PbaR, an IclR family transcriptional activator for the regulation of the 3-phenoxybenzoate 1',2'-dioxygenase gene cluster in Sphingobium wenxiniae JZ-1T.

The 3-phenoxybenzoate (3-PBA) 1',2'-dioxygenase gene cluster (pbaA1A2B cluster), which is responsible for catalyzing 3-phenoxybenzoate to 3-hydroxybenzoate and catechol, is inducibly expressed in Sphingobium wenxiniae strain JZ-1(T) by its substrate 3-PBA. In this study, we identified a transcriptional activator of the pbaA1A2B cluster, PbaR, using a DNA affinity approach. PbaR is a 253-amino-acid protein with a molecular mass of 28,000 Da. PbaR belongs to the IclR family of transcriptional regulators and shows 99% identity to a putative transcriptional regulator that is located on the carbazole-degrading plasmid pCAR3 in Sphingomonas sp. strain KA1. Gene disruption and complementation showed that PbaR was essential for transcription of the pbaA1A2B cluster in response to 3-PBA in strain JZ-1(T). However, PbaR does not regulate the reductase component gene pbaC. An electrophoretic mobility shift assay and DNase I footprinting showed that PbaR binds specifically to the 29-bp motif AATAGAAAGTCTGCCGTACGGCTATTTTT in the pbaA1A2B promoter area and that the palindromic sequence (GCCGTACGGC) within the motif is essential for PbaR binding. The binding site was located between the -10 box and the ribosome-binding site (downstream of the transcriptional start site), which is distinct from the location of the binding site in previously reported IclR family transcriptional regulators. This study reveals the regulatory mechanism for 3-PBA degradation in strain JZ-1(T), and the identification of PbaR increases the variety of regulatory models in the IclR family of transcriptional regulators.