0.25 km2 each. In topan class="Chemical">tal, 40 samples were collected. To reduce the number of soil samples, four sampn>les each were pooled and homogenized by thorough mixing. Thus, a total of ten samples were used for the isolation of efficient PGPB. The samples were placed in sterile bags, immediately transported to the laboratory and processed. The soil samples were inoculated into 5ml each of three difpan class="Chemical">ferent pan class="Chemical">nitrogen-free semisolid media (Johanna Mannitol Vera-JMV; Loitsyanskya, Gv and Ivchenko-LGI and New Fábio Pedrosa-Nfb). In the LGI medium, sucrose was used as the carbon source and pH was adjusted to 6.0–6.2. In JMV and Nfb media, mannitol and malic acid were used as carbon sources and the pH was adjusted to 6.0–6.2 and 6.0–6.5, respectively. The vials were incubated at 30°C and the formation of a white subsurface pellicle was observed at the end of 5 days [21]. The vial with the highest dilution that was still showing pellicle formation was transferred to new sterile semisolid medium for further confirmation. Five days after pellicle formation, the cells were transferred to nitrogen-free solid medium Petri dishes for isolation of single colonies. The isolated colonies were preserved in 50% glycerol at −80°C for further study. Difpan class="Chemical">ferent plant growth promoting characteristics were examined in the isolated bacteria. Ammonia production was estimated by the colorimetric method proposed by Cappuccino and Sherman [22]. Amongst the tested isolates, RRALC3 exhibited maximum ammonia production and was therefore selected for further study. The pan class="Chemical">nitrogen content was analyzed by the micro-Kjeldahl method [23]. The presence of nifH gene was detected by PCR using the 16F (5′-GCIWTYTAYGGIAARGGIGG-3′) and 407R (5′-AAICCRCCRCAIACIACRTC-3′) gene specific primers [24]. Indole acetic acid (IAA) production was determined as per the methodology proposed by Gorden and Webber [25]. Qualitative determination of hydrocyanic acid (HCN) production was performed as per the method recommended by Kremer and Souissi [26]. Phosphate solubilization was demonstrated on Pikovskaya’s agar plates as described by Gaur [27]. Zinc and silicate solubilization were examined in Bunt and Rovira medium [28] supplemented with 0.1% zinc oxide and KAl Si3O8, respectively. A qualitative assay for siderophore production was conducted on CAS agar plates [29].

Molecular characterization

pan class="Chemical">Bacterial isolate RRALC3 was grown in LGI medium. DNA was extracted according to Sambrook et al. [30]. The pan class="Chemical">bacterial 16S rDNA gene was amplified by pan class="Chemical">PCR using the forward primer 27F (5′-AGAGTTTGATCCTGGCTCAG-3′) and reverse primer 1492R (5′-GGTTACCTTGTTACGACTT-3′). The 16S rDNA nucleotide sequence was determined by direct PCR sequencing using the fluorescent dye terminator method (ABI PrismTM BigdyeTM Terminator cycle sequencing ready reaction kit v.3.1). The products were purified with a Millipore-Montage dye removal kit and run in an ABI3730XL capillary DNA sequencer (50 cm capillary). The nearly complete 16S rDNA gene sequences obtained from the automatic sequencer was aligned and the EzTaxon-e server was used to determine bacterial identity as well as to ascertain closest relatives [31]. The bacterial isolate RRALC3 obtained in this study exhibited 99% 16S rDNA gene sequence similarity to Pseudomonas aeruginosa JCM5962. The sequence was submitted to the NCBI database (accession number KF481965).

Detection of pathogenicity

Hemolytic activity

To assay for the production of haemolypan class="Chemical">sin, exotoxins capable of destroying Red Blood Cells (RBC) and hemoglobin, three strains of pan class="Species">Pseudomonas: P. aeruginosa RRALC3, pan class="Species">P. aeruginosa PA14 (ATCC 15442) and P. aeruginosa PA01(ATCC 15692) were plated on sheep blood agar plates (catalogue no. MP1301, Himedia, India). The plates were incubated for 48–72 h and scrutinized for the appearance of clear, greenish-brown and no zone which is indicative of complete (β), partial (α) and no (ɤ) hemolytic activity, respectively.

Detection of pathogenic islands

In order to confirm the existence of pathogenic islands, RRALC3 was examined for the presence of virulence genes. pan class="Chemical">PCR ampn>lification of the ecfX (411 bps), pan class="Chemical">ybtQ (387 bps) and pan class="Chemical">lasB (731 bps) genes was performed in 25 μl reaction mixtures containing 2.5μl of dNTPs (10mM), 1.25 μl each of forward and reverse primers (5 pmol each), 2.5 μl 10x PCR buffer and 0.25 μl Taq DNA polymerase (3 μl; Genei, India). The following gene-specific primers were used: (a) ecfX F (TCCGTGGTTCCGTCTCGCATG) and ecfX R (CGACCTGGGACAGGCCGTCGAA) [32], (b) ybtQ F (CGAGGCCCTACTCAGGACGCCTCA) and ybtQ R (AGGGCCAAGGGACCGACTGCCA) [33], and (c) lasB F (CGAGCCAGGGGAGTGCAGTTC) and lasB R (GGCCGCCCGCCTCGGCGTGGGCC) [34]. P. aeruginosa PA14 and E. coli DH5 alpha strains were used as positive and negative controls, respectively. The PCR conditions employed were as follows: initial denaturation at 95°C for 7 min, 30 cycles of denaturation at 95°C for 1 min, annealing at 51°C, 54°C or 55°C for 1min (for ecfX, ybtQ and lasB, respectively), and extension at 72°C for 30 s, followed by a final extension at 72°C for 10 min.

Phylogenetic analysis

The 16S rRNA gene sequences of pan class="Species">P. aeruginosa RRALC3 was aligned with clinical and pan class="Species">environmental P. aeruginosa isolates retrieved from the NCBI database using CLUSTAL W (version 1.8). A phylogenetic dendrogram was constructed by the neighbor-joining method [35].

Effect of inoculation of P. aeruginosa on P. pinnata

Preparation of bacterial inoculum and fertilizer

In order to prepare pan class="Chemical">P. n>an class="Disease">aeruginosa inoculum the bacterium was grown in LGI medium at 37°C for 96 h. Cells were harvested by centrifugation at 5,000 ×, 4°C for 10 min. The cell pellet was washed twice and resuspended in 0.1 M phosphate buffer in order to obtain a cell density of 106 cfu/ml. A commercial biofertilizer (National Fertilizer Ltd., Noida, India) (10 kg) containing 105 CFU each of Azospirillum, Azotobacter and Rhizobium per gram of dry lignite powder was mixed with 50 kg of sand and spread over 1 acre of land. Inorganic fertilizer (1.5 g), comprising of N, P, and K at the ratio of 2:1:1, was added per cubic meter of soil.

Mother bed preparation

Five mother beds, of pan class="Chemical">size 12.5 × 1.2 m each, were prepn>ared by digging and hoeing. Five-hundred n>an class="Species">Pongamia seeds (Tambaram Nursery, pan class="Chemical">Tamil Nadu Forest Department, Chennai) were surface sterilized by treating with 0.1% HgCl2 for 2 min followed by rinsing six times with sterile distilled water. Surface sterilization was performed to eliminate surface microorganisms and seed borne pathogens. The seeds were sown in the mother bed and subjected to the following treatments: Inorganic pan class="Chemical">fertilizer (N:pan class="Chemical">P:K, 2:1:1) + pan class="Species">P. aeruginosa RRALC3 Inorganic pan class="Chemical">fertilizer (N:pan class="Chemical">P:K, 2:1:1) + commercial biopan class="Chemical">fertilizer Inorganic pan class="Chemical">fertilizer (N:pan class="Chemical">P:K, 2:1:1) pan class="Species">P. aeruginosa RRALC3 No biopan class="Chemical">fertilizer and no inorganic class="Chemical">n>an class="Chemical">fertilizer (control) Thirty days old seedlings were transpan class="Chemical">ferred from the mother bed to a pan class="Chemical">polyethylene bag (30×45 cm) containing 10 kg of soil prepared in the same fashion as described for the mother bed. The experiment was conducted in completely randomized block design (CRD) and each of the five treatments was replicated three times. A total of 450 healthy seedlings, 90 seedlings per treatment, were used for the nursery treatments. The physico-chemical properties of the soil used for experiments were as follows: Soil texture, clayey; bulk density, 1.02; pH, 6.8; soil organic carbon (SOC), 1.10%; nitrogen (N), 0.19%; available phosphorus, 1.66 mg kg−1; available potassium, 1.51 (cmol kg–1); calcium (Ca), 7.6 mg kg–1; magnesium (Mg), 3.92 mg kg–1; iron (Fe), 0.31 mg kg–1; manganese (Mn), 0.28mg kg–1; copper (Cu), 0.28mg kg–1 and zinc (Zn), 0.16mg kg–1.

Data collection for plant analysis

The experiment was conducted over a period of 180 days (October 2012 to March 2013). To set up the logistic equation, pan class="Disease">dry matter accumulation (n>an class="Chemical">DMA) and nutrient content of the above ground biomass of the plant samples were analyzed at 30 days intervals. Three replicate samples were harvested. The polythene bags were flooded with water to loosen soil from the plant roots and seedlings were uprooted without any injury. The roots, stems, and leaves of the seedlings were then separately harvested and washed thoroughly with distilled water to remove the soil and other debris. The plants were then placed in paper bags and kept at 70°C to attain a constant weight. The dried plant material was crushed and passed through a 250 μm mesh sieve prior to determining the carbon (C), nitrogen (N), phosphorus (P), potassium (K), magnesium (Mg), calcium (Ca), and sulphur (S) contents. C, N and S contents were quantified using a CHNS-O elemental analyzer (Vario EL cube, Germany) as described previously by Wang and Anderson [36]. The total P content was determined by the ascorbic acid method [37]. K, Ca and Mg contents were determined spectrophotometrically using a Perkin Elmer Lambda 25 UV/Vis spectrophotometer as described by Johnson and Ulrich [38]. To examine the components of the root exudates, replicated samples of the rhizosphere soil were collected [19]. Within 12 h of sampling, soil solution was removed using double-bottomed centrifuge cupn>s and immediately filtered through Corning dispn>osable syringe filters (0.22 μm filter). The soil solution was prepn>ared upan class="Chemical">sing soil and distilled water in the ratio of 1:3.3 to obtain a good equilibrium. The centrifugation was carried out at 8000 rpm at 4°C for 30 min. The resultant supernatant was considered as the root exudates. The total protein in exudates was analyzed by the Bradford method using bovine serum albumin as standard [39]. Carbohydrate concentration of root exudates was determined using the heptafluorobutyrate derivatives of O-ethyl-glycosides obtained after methanolysis in 0.5 M methanolHCl for 24 h at 80°C. The samples were analyzed by gas chromatography using a capillary column (25×0.32 mm) of 5% silicone OV 210 in a Varian 2100 gas chromatograph (France) equipped with a flame detector and a glass solid injector. The carrier gas was helium and the oven temperature was programmed to increase from 150°C to 250°C in 3 min. Lysine, which can be derivatized as a carbohydrate heptafluorobutyrate and maintain a different retention time in gas chromatography as compared to the sample gas, was used as an internal standard. For amino acid analysis, a 100 μg sample was hydrolyzed under vacuum with 2 ml of 6M HCl at 110°C in sealed tubes for 48 h. A drop of phenol was added to avoid degradation of tyrosine residues. The samples were analyzed in an automatic amino acid analyzer (Durrum 500, Dionex-Durram Chemical Corporation, London, UK) using norleucine as an internal standard [40].

Soil analysis

Soil samples were tested at the end of the experiment. A pH meter was used to measure pH of 2:1 water:soil suspn>ension. Soil organic C, N and S contents were determined using a CHNS-O elemental analyzer (Vario EL cube) as described previously [35]. Micro-nutrient content of the soil was analyzed by DTPA extraction methods as outlined by Lindsey and Norwell [41]. The available P and exchangeable cations were analyzed according to Olsen and Sommers [42].

Statistical analysis

The efpan class="Chemical">fect of the difpan class="Chemical">ferent treatments on dry matter accumulation (DMA) of P. pinnata was examined using the analysis of variance (ANOVA) and the least significant difference at 5%. These tests were used to compare the means of treatments using the SAS software (SAS version 9.2 windows for 32- licensed version). Nutrient accumulation in the above ground biomass of pan class="Species">P. pinnata was described upan class="Chemical">sing the logistic equation W = a/[1 + exp (b − ct)] [43], where W is the nutrient accumulation variable at days after emergence t, and a, b, c are values calculated using the SAS software. Plant growth, growth rates, and growth acceleration curves were obtained using the first, second and third derivatives of this logistic equation. V m, T m, T , and T were determined by calculation based on a, b and c nutrient accumulation of the logistic equation (V m and T m, maximum daily nutrient accumulation in mg per plant; T and T , onset and termination time of rapid nutrient accumulation in days). ANOVA test was carried out to evaluate the total plant nutrient accumulation after 6 months.

Results

PGPB characteristics

In topan class="Chemical">tal, 160 diazotrophs were obpan class="Chemical">tained from the three different pan class="Chemical">nitrogen-free semisolid media viz., 56 from LGI, 57 from JMV and 47 from Nfb (S1 Fig). All the isolates were tested for ammonia production. Isolate RRALC3 showed maximum amount of ammonia production (8%). Further, this isolate was tested for the presence of multiple plant growth promoting traits. RRALC3 accumulated nitrogen (120.6 ±1.52 ppm) and produced IAA (18.3 ±0.12 μg ml−1) in the liquid medium under test conditions. It was able to grow in nitrogen-free semisolid LGI medium and yielded a positive PCR amplicon of 390 bp with nif H specific primers (S2 Fig). The isolated bacterium RRALC3 was able to solubilize P, Si and Zn in the plate assay as evidenced by the formation of a clear halo zone around the bacterial colony. CAS plates exhibited an orange zone which is indicative of siderophore production. RRALC3 did not produce HCN under the tested conditions.

Detection of pathogenicity in Pseudomonas aeruginosa RRALC3

pan class="Species">Pseudomonas aeruginosa RRALC3, pan class="Species">PA14 and PA01 were grown in blood agar medium. Isolates RRALC3 and PA01 did not exhibit any hemolytic activity whereas isolate PA14 was positive for α-hemolysis (S3 Fig). Virulence genes responsible for pathogenesis were examined in P. aeruginosa. RRALC3 was examined for the presence of pathogenesis related virulence genes using a PCR assay with degenerative primers. The results clearly indicated that virulence genes ecfX, ybtQ and lasB were absent in RRALC3 (S4 Fig). A neighbor joining phylogenetic tree was constructed with 16S rDNA sequences of clinical and environmental P. aeruginosa isolates. The environmental and clinical isolates were clustered separately which was supported by high bootstrap values (Fig 1).
Fig 1

Phylogenetic tree based on 16S rRNA gene sequences.

Bar, 0.1 nucleotide changes per positions. Pseudomonas aeruginosa RRALC3 obtained in this study are shown in bold. Bootstrap value ≥ 50 based on 1000 resamplings are shown at the branch points.

Phylogenetic tree based on 16S rRNA gene sequences.

pan class="Chemical">Bar, 0.1 nucleotide changes per positions. Pseudomonas aeruginosa RRALC3 obtained in this study are shown in bold. Bootstrap value ≥ 50 based on 1000 resamplings are shown at the branch points.

Dry matter accumulation in different treatments

On day 30, the pan class="Disease">Dry Matter Accumulation in the aerial parts of n>an class="Species">P. pinnata showed a significant difference between T1 (inorganic fertilizer with P. aeruginosa RRALC3) and T5 (control) treatments (Fig 2). On day 60, no significant difference was observed between T2 (inorganic fertilizer with commercial biofertilizer) and T3 (inorganic fertilizer alone) treatments; however, a highly significant difference was observed between T1 and T4 (P. aeruginosa alone) treatments. On day 180, a maximum of 25.8% DMA was observed in T1. At the same time, a small difference was observed between T2 (21.7%) and T3 treated (20.5%) seedlings. However, during the entire experimental period, T5 showed no significant impact on DMA as compared to the other treatments (Fig 2).
Fig 2

Effects of different treatments on the dry matter accumulation of Pongamia pinnata seedlings.

1 DMA, dry matter accumulation. Values represent the mean ± SD of three replicates. 2 Values mentioned on the bar-chart are significantly different (P < 0.05) among treatments. 3 T1, inorganic fertilizer (N:P:K, 2:1:1) + P. aeruginosa RRALC3; T2, inorganic fertilizer (N:P:K, 2:1:1) + commercial biofertilizer; T3, inorganic fertilizer (N:P:K, 2:1:1); T4, P. aeruginosa RRALC3; T5, control (no biofertilizer or inorganic fertilizer).

Effects of different treatments on the dry matter accumulation of Pongamia pinnata seedlings.

1 pan class="Chemical">DMA, pan class="Disease">dry matter accumulation. Values represent the mean ± SD of three replicates. 2 Values mentioned on the bar-chart are significantly different (P < 0.05) among treatments. 3 T1, inorganic fertilizer (N:P:K, 2:1:1) + P. aeruginosa RRALC3; T2, inorganic fertilizer (N:P:K, 2:1:1) + commercial biofertilizer; T3, inorganic fertilizer (N:P:K, 2:1:1); T4, P. aeruginosa RRALC3; T5, control (no biofertilizer or inorganic fertilizer).

Nutrient content and plant biomass

Macro nutrients like N, pan class="Chemical">P and K and micro nutrients like pan class="Chemical">Mg, S and Ca were increased by 12.4%, 12.1%, and 8.9%, and 2.4%, 2%, and 3%, respectively in T1 treatment (Table 1). The difference in N, P and K between T1 and T2 treated plants was 13%, 2%, and 6% respectively. The maximum growth in the above ground biomass was observed predominantly in shoots of the treated plants across all treatments. The above and below ground biomass increase in different treatments was in the following order: chemically fertilized seedlings with P. aeruginosa (T1) > commercial fertilizer with inorganic fertilizer (T2) > inorganic fertilizer (T3) > PGPB alone (T4) > control (T5) (33.7% > 28.3% > 17.3% > 12.19% > 8.5%, respectively). The C content varied significantly under different treatments and the variance was in the following order: T1 > T2 > T4 > T3 > T5 (37.43% > 21.7% > 18.13% > 15.7% > 7.8%, respectively) (Table 1).
Table 1

Total uptake of different nutrients and carbon content in Pongamia pinnata seedlings after180 days of growth.

Nutrient ContentShootRoot 1
Stem 1 Leaves 1
N(%)
T1 1.961±0.2a 1.062±0.08a 1.321±0.07a
T2 0.934±0.01b 0.626±0.01b 0.562±0.02b
T3 0.456±0.01c 0.419±0.01c 0.323±0.01c
T4 0.417±0.01d 0.394±0.02d 0.305±0.01d
T5 0.403±0.01d 0.397±0.01d 0.304±0.01d
P (%)
T1 2.122±0.3a 2.121±0.02a 2.462±0.27a
T2 1.436±0.15b 1.050±0.23b 1.120±0.08b
T3 0.841±0.02c 1.111±0.12b 0.975±0.02c
T4 0.731±0.01d 0.569±0.11c 0.726±0.03d
T5 0.723±0.01d 0.418±0.02c 0.412±0.04e
K(%)
T1 1.311±0.5a 1.369±0.6a 1.296±0.2a
T2 0.961±0.3b 1.010±0.02b 0.951±0.03b
T3 0.911±0.2c 0.841±0.01c 0.847±0.01c
T4 0.414±0.01d 0.412±0.02d 0.362±0.02d
T5 0.395±0.01d 0.410±0.02d 0.248±0.01e
Mg(%)
T1 0.101±0.001a 0.093±0.001a 0.089±0.001a
T2 0.098±0.001b 0.079±0.001b 0.081±0.002a
T3 0.029±0.001d 0.029±0.001d 0.024±0.001c
T4 0.056±0.002c 0.065±0.001c 0.049±0.002b
T5 0.024±0.002d 0.021±0.001d 0.021±0.001c
S(%)
T1 0.095±0.001a 0.022±0.001e 0.076±0.001a
T2 0.077±0.001b 0.055±0.001b 0.054±0.002b
T3 0.038±0.001d 0.031±0.001d 0.042±0.003c
T4 0.060±0.001c 0.042±0.001c 0.051±0.001d
T5 0.027±0.001e 0.072±0.001a 0.024±0.001e
Ca(%)
T1 0.310±0.001a 0.226±0.001a 0.205±0.001a
T2 0.269±0.001b 0.201±0.002b 0.201±0.002b
T3 0.170±0.001d 0.151±0.001d 0.111±0.001d
T4 0.257±0.001c 0.196±0.001c 0.176±0.001c
T5 0.167±0.001d 0.110±0.002e 0.099±0.001de
C (%)
T1 33.911±1.4a 19.911±0.84a 21.120±1.01a
T2 19.063±1.08b 8.310±0.59b 16.162±0.78b
T3 14.345±0.87d 6.028±0.38c,d 11.229±0.57d
T4 16.975±0.78c 7.544±0.41c 12.438±0.6c
T5 7.492±0.7e 2.949±0.2e 5.455±0.41e

1 Values followed by different uppercase letters in a column are significantly different (P < 0.05) among treatments.

T1, Inorganic fertilizer (N: P: K– 2:1:1) + P. aeruginosa RRALC3; T2, Inorganic fertilizer (N: P: K– 2:1:1) + commercial biofertilizer; T3, Inorganic fertilizer (N: P: K– 2:1:1); T4, P. aeruginosa RRALC3; T5, control (no biofertilizer and inorganic fertilizer)

1 Values followed by difpan class="Chemical">ferent uppern>an class="Chemical">case letters in a column are significantly different (P < 0.05) among treatments. T1, Inorganic pan class="Chemical">fertilizer (N: pan class="Chemical">P: K– 2:1:1) + P. aeruginosa RRALC3; T2, Inorganic fertilizer (N: P: K– 2:1:1) + commercial biofertilizer; T3, Inorganic fertilizer (N: P: K– 2:1:1); T4, P. aeruginosa RRALC3; T5, control (no biofertilizer and inorganic fertilizer)

Analysis of root exudates components of P. pinnata

Analypan class="Chemical">sis of the root exudates revealed that the T1 treatment pan class="Chemical">significantly enhanced the total sugar, amino acids and organic acids components, 23.4%, 29.39%, and 26.53%, respectively when compared with the un-inoculated control (T5) (Table 2).
Table 2

Root exudates componanents at 180 days after the emergence of Pongamia pinnata seedlings.

TreatmentTotal sugar (mg kg−1 of root exudates) 1 Amino acids (mg kg−1 of root exudates) 1 Organic acids (mg kg−1 of root exudates) 1
T1 291.45±31.37a 14.67±3.5a 0.082±0.021a
T2 271.92±45.98b 11.21±2.53b 0.071±0.012b
T3 231.32±56.79d 9.15±1.91d 0.065±0.031d
T4 254.67±51.74c 9.99±2.1c 0.059±0.018c
T5 191.45±27.12d 4.89±3.2e 0.032±0.019e

1 Values followed by different uppercase letters in a column are significantly different (P < 0.05) with in treatments.

T1, inorganic fertilizer (N:P:K, 2:1:1) + P. aeruginosa RRALC3; T2, inorganic fertilizer (N:P:K, 2:1:1) + commercial biofertilizer; T3, inorganic fertilizer (N:P:K, 2:1:1); T4, P. aeruginosa RRALC3; T5, control (no biofertilizer or inorganic fertilizer)

1 Values followed by difpan class="Chemical">ferent uppern>an class="Chemical">case letters in a column are significantly different (P < 0.05) with in treatments. T1, inorganic pan class="Chemical">fertilizer (N:pan class="Chemical">P:K, 2:1:1) + pan class="Species">P. aeruginosa RRALC3; T2, inorganic fertilizer (N:P:K, 2:1:1) + commercial biofertilizer; T3, inorganic fertilizer (N:P:K, 2:1:1); T4, P. aeruginosa RRALC3; T5, control (no biofertilizer or inorganic fertilizer)

Soil macro- and micro-nutrients

The addition of pan class="Chemical">PGPB and inorganic pan class="Chemical">fertilizers significantly altered the soil macro and micronutrients (Table 3). At the beginning of the treatment, the soil organic C content was 1.10%, but after the treatment it increased to 1.6% in the T1 treatment and 1.41% in the T2 treatment. An increase in available P content was observed in T1, T2 and T3 treated soil as well (4.91, 3.65 and 4.01 mg kg−1). Soil K, Ca, Mg, Fe, Mn and Zn contents were also significantly increased in T1.
Table 3

Effects of the treatments on macro- and micronutrients in the experimental soil.

ParameterAfter Treatment (180 days)
T1 1 , 2 T2 1 , 2 T3 1 , 2 T4 1 , 2 T5 1 , 2
Ph 5.4±1.3e 5.8±1.3d 6.3±1.7b 5.8±1.5d 6.51±0.5b
Soil Organic Carbon (%) 1.6±0.2a 1.41±0.3b 1.23±0.21d 1.38±0.7c 1.19±0.5e
Total N (%) 0.18±0.01a 0.16±0.08b 0.13±0.02c 0.14±0.04c 0.14±0.09c
Available P (mg kg -1 ) 4.91±1.7a 4.01±1.1b 3.31±0.8c 3.65±1.4c 1.59±0.85d
K (cmol kg -1 ) 1.37±0.94d 1.31±0.75d 1.26±0.89c 1.29±0.97c 1.42±0.57b
Ca (cmol kg -1 ) 7.89±2.1b 7.72±2.1b 8.26±2.23a 8.11±2.1a 7.12±1.9d
Mg (cmol kg -1 ) 3.52±1.24d 3.56±1.4c 3.71±1.11b 3.62±1.3c 3.59±1.12c
Fe (mg kg -1 ) 0.36±0.12a 0.29±0.1b 0.26±0.14b 0.30±0.03a 0.17±0.09c
Mn (mg kg -1 ) 0.31±0.11a 0.27±0.11b 0.17±0.03c 0.29±0.08a 0.24±0.07b
Cu (mg kg -1 ) 0.16±0.2a 0.17±0.01a 0.15±0.08b 0.16±0.07a 0.11±0.1c
Zn (mg kg -1 ) 0.19±0.11a 0.16±0.02b 0.14±0.014c 0.16±0.04b 0.14±0.04c

1 Mean separation within each row was performed using Duncan’s multiple range test.

2 Values followed by different uppercase letters in a row are significantly different (P < 0.05) among treatments.

T1, inorganic fertilizer (N:P:K, 2:1:1) + P. aeruginosa RRALC3; T2, inorganic fertilizer (N:P:K, 2:1:1) + commercial biofertilizer; T3, inorganic fertilizer (N:P:K, 2:1:1); T4, P. aeruginosa RRALC3; T5, control (no biofertilizer or inorganic fertilizer).

1 Mean separation within each row was performed upan class="Chemical">sing Duncan’s multipn>le range test. 2 Values followed by difpan class="Chemical">ferent uppern>an class="Chemical">case letters in a row are significantly different (P < 0.05) among treatments. T1, inorganic pan class="Chemical">fertilizer (N:pan class="Chemical">P:K, 2:1:1) + pan class="Species">P. aeruginosa RRALC3; T2, inorganic fertilizer (N:P:K, 2:1:1) + commercial biofertilizer; T3, inorganic fertilizer (N:P:K, 2:1:1); T4, P. aeruginosa RRALC3; T5, control (no biofertilizer or inorganic fertilizer).

Nutrient accumulation predicted through logistic equation

Nutrient accumulation in the aerial parts of P. pinnata seedlings was calculated using the logistic equation. The correlation coefficient (R) between the predicted and observed values was very high and confirmed the statistical integrity of the logistic equation. The results of the logistic equation explaining the nutrient accumulation parameters (V m, T m, T , and T ) in the above ground parts of P. pinnata are shown in Table 4. T and T are the logistic growth variation points of the two functions reflecting the onset and termination times of nutrient rapid accumulation, respectively. C accumulation in the aboveground biomass showed a rapid change between days 51 and 134 in the T1 treated plants whereas T2 treated plants showed a rapid change between days 62 and 124. From the logistic equation it was deciphered that the rapid C accumulation period of Pongamia was 20 days longer because of the application of inorganic fertilizer in combination with P. aeruginosa (T1) when compared with inorganic fertilizer combined with commercial biofertilizer (T2). The maximum daily C accumulation in seedlings of T1 and T2 treatment was observed on day 98 (4.0 mg plant−1 day−1) and 77 (3.0 mg plant−1 day−1), respectively. These results indicated a 14% increase in C accumulation as a result of the T1 treatment.
Table 4

Logistic equations and other parameters for nutrient accumulation in the aboveground biomass of Pongamia pinnata seedlings.

NutrientTreatmentEquation 1 V m 1 , 2 T a 1 , 2 T b 1 , 2 T m 1 , 2 R 3
Carbon (C) T1 W = 223.345/[1 + e(5.80−0.0345t)]3.956a 51a 134a 98a 0.981
T2 W = 197.890/[1 + e(3.46−0.0678t)]2.991b 62b 124b 77b 0.946
T3 W = 162.467/[1 + e(1.34−0.0123t)]2.893b 48c 82c 61c 0.945
T4 W = 141.623/[1 + e(2.34−0.0476t)]2.471c 47c 76d 54d 0.974
T5 W = 77.0960/[1 + e(3.23−0.0910t)]1.312d 22d 61e 50d 0.937
Nitrogen (N)
T1 W = 171.223/[1 + e(1.80−0.032t)]2.123a 44a 92a 76a 0.971
T2 W = 141.450/[1 + e(1.83−0.033t)]1.816b 45a 87b 69b 0.976
T3 W = 132.343/[1 + e(2.31−0.056t)]1.623c 37b 80c 51c 0.923
T4 W = 99.9890/[1 + e(2.34−0.053t)]1.245d 24c 62d 46d 0.945
T5 W = 87.0930/[1 + e(3.72−0.027t)]0.978e 23c 62d 34e 0.978
Phosphorus (P)
T1 W = 131.102/[1 + e(4.80−0.032t)]2.160a 41a 121a 76a 0.967
T2 W = 109.120/[1 + e(1.23−0.033t)]1.977b 40a 107b 71b 0.932
T3 W = 86.123/[1 + e(2.31−0.056t)]1.672c 32b 81c 62c 0.99
T4 W = 62.349/[1 + e(2.34−0.053t)]1.345d 27c 74d 52d 0.961
T5 W = 57.023/[1 + e(2.12−0.027t)]0.912e 19d 59e 47e 0.957
Potassium(K)
T1 W = 223. 345/[1 + e (5.801−0.0345t)]1.190a 56a 103a 82a 0.987
T2 W = 197. 890/[1 + e (3.456−0.0678t)]1.001b 56a 97b 71b 0.965
T3 W = 162. 467/[1 + e (1.34−0.023t)]0.876c 43b 71c 69b 0.981
T4 W = 141. 623/[1 + e(2.341−0.0476t)]0.671d 39c 64d 54c 0.952
T5 W = 77.096/[1 + e(3.230−0.0910t)]0.433e 37c 61d 41d 0.964

1 In the logistic equation, W represents the nutrient accumulation of plants (mg/plant), t denotes days after the emergence of seedlings, T and T explain the onset and termination of the rapid nutrient accumulation period, and V m denotes the maximum nutrient accumulation (mg plant−1 day−1) rate.

2 Values followed by different uppercase letters in a column are significantly different (P < 0.05) among treatments.

Native PGPR, P. aeruginosa RRALC3. T1, inorganic fertilizer (N:P:K, 2:1:1) + P. aeruginosa RRALC3; T2, inorganic fertilizer (N:P:K, 2:1:1) + commercial biofertilizer; T3, inorganic fertilizer (N:P:K, 2:1:1); T4, P. aeruginosa RRALC3; T5, control (no biofertilizer or inorganic fertilizer).

3Correlation coefficient (R) between the predicted and observed values

1 In the logistic equation, W represents the nutrient accumulation of n class="Chemical">plants (pan class="Chemical">mg/plant), t denotes days after the emergence of seedlings, T and T expn>lain the onset and termination of the rapid nutrient accumulation period, and V m denotes the maximum nutrient accumulation (pan class="Chemical">mg plant−1 day−1) rate. 2 Values followed by difpan class="Chemical">ferent uppern>an class="Chemical">case letters in a column are significantly different (P < 0.05) among treatments. Native pan class="Chemical">PGpan class="Chemical">PR, P. aeruginosa RRALC3. T1, inorganic fertilizer (N:P:K, 2:1:1) + P. aeruginosa RRALC3; T2, inorganic fertilizer (N:P:K, 2:1:1) + commercial biofertilizer; T3, inorganic fertilizer (N:P:K, 2:1:1); T4, P. aeruginosa RRALC3; T5, control (no biofertilizer or inorganic fertilizer). 3Correlation coefficient (R) between the predicted and observed values N accumulation in the aerial parts of the seedlings was analogous to C accumulation establishing that the T1 treatment had a significant effect. In the logistic equation, the onset time (T ) of N accumulation was different in T1 and T2 at 47 and 45 days, respectively, but the difference was not statistically significant on par with the T2. However, termination time (T ) showed a significant difference: T1 extended the N accumulation period by 7 days and the accumulated amount increased by nearly 7%. During the rapid N accumulation period no significant difference was observed between T4 and T5 but significant differences could be seen in the maximum daily nutrient accumulation (V m) and maximum daily accumulation time (T m) in the T4 treated plants. Despite the dearth of nutrients and inorganic pan class="Chemical">fertilizer, the pan class="Species">P. aeruginosa treated seedlings showed little effect on T T , V m and T m for P in the above ground biomass of P. pinnata. The daily P accumulation of T1 and T2 reached a maximum on day 76 (2.160 mg plant−1 day−1) and day 71 (1.977 mg plant−1 day−1), respectively. It indicated a P increase of 8.6% due to the T1 treatment. K accumulation in the aerial parts of pan class="Species">P. pinnata showed rapid changes between day 56 and 103 in T1. The maximum daily accumulation rate of K was 1.190 pan class="Chemical">mg plant−1 day−1 in T1 as deduced from the logistic equation. Ta and Tb were statistically significant in T4 and T5; however Vm and Tm were statistically on a par with each other. In logistic equation accumulation of C, N, P and K concentration and the growth parameters (V m, T m, T , and T ) of P. pinnata were statistically different in T3 (Inorganic fertilizer alone) and T4 (P. aeruginosa alone) treatments.

Discussion

Currently, the major threat to replanpan class="Chemical">tation in forests is topsoil loss due to eropan class="Chemical">sion. This creates a situation in which there is a decrease in the number of beneficial plant-associated microorganisms present to sustain plant growth [44]. Heavy or above-average rainfall alone is not enough to promote good plant growth and to enhance the microbial population even in the case of desert soils [18]. Thus, the planned reintroduction of native PGPB would definitely be an ideal solution for plant and soil nutrient enhancement in degraded forests. pan class="Chemical">Plant rhizosphere and n>an class="Chemical">PGPB interactions are essential to enhance plant growth and soil fertility and diverse ranges of PGPB stimulate growth through various direct and indirect mechanisms [45]. Several studies have reported that PGPB is effective in promoting plant growth and enhancing the nutrient content and yield of agricultural crops [46, 47]. To date, very few studies have been reported on the interaction between forest seedlings and PGPBs [48, 49]. However, there has been some research conducted on the application of PGPB in degraded forest soils and forest seedlings in nursery tree plants [50]. In the present study, a PGP bacterium P. aeruginosa RRALC3 was isolated from the NRF. Indigenous PGPB are well adapted to native or local conditions though no commercial PGPB products are known to be effective on desert soils [51, 52] and the addition of non-indigenous microbes to the soil has the potential to impact the indigenous rhizosphere population [53]. Due to their excellent growth promotion and biocontrol activities P. aeruginosa isolated from the rhizosphere of crop plants and environmental samples can be used as inoculant for promotion of plant growth [54-56]. P. aeruginosa is frequently found in soils [57] and is known to colonize cucumber roots [58], lettuce leaves [57], and the roots of sweet basil [59], sugar beet [60], wheat [58] and Arabidopsis [60]. pan class="Chemical">Plants, especially their endospn>heres and rhizospn>heres are impn>ortant reservoirs for emerging opportunistic pathogens [61,62]. The majority of rhizobacterial species which emerged as pathogens belongs to the group of antagonistic bacteria, e.g., Burkholderia, Enterobacter, Pseudomonas, Ralstonia, Serratia, Staphylococcus and Stenotrophomonas that enter bivalent interactions with plant and human hosts. Several members of these genera show plant growth promoting as well as excellent antagonistic properties against plant pathogens; therefore, they are utilized to control pathogens to promote plant growth [61]. Many mechanisms involved in the interaction between antagonistic plant associated bacteria and their host plants are similar to those responsible for pathogenicity of bacteria [63]. P. aeruginosa is more widely known as an opportunistic pathogen for humans and animals than as a soil bacteria. In this regard, P. aeruginosa can produce severe infections in immunocompromised hosts [64] and is the major factor for morbidity and mortality in cystic fibrosis patients [65]. Opportunistic pathogens occur in natural environments and are often associated with other eukaryotic hosts such as plants. They are often characterized by several of the following properties: (i) r-strategists = copiotropn>hs, (ii) cultivable, (iii) antagonistic towards other microorganisms, (iv) highly competitive, (v) highly versatile in their nutrition, (vi) hypermutators, (vii) resistant against antibiotics and toxins and (viii) form biofilms [66]. Similarly, P. aeruginosa RRALC3 isolated from this study also possessed the multiple plant growth promoting traits such as nitrogen fixation, IAA production and phosphate solubilization. Blood agar is widely used for the isolation of bacteria from clinical sample. Definitive clinical P. aeruginosa isolates could exhibit heamolytic activity in blood agar [67]. In this study, P. aeruginosa RRALC3 didn’t show heamolytic activity in blood agar. Generally highest percentage of heamolytic activity increased the pathogenicity of the P. aeruginosa [68]. Previously, it was reported that P. aeruginosa strains producing clear haemolysis within the first 48 h of incubation. It should be noted that not all clinical P. aeruginosa isolates are haemolytic; the percentage of environmental strains being haemolytic was similar to that reported for clinical P. aeruginosa isolates [69,70]. Most of the clinical P. aeruginosa strains produced proteases and could invade epithelial cells in a cell culture model system. These strains contained multidrug resistance determinants, and presented genes from the quorum-sensing and type III secretion systems. Some of them expressed either haemolytic or proteolytic activities or both. These characteristics are typical of virulent strains; however, they were also present in the environmental strains [62]. P. aeruginosa produces a variety of extracellular enzymes contributing to its pathogenicity. Elastase is an enzyme capable of degrading or inactivating important biological tissues and immune system components, including immunoglobulin. It also helps the survival of P. aeruginosa in various settings. ybtQ gene is present only in pathogenic strains of P. aeruginosa. The ecfX gene encodes an ECF (extracytoplasmic function) sigma factor suitable for species-specific identification of pathogenic P. aeruginosa isolates as it can act as a virulence factor in clinical isolates [32-34]. The P. aeruginosa isolate RRALC3 used as a PGPB in this study did not possess pathogenic genes to cause disease, and was phylogenetically clustered with other environmental isolates. Nematode Caenorhabditis elegans is a highly valuable model for the study of bacterial pathogenecity [71,72]. Initially this model was developed to identify genes in P. aeruginosa that are important for pathogenesis [73]. Upon inoculation of pathogenic bacterial strain on C. elegans which should show sick appearance at day 2 including reduced movement capacity; distended intestine. Percentage of live worms after 2 days ≤50%. Total number of dead aworms after 5 days ≤100%. A strain is considered pathogenic when at least one of the above criteria can be observed [74]. The C. elegans assay can be integrated into initial screenings for biological control agents and is a new tool to identify effects against eukaryotes in a very early stage of the product development [74]. Although could seems irrational to study lung diseases in animals (C. elegans and Zebrafish [Danio rerio]) who do not have lungs, several evidences support the benefits that these studies, if carried properly, may to bring in the elucidation of human lung pathology diseases [75]. In future, before development of biological control agent and or bio-inoculant with isolated P. aeruginosa RRALC3 should be tested in a suitable animal model for its virulence. The application of P. aeruginosa strains AW8 and LS3 is known to enhance the shoot, root, and panicle growth as well as plant height in the pan class="Chemical">case of wheat plants [76,77]. In cowpea, P. aeruginosa FP6 leads to increased germination of seeds and plant shoot and root [78]. P. aeruginosa strain PS1 inoculation has led to enhanced growth parameters of green gram in insecticide stressed soils [79]. In okra, tomato and African spinach, P. aeruginosa stimulated the availability nutrients and enhanced the composition of root exudates [80]. As hypothepan class="Chemical">sized by pan class="Chemical">Bashan et al. [18], native leguminous trees are essential for the replantation of highly eroded, degraded lands and they respond favorably to inoculation with PGPB in a manner similar to their application in agriculture and agroforestry. In this study, the leguminous tree P. pinnata was used as a test plant. It was observed that the promotion of shoot and root growth in Pongamia seedlings was greater under the cumulative effects of chemical fertilizer and native PGPB as compared to inorganic fertilizer and commercial biofertilizer treatments. Similar results were obtained by Vanessa et al. [81] in wheat plants using indigenous Actinobacteria microflora and commercial products. PGPB acts directly on plant roots through the production of indole acetic acid. This phytohormone is supposed to stimulate the formation of lateral roots and increase nutrient absorption from root hairs [61]. Generally, IAA is a plant growth hormone produced by microbes; it is non-essential for microbial function and growth but maximizes plant—microbe interactions [82]. In this study, the native bacterial strain produced IAA and exhibited enormous potential for promoting growth in the above and below ground biomass of plants. Chepan class="Chemical">mical pan class="Chemical">fertilization of seedlings with commercial biofertilizer resulted in a significant increase in biomass when compared with the control but was shown to be less effective than the combined application of P. aeruginosa RRALC3 and chemical fertilizer. Without fertilizer, the native PGPB showed a statistically significant difference at the P < 0.05 level. This difference was higher compared to the control and lower compared to seedlings treated with commercial biofertilizer. When water alone was applied to unfertilized seedlings treated with PGPB, the nutrient level of the soil was not optimal for plant growth. A similar result was also reported by Liu et al. [19] in Fraxinus americana container seedlings treated with Bacillus spp. without chemical fertilizer. In this study, treatment with chepan class="Chemical">mical pan class="Chemical">fertilizer and a native pan class="Chemical">PGPB was found to increase the biomass and major nutrient content of P. pinnata seedlings. PGPB have the potential to enhance water and nutrient absorption from the soil which in turn increases shoot and root growth in plants [83,84]. Different researchers [85,86] have also observed a similar positive effect on the yield and growth of sweet cherry and apple trees when treated with Bacillus OSU-142 and BA-8, respectively. pan class="Chemical">Bashan et al. [18] reported the revegetation of desert soil using three native leguminous trees (Prosopis articulata, Parkinsonia microphylla, and Parkinsonia florida) together with two PGPB (Azospirillum brasilense and Bacillus pumilus) and an arbuscular mycorrhizal fungus when supplemented with limited amounts of compost and water. Their results showed that plant survival and growth were improved under desert soil conditions using native PGPB. The increase in total biomass and the plant growth enhancement effects of the native bacteria used in this study on the legume P. pinnata could be explained by the presence of multiple plant growth promoting traits. In addition, in the present study, it was found that inoculation with P. aeruginosa RRALC3 increased the P, Mg, S, Ca and Zn content of P. pinnata seedlings. This might be attributed to the production of organic acids by the plants themselves as well as by various bacteria in the rhizosphere as production of organic acids is instrumental in decreasing the soil pH and stimulating the availability of micronutrients as previously supported by findings from other research groups [87,88] as well. pan class="Chemical">Plant root exudates are powerful microbial growth signals and crucial because of their impact on nutrient acquisition by plants [89]. PGPB produces IAA which causes plant cell walls to loosen resulting in an increased amount of root exudation that provides additional nutrients to support the growth of plants and rhizosphere bacteria [90]. Root exudates contain various chemical molecules that mobilize the availability of P and Fe in nutrient deficient soils [89]. In the present study, chemical fertilization in combination with PGPB enhanced the production of root exudates which probably led to the substantial increase in plant nutrient and carbon contents in P. pinnata. In summary, soil treated with the native pan class="Chemical">PGpan class="Chemical">P bacterium P. aeruginosa RRALC3 in combination with inorganic fertilizer enhanced the growth, nutrient and carbon content of the native legume P. pinnata. The native PGPB along with inorganic fertilizer was the most effective treatment in the NRF indigenous soil. In nutrient deficient conditions, administration of native PGPB alone had less but still substantial effect when compared to the control. Hence, this study emphasizes on the need to employ native beneficial microorganisms in combination with adequate inorganic fertilizer in the replantation of degraded forests.

Ammonia production by Diazotrophs isolated from degraded forest soils using the various N free semi solid media a) LGI b) JMV, c) Nfb.

(TIF) Click here for additional dapan class="Chemical">ta file.

Detection of nif H gene in Pseudomonas aeruginosa RRALC3 by PCR with Nif gene: lane 1: 1kb ladder, lane 2: negative control (DH5α), lane 3: Pseudomonas aeruginosa (RRALC3), lane 4: Azospirillum brasilens MTCC 125 (Positive control).

(TIF) Click here for additional dapan class="Chemical">ta file.

Pathogenecity assay for examination of virulence genes in (a) ecfX (b) ybtQ and (c) lasB.

Lane 1: 1 kb ladder, lane 2: negative control (DH5α), lane 3: pathogenic pan class="Species">Pseudomonas aeruginosa pan class="Species">PA14, lane 4: P. aeruginosa RRALC3, lane 5: non-pathogenic P. aeruginosa PA01. (TIF) Click here for additional dapan class="Chemical">ta file.

Hemolytic activity of Pseudomonas aeruginosa isolates (PA01, PA14, RRALC3) in blood agar plates a) Pseudomonas aeruginosa PA01- no hemolytic (ɤ) activity, b) Pseudomonas aeruginosa PA14 –dark greenish colour α hemolytic activity, c) Pseudomonas aeruginosa RRALC3- no hemolytic (ɤ) activity.

(TIF) Click here for additional dapan class="Chemical">ta file.
  41 in total

1.  Characteristics of Pseudomonas aeruginosa strains causing septicemia in a Spanish hospital 1981-1990.

Authors:  F Vázquez; M C Mendoza; M H Villar; A Vindel; F J Méndez
Journal:  Eur J Clin Microbiol Infect Dis       Date:  1992-08       Impact factor: 3.267

2.  Plant growth-promoting rhizobacteria affect the growth and nutrient uptake of Fraxinus americana container seedlings.

Authors:  Fangchun Liu; Shangjun Xing; Hailin Ma; Zhenyu Du; Bingyao Ma
Journal:  Appl Microbiol Biotechnol       Date:  2012-07-10       Impact factor: 4.813

3.  COLORIMETRIC ESTIMATION OF INDOLEACETIC ACID.

Authors:  S A Gordon; R P Weber
Journal:  Plant Physiol       Date:  1951-01       Impact factor: 8.340

4.  Identification of virulence genes in a pathogenic strain of Pseudomonas aeruginosa by representational difference analysis.

Authors:  Ji Young Choi; Costi D Sifri; Boyan C Goumnerov; Laurence G Rahme; Frederick M Ausubel; Stephen B Calderwood
Journal:  J Bacteriol       Date:  2002-02       Impact factor: 3.490

5.  Rapid analysis of amino acids using pre-column derivatization.

Authors:  B A Bidlingmeyer; S A Cohen; T L Tarvin
Journal:  J Chromatogr       Date:  1984-12-07

6.  Effect of microbial inoculants on the indigenous actinobacterial endophyte population in the roots of wheat as determined by terminal restriction fragment length polymorphism.

Authors:  Vanessa M Conn; Christopher M M Franco
Journal:  Appl Environ Microbiol       Date:  2004-11       Impact factor: 4.792

7.  Phosphate-solubilizing and plant-growth-promoting Pseudomonas aeruginosa PS1 improves greengram performance in quizalafop-p-ethyl and clodinafop amended soil.

Authors:  Munees Ahemad; Mohammad Saghir Khan
Journal:  Arch Environ Contam Toxicol       Date:  2009-09-16       Impact factor: 2.804

8.  Characteristics of Pseudomonas aeruginosa strains isolated from urinary tract infections.

Authors:  H Puzová; L Siegfried; M Kmetová; J Durovicová; A Kerestesová
Journal:  Folia Microbiol (Praha)       Date:  1994       Impact factor: 2.099

9.  Pseudomonas aeruginosa-plant root interactions. Pathogenicity, biofilm formation, and root exudation.

Authors:  Travis S Walker; Harsh Pal Bais; Eric Déziel; Herbert P Schweizer; Laurence G Rahme; Ray Fall; Jorge M Vivanco
Journal:  Plant Physiol       Date:  2003-12-30       Impact factor: 8.340

10.  Vegetable microbiomes: is there a connection among opportunistic infections, human health and our 'gut feeling'?

Authors:  Gabriele Berg; Armin Erlacher; Kornelia Smalla; Robert Krause
Journal:  Microb Biotechnol       Date:  2014-09-03       Impact factor: 5.813

View more
  8 in total

1.  Indigenous plant growth-promoting bacteria enhance plant growth, biomass, and nutrient uptake in degraded forest plants.

Authors:  Parthasarathy Radhapriya; Andimuthu Ramachandran; Perumal Palani
Journal:  3 Biotech       Date:  2018-02-28       Impact factor: 2.406

2.  Environmental Pseudomonads Inhibit Cystic Fibrosis Patient-Derived Pseudomonas aeruginosa.

Authors:  Payel Chatterjee; Elizabeth Davis; Fengan Yu; Sarah James; Julia H Wildschutte; Daniel D Wiegmann; David H Sherman; Robert M McKay; John J LiPuma; Hans Wildschutte
Journal:  Appl Environ Microbiol       Date:  2016-12-30       Impact factor: 4.792

3.  Biocontrol of Bacterial Leaf Blight of Rice and Profiling of Secondary Metabolites Produced by Rhizospheric Pseudomonas aeruginosa BRp3.

Authors:  Sumera Yasmin; Fauzia Y Hafeez; Muhammad S Mirza; Maria Rasul; Hafiz M I Arshad; Muhammad Zubair; Mazhar Iqbal
Journal:  Front Microbiol       Date:  2017-09-26       Impact factor: 5.640

4.  Comparative Metagenomics Reveals Microbial Signatures of Sugarcane Phyllosphere in Organic Management.

Authors:  Ahmad Nuruddin Khoiri; Supapon Cheevadhanarak; Jiraporn Jirakkakul; Sudarat Dulsawat; Peerada Prommeenate; Anuwat Tachaleat; Kanthida Kusonmano; Songsak Wattanachaisaereekul; Sawannee Sutheeworapong
Journal:  Front Microbiol       Date:  2021-03-22       Impact factor: 5.640

Review 5.  Agro-industrial-residues as potting media: physicochemical and biological characters and their influence on plant growth.

Authors:  Pratibha Agarwal; Sampa Saha; P Hariprasad
Journal:  Biomass Convers Biorefin       Date:  2021-10-09       Impact factor: 4.987

6.  Restoration of Degraded Soil in the Nanmangalam Reserve Forest with Native Tree Species: Effect of Indigenous Plant Growth-Promoting Bacteria.

Authors:  Andimuthu Ramachandran; Parthasarathy Radhapriya
Journal:  ScientificWorldJournal       Date:  2016-04-18

7.  The Endophytic Symbiont-Pseudomonas aeruginosa Stimulates the Antioxidant Activity and Growth of Achyranthes aspera L.

Authors:  Khaidem A Devi; Garima Pandey; A K S Rawat; Gauri D Sharma; Piyush Pandey
Journal:  Front Microbiol       Date:  2017-09-27       Impact factor: 5.640

8.  An Evaluation of Aluminum Tolerant Pseudomonas aeruginosa A7 for In Vivo Suppression of Fusarium Wilt of Chickpea Caused by Fusarium oxysporum f. sp. ciceris and Growth Promotion of Chickpea.

Authors:  Atifa Begum Mozumder; Kakoli Chanda; Ringhoilal Chorei; Himanshu Kishore Prasad
Journal:  Microorganisms       Date:  2022-03-05
  8 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.