The cytotoxicity effects of E. adenophorum on cell cycle and apoptosis of renal cells in Saanen goat was evaluated by TUNEL, DAPI, AO/EB staining, DNA fragmentation assay, Caspase activity, Western-blot, qRT-PCR and flow cytometry analysis. 16 saanen goats randomly divided into four groups were fed on 0%, 40%, 60% and 80% E. adenophorum diets. The Results showed that E. adenophorum induced typical apoptotic features of renal cells. E. adenophorum significantly suppressed renal cells viability, caused cell cycle activity arrest and induced typical apoptotic features in a dose-dependent manner. However, the protein levels of Fas/FasL, Bid and caspase-8 did not appear significant changes in the process of E. adenophorum-induced apoptosis. Moreover, E. adenophorum administration slightly decreased Bcl-2 expression, promoted Bax translocation to mitochondria, triggered the release of Cyt c from mitochondria into cytosol and activated caspase-9, -3, and cleaved PARP. The mitochondrial p53 translocation was significantly activated, accompanied by a significant increase in the loss of ΔΨm, Cyt c release and caspase-9 activation. Above all, these data suggest that E. adenophorum induces renal cells apoptosis via the activation of mitochondria-mediated apoptosis pathway in renal cells. These findings may provide new insights to understand the mechanisms involved in E. adenophorum-caused cytotoxicity of renal cells.
The cytotoxicity effects of E. adenophorum on cell cycle and apoptosis of renal cells in Saanengoat was evaluated by TUNEL, DAPI, AO/EB staining, DNA fragmentation assay, Caspase activity, Western-blot, qRT-PCR and flow cytometry analysis. 16 saanengoats randomly divided into four groups were fed on 0%, 40%, 60% and 80% E. adenophorum diets. The Results showed that E. adenophorum induced typical apoptotic features of renal cells. E. adenophorum significantly suppressed renal cells viability, caused cell cycle activity arrest and induced typical apoptotic features in a dose-dependent manner. However, the protein levels of Fas/FasL, Bid and caspase-8 did not appear significant changes in the process of E. adenophorum-induced apoptosis. Moreover, E. adenophorum administration slightly decreased Bcl-2 expression, promoted Bax translocation to mitochondria, triggered the release of Cyt c from mitochondria into cytosol and activated caspase-9, -3, and cleaved PARP. The mitochondrial p53 translocation was significantly activated, accompanied by a significant increase in the loss of ΔΨm, Cyt c release and caspase-9 activation. Above all, these data suggest that E. adenophorum induces renal cells apoptosis via the activation of mitochondria-mediated apoptosis pathway in renal cells. These findings may provide new insights to understand the mechanisms involved in E. adenophorum-caused cytotoxicity of renal cells.
Eupatorium adenophorum spreng (E. adenophorum), known as Crofton weed and that grows on roadsides and degraded land in different parts of the word, is a invasive weed. The plant is indigenous to Mexico, but has been introduced to Hawaii, the Philippines and another place [1]. Which instead and then has infested the grazing areas, especially in the Himalayan region of India[2], now, E. adenophorum can be found in Chongqing, Yunnan, Sichuan, Guizhou and other provinces of China. A rough estimate of the annual spreading rate of E. adenophorum is about 10–60 km from south to north and from west to east in China[3]. As reported, E. adenophorum had extensive biological activity, such as acaricidal activity [4-6], antitumor activity[7, 8] and anti-Inflammatory potential [9]. Besides, previous studies had reported that the plant has neurotoxic and hepatotoxic effects in different species of animals. Also, it’s reported regular ingestion of E. adenophorum could cause chronic pulmonary disease mainly in Australia, New Zealand and so on[1, 10]. From existing reported, using E. adenophorum freeze-dried leaf powder as diet supplement could cause hepatotoxicity[10]. Also, methanolic extract of E. adenophorum has been reported to induce hepatotoxicity in mice[11]. Furthermore, the rats administrated with purified extracts from E. adenophorum leaf as diet supplement could be caused hepatotoxicity and cholestasis [12, 13]. Besides, previous studies had found that the active compound 9-oxo-10, 11-dehydroageraphorone (euptox A) isolated from E. adenophorum works as the important toxins of E. adenophorum and had hepatotoxicity [6, 14]. These cases suggested that E. adenophorum might serve as an apoptotic inducer to promote apoptosis in some types of organ cells.Apoptosis, an essential physiological process and a critical role in development and tissue homeostasis, is a type of cell death regulated in an orderly way by a series of signal cascades under certain situations. There are at least two major apoptotic pathways, death receptors and mitochondria pathways, which are initiated by caspase-8 and caspase-9, respectively[15].The stimulation of the death receptor pathway, caspase-8 follows the recruitment of the procaspase to the death-inducing signalling complex. In contrast, the mitochondrial pathway requires the release of mitochondrial Cyt c and the formation of a large multiprotein complex comprising Cyt c, Apaf-1 and procaspase-9. The activation of caspase-3 is the key and irreversible point in the development of apoptosis[16, 17] and exists as a inactive precursor. Besides, procaspase-3 is converted to a active heterodimer when cells are signaled to die [18-20]. Many studies revealed that caspase-3 is activated by various stimuli, including receptor-mediated activation of caspase-8[21], caspase-9 activation[22, 23], alterations in the expression of the apoptotic proteins Bax and Bcl-2[24], and reactive oxygen species[25]. Activation of caspase-8 leads to cleavage of bid which subsequently can lead to permeabilization of the outer mitochondrial membrane followed by caspase-9 activation. Secondly caspase-8 is able to directly cleave caspase. In response to apoptotic stimuli, Bax translocates to the mitochondria and inserts into the outer mitochondrial membrane resulting in the collapse of ΔΨm. In contrast, Bcl-2 blocks this process by binding to the outer mitochondrial membrane and forming a heterodimer with Bax resulting in neutralization of its proapoptotic effects[26-29]In the present study, we investigated the cytotoxicity effects of E. adenophorum on Saanengoat renal cells, and detected its apoptosis-inducing effects at both cell and tissue levels, and cell cycle progression, so as to illuminate the possible mechanisms involved in E. adenophorum-caused goat’s nephrotoxicity.
Materials and Methods
Ethics Statement
All experimental procedures with goats and animal care used in the present study had been given prior approval by the recommendations in the Guide for Sichuan Agricultural University Animal Care and Use Committee, Sichuan Agricultural University, Sichuan, China under permit no. DKY-B20100805, and all efforts were made to minimize suffering. The field studies did not involve endangered or protected species. Saanengoats were housed in the experimental farm of animal nutrition institute, Sichuan Agricultural University.
Plant Materials
E. adenophorum leaves were collected from cropland in Xichang, Sichuan Province, with the permission to conduct the study on this site gave by the owner of the land. Then the leaves were dried after that the collected leaves of the plant were washed, grinded and sieved at room temperature to generate dry powder for the experiment.
Experimental Animals
A total of 16 saanengoats (12 males and 4 females, average weight and age were 25.34±1.11 kg and 3.15±0.13 months) randomly selected as test samples were divided into four groups of three males and one female each. Saanengoats of control group served as non-E. adenophorum feedstuffs, while saanengoats of Groups I, II and III were administered with the dose levels of 40% (i.e. 400 g/kg), 60% (i.e. 600 g/kg), 80% (i.e. 800 g/kg) E. adenophorum feedstuffs twice a day (at 8:00 and 16:00) for 3 months depending on the study of Sahoo [30], the saanengoats were fed 500 g feedstuffs each time, respectively, ryegrass and water were freely available during the experiment. All saanengoats were raised by feeding practices according to the Saanengoat standard, besides the sheepfold was clean up daily and measures for heat preservation, cold prevention and improving experimental environment were taken, such as ceiling fan was used to keep the room temperature about 20°C. There was a pre-test lasted for 15 days before the formal trial, during the pre-test, the saanengoats were given a deworming agent and invigorated the stomach. No saanengoats died prior to the experimental endpoint and at the end of the experiment. Throughout the experiment, the saanengoats of groupⅠ exhibited no sign of illness and the appetite of all the saanengoats exhibited normally, but group Ⅲ shown light stool and neurological symptoms similar to a trance condition. The exhibition of group Ⅱ was less serious than group Ⅲ. Oral rehydration salts was given to minimize potential suffering of saanengoats. After feeding three months on these diets, the goats were sacrificed.
Cell Cycle Detection
Four saanengoats in each group were euthanized after 3 months of formal trial. The kidneys were immediately removed and minced using scissors to form a cell suspension that was filtered through a 300-mesh nylon screen. The cells were washed twice with cold PBS (pH 7.2–7.4, Cat. No. 51-66121E, BD) and were then suspended in PBS at a concentration of 1×106 cells/ml. 500 μl of the solution was transfered to a 5 ml culture tube and centrifuged (200×g). After the cell suspension was permeabilized with 1 ml of 0.25% Tritonx-100 for 20 min at 4°C, the cells were washed with phosphate buffer, and then 5 μl propidium iodide (PI, Cat. No. 51-66211E, BD) was added. The cells were gently vortexed and incubated for 30 min at 4°C in the dark. Finally, 500 μl PBS was added to each tube, and the cell cycle phases were analyzed by flow cytometry (BD FACSCalibur, San Jose, CA, USA) within 45 min.
Annexin-V/PI Apoptosis Detection
Four saanengoats in each group were humanely killed after 3 months of formal trial, and kidneys were taken from each saanengoats immediately. The cell suspension was filtered through a 300-mesh nylon mesh, washed twice with cold PBS, and then suspended in cells in 1× binding buffer (Cat. No. 51-66121E) at a concentration of 1×106 cells/ mL. Transfer 100 μL of the solution to a 5-mL culture tube, and then add 5 μL of Annexin V-FITC (Cat. No. 51-65874X) and 5 μL of PI (Cat. No. 51-66211E). Gently vortex the cells and incubate for 15 min at RT (25°C) in the dark. Add 400 μL of 1× binding buffer to each tube and analyze by flow cytometry (BD FACSCalibur) within 1 h.
qRT-PCR Analysis of Bax, Bcl-2, Caspase-3, 8, 9 mRNA
The kidneys removed from the saanengoats immediately were placed in liquid nitrogen. The kidneys were grinded into powder with pestle by adding liquid nitrogen, respectively. Total RNA was isolated from the powder of kidney (50 mg) using Trizol (Aidlab, China) by following the manufacturer’s instructions. Synthesis of single-stranded cDNA from 5 μg of RNA was performed according to the “TUREscript 1st strand cDNA Synthesis Kit” from Aidlab (China), the mRNA was reverse transcribed into cDNA. The cDNA was used as a template for qRT-PCR analysis. Reaction conditions were set to 3 min at 95°C (first segment, one cycle), 10 s at 95°C and 30 s at Tm of a specific primer pair (second segment, 39 cycles) followed by 10 s at 95°C, and 72°C for 10 s (dissociation curve segment) using Thermal Cycler(C1000, BIO RAD, USA). Relative gene expression was defined as a ratio of target gene expression versus β-actin gene expression [31]. Gene expression values of control group were used for gene expression calibration, respectively. With 2-△△Ct assay, the results were analyzed [32]. The following primers (Table 1) were designed and synthesized by Liuhe Beijing company (China).
Table 1
The primers used for qRT- PCR.
Items
Sense (5’—to- 3’)
Antisense (5’—to- 3’)
Bax
CCTGCTTCTTTCTTCATCGG
AGGTGCCTGGACTCTTGGGT
Bcl-2
GGCTGGGATGCTTTGTG
GAGCAGTGCCTTCAGAGACAGC
Caspase-3
GCAGCAAACCTCAGGGAAAC
GGTTTCCCTGAGGTTTGCTG
Caspase-8
AAGAACGAGCCTCAGTAATC
GGATTACTGAGGCTCGTTCT
Caspase-9
GAAGACCAGCAGACAAGC
TGAATCCTCCAGAACCAA
β-actin
CCTGCTTCTTTCTTCATCGG
AGGTGCCTGGACTCTTGGGT
TUNEL assay
Nephridial tissues were fixed in 4% paraformal-dehyde, embedded in paraffin and cut into 6 μm sections. TdT-mediated dUTP nick end labelling (TUNEL) assay was conducted to study DNA fragmentation using the in situ cell death detection kit (Vazyme, Piscataway, NJ, USA) according to the manufacturer’s instructions. After mounting the TUNEL positive cells, nuclei were counterstained with DAPI and the sections were observed at ×1000 magnification under a Nikon microscope (Nikon Inc., Japan).
Apoptosis assessment by DAPI and AO/EB staining
The kidneys were removed and minced using scissors to form a cell suspension that was filtered through a 300-mesh nylon screen. For DAPI staining, the renal cells were fixed with 80% ethanol at room temperature for 30 min. The fixative was removed and the renal cells were washed with PBS for 3 times, and then incubated with DAPI (1 μg/ml) for 45 min at room temperature in the dark. For AO/EB staining, the cells without fixation were loaded with a 100 μl fresh-prepared AO/EB staining solution (100 μg/ml), then immediately observed under a Nikon fluores-cence microscope (Nikon Inc., Japan) in less than 20 min.
Caspase activity measurement
Caspases activities were measured by colorimetric assay kits (BioVision, Inc., Mountain View, California, US), according to the manufacture’s recommendations. Briefly, renal cells were harvested and incubated in ice-cold cell lysis buffer for 30 min on ice. The supernatants were collected and protein concentrations were determined using BCA Protein Assay Reagent (Pierce, Rockford, IL, US). Equivalent amount of proteins for each sample was incubated with interested caspase substrate. After incubation at 37°C for 4h, the protease activity was determined at 405 nm with microplate spectrophotometer (Bio-Tek Instruments, Inc., Winooski, US)
Western blot analysis
Mouse monoclonal antibodies against caspase-9, -3, -8, Cyt c, Bcl-2, Bax, Bid, Apaf-1, COX4, PARP, Fas, FasL, p53 and β-actin were purchased from Santa Cruz Biotechnology, Inc. (Santa Cruz, CA, US). Horseradish peroxidase-conjugated secondary antibody was purchased from Wuhan Boster Bio-Engineering Co., Ltd. (Wuhan, China). Renal cells were harvested and washed with ice-cold PBS, then lysed with ice-cold RIPA lysis buffer (Beyotime Inst. Biotech, Beijing, China) with 1 mmol/L PMSF. Protein concentrations were calculated by BCA assay kits (Pierce). 20 μg of total cellular protein was subjected to 12% SDS-PAGE and transferred to PVDF membranes (Millipore, Atlanta, GA, US). The membranes were blocked with 5% defatted milk powder at room temperature for 1 hr and then immunoblotting was performed with primary antibodies at 4°C overnight, followed by HRP-conjugated secondary antibody at room temperature for 1 h. Following each step, the membranes were washed five times with PBS-T for 3 min. Finally, the blots were developed using the enhanced chemiluminescence (ECL) system (Pierce).
DNA fragmentation assay
Both control and E. adenophorum-administration Renal cells were collected and washed with PBS. DNA extraction was performed according to previous studies[33]. After dissolved in TE buffer, DNA was subjected to 2% agarose gel electrophoresis for DNA fragmentation analysis.
Mitochondrial membrane potential assay
The mitochondrial membrane potential was detected using 5,5′,6,6′-tetrachloro-1,1′,3,3′ tetraethylbenzimidazolcarbocyanine iodide (JC-1; Molecular Probes, Eugene, OR, USA). Renal cells were rinsed once with PBS and incubated with JC-1 for 30 min at 37°C, centrifuged, washed twice with cold PBS, transferred to a 96-well plate (105 cells/well), and assayed in a fluorescence plate reader.
Electron microscopy observation
The ultrastructural morphology changes were observed under a transmission electron microscope. After E. adenophorum administration, the cells were fixed with 3% glutaraldehyde, and post-fixed with 1% OsO4. Then samples were dehydrated in graded ethanol solutions, followed by embedment and section. Ultra-thin sections were stained with uranyl acetate and lead citrate, and then observed under a transmission electron microscope (JEM-1230, Tokyo, Japan) at 60 kV.
Statistical Analysis
All data are expressed as mean ± SE and mean values of three independent experiments. Statistical analyses were performed to compare the experimental groups with the control group using a one-way analysis of variance (ANOVA) complemented with the Tukey-Kramer multiple comparison test with equal sample size. All the statistical analyses were performed using a commercially available statistical software package (SPSS15.0, SPSS Inc, USA)
Results
Cell Cycle of Renal Cells
The distribution of renal cells in different phases of the cell cycle was analyzed by flow cytometry (Fig 1). Following feeding saanengoats on different dose levels of E. adenophorum, in the experimental groups, the proportion of renal cells in the G0/G1 phase was increased substantially (P<0.01) and the percentage of renal cells was decreased to different extent in the S (P<0.01, P<0.01 and P<0.01) and PI value (P<0.01). Besides, the percentages of renal cells in the G0/G1 were increased by 13.8%, 26.0%, 36.6% and decreased by 23.8%, 48.2%, 68.6% in S phase than control, respectively, but there is no significant difference in G2/M phase (P>0.05), which suggested G0/G1 phase arrest. Our data suggests that E. adenophorum inhibits renal cell growth of saanengoats by blocking the G0/G1 to S phase transition in the cell cycle.
Fig 1
DNA histogram of renal cell cycle in control.
(A) The Saanen goat was treated with different dose of E. adenophorum for 3 months, Then DNA histogram of renal cells cell cycle was analyzed by flow cytometry for PI staining. the G0/G1%,S% and G2+M% phases of the renal cells were analyzed using flow cytometry. Flow cytometric histograms are representative of 3 separate experiments. Proliferating index (PI) value = [S+(G2+M)]/[(G0/G1)+S+(G2+M)]×100%. Data are presented with the means ±SD and mean values of three independent experiments. *p<0.05 and **p<0.01, compared with the control group.
DNA histogram of renal cell cycle in control.
(A) The Saanengoat was treated with different dose of E. adenophorum for 3 months, Then DNA histogram of renal cells cell cycle was analyzed by flow cytometry for PI staining. the G0/G1%,S% and G2+M% phases of the renal cells were analyzed using flow cytometry. Flow cytometric histograms are representative of 3 separate experiments. Proliferating index (PI) value = [S+(G2+M)]/[(G0/G1)+S+(G2+M)]×100%. Data are presented with the means ±SD and mean values of three independent experiments. *p<0.05 and **p<0.01, compared with the control group.
The detection of apoptosic renal cells
We further detected the apoptosis occurrence in renal cells. The renal cells apoptotic rate of saanengoats was assessed by using the Annexin V/PI staining assay, DAPI and AO/EB staining and TUNEL assay. By flow cytometry, the results indicated that the percentage of normal renal cells in the experimental groups was decreased markedly (P<0.05, P<0.01 and P<0.01). With the increase of E. adenophorum adding proportion, the apoptosis ratio was also on the increase, the percentages of early and late apoptotic renal cells in group Ⅱ, Ⅲ were significantly increased (P<0.01) (Fig 2A). The TUNEL assay is capable of detecting DNA strand breaks that occur prior to the nucleus fragmenting[34]. We also evaluated cell apoptosis through TUNEL staining. TUNEL-positive cells were quantified through manual counting. Our TUNEL staining results revealed that TUNEL-positive cells were not significantly observed in control group, whereas the proportion of renal cells undergoing apoptosis and showing signs of apoptosis increased significantly compared to the control group. Quantification indicated a 22.20% and 31.45% amount of TUNEL-positive cells at dose of 600, 800g/d E. adenophorum and both were significantly increased (P<0.01). The proportion of apoptosic renal cells positively correlated with the doses of E. adenophorum. DAPI and AO/EB staining showed that the cell nuclei and cell membrane integrity of renal cells of control did not appear significant changes, however, the renal cells of experimental groups appeared different extent of chromatin condensation, nuclear fragmentation and destruction of cell membrane integrity (Fig 2B). Besides the morphological changes of apoptosis in E. adenophorum–administrated renal cells, DNA fragmentation assay also showed that characteristic ladder patterns appeared in renal cells. Also, DNA ladder started became more evident in renal cells when at the dose level of 600 and 800g/kg/d (Fig 2C). The proportion of apoptosic renal cells positively correlated with the doses of E. adenophorum. These results demonstrated that E. adenophorum induced renal cells apoptosis in a dose-dependent manner.
Fig 2
E. adenophorum administration induces apoptosis in renal cells.
(A) The scattergram of apoptotic renal cells. The renal cells were analyzed for apoptosis by flow cytometry for Annexin V and PI staining. The percentage number of renal cells apoptosis(%) were shown. E. adenophorum significantly induced apoptosis in renal cells.(B) The Detection of apoptotic renal cells by DAPI, AO/EB staining and TUNEL assay. Representative kidney sections from saanen goats were analyzed using TUNEL assay for apoptotic cell death. The number of TUNEL positive cells (indicated arrows) in kidney was counted from five random microscopic fields. Magnification, x400. Nuclear morphological changes in renal cells were observed under fluorescent microscope after DAPI staining (indicated arrows, 200×) and DAPI or AO/EB staining (400×). (C) Induction of DNA fragmentation. DNA isolated from E. adenophorum-administration renal cells was subjected to 2% agarose gel electrophoresis, followed by visualization of bands and photography. Data are presented with the means±SD and mean values of three independent experiments. *p<0.05 and **p<0.01, compared with the control group.
E. adenophorum administration induces apoptosis in renal cells.
(A) The scattergram of apoptotic renal cells. The renal cells were analyzed for apoptosis by flow cytometry for Annexin V and PI staining. The percentage number of renal cells apoptosis(%) were shown. E. adenophorum significantly induced apoptosis in renal cells.(B) The Detection of apoptotic renal cells by DAPI, AO/EB staining and TUNEL assay. Representative kidney sections from saanengoats were analyzed using TUNEL assay for apoptotic cell death. The number of TUNEL positive cells (indicated arrows) in kidney was counted from five random microscopic fields. Magnification, x400. Nuclear morphological changes in renal cells were observed under fluorescent microscope after DAPI staining (indicated arrows, 200×) and DAPI or AO/EB staining (400×). (C) Induction of DNA fragmentation. DNA isolated from E. adenophorum-administration renal cells was subjected to 2% agarose gel electrophoresis, followed by visualization of bands and photography. Data are presented with the means±SD and mean values of three independent experiments. *p<0.05 and **p<0.01, compared with the control group.
The contributions of caspase-8, 9 and 3 in apoptosis
Caspases are the central components in the execution of apoptosis. Respectively, caspase-8 and -9 are both the initiator caspases in the death receptor pathway and the mitochondrial pathway. Caspase-3 is the key executioner caspase in apoptosis pathway and the downstream caspase of caspase-8 and -9. The contributions of caspase-8, -9 and -3 in E. adenophorum-induced apoptosis were confirm by qRT-PCR caspase activity and Western blot. The results of Western-blot indicated that full-length procaspase-9 and procaspase-3 were decreased with the increased treated times, while their cleaved form were increased. However, the cleavage of procaspase-8 and the cleaved form of it did not show any difference (Fig 3A). In cytoplasm, released Cyt c usually combines with Apaf-1 and procaspase-9 to form the apoptosome in the presence of ATP, resulting in the activation of caspase-9. The cell lysates were immunoprecipitated with an anti-Apaf-1 antibody and subsequently subjected to Western blot with anti-Caspase-9 antibodies, which was conducted to detect whether E. adenophorum promotes the formation of apoptosome. The results showed that Apaf-1 was interacted with Caspase-9 (Fig 3B). Besides, qRT-PCR showed that E. adenophorum evidently induced the activation of caspase-3 and caspase-9, but not induce the activation of caspase-8 in group Ⅰ, Ⅱ(P>0.05) (Fig 3C). The caspase molecules involved in E. adenophorum-induced apoptosis was analysed to measure the activities of caspase-8, -9, and -3 using colorimetric assay kits. E. adenophorum significantly induced the activation of caspases-9 and -3, but not caspase-8 (Fig 3D).
Fig 3
E. adenophorum-induced apoptosis is mediated by activation of caspase-9, caspase-3.
(A) The protein levels of procaspase-3, -8, -9 and the cleaved form of them. The expression of apoptosis-related proteins, including caspase-3, -9, -8 were shown with β-actin as a control, were detected by Western-blot analysis.(B)
E. adenophorum induced apoptosome formation. Protein extractions from renal cells were collected and then used in immunoprecipitation assays against Apaf-1. The level of caspase-9 was detected by western blot to indicate the formation of apoptosome complex. (C) The relative mRNA levels of caspase-3, -8 and -9. The Saanen goat was treated with different dose of E. adenophorum for 3 months and the mRNA of renal cells was extraced and used for qRT-PCR assay. E. adenophorum induced the activiation of caspase-3, -9.(D) Caspase activities in renal cells. BCA assay was used to equal protein amounts and the enzymatic activities of caspases-8, -9, and -3 were measured using the colorimetric assay kits. Data are presented with the means±SD and mean values of three independent experiments. *p<0.05 and **p<0.01, compared with the control group.
E. adenophorum-induced apoptosis is mediated by activation of caspase-9, caspase-3.
(A) The protein levels of procaspase-3, -8, -9 and the cleaved form of them. The expression of apoptosis-related proteins, including caspase-3, -9, -8 were shown with β-actin as a control, were detected by Western-blot analysis.(B)
E. adenophorum induced apoptosome formation. Protein extractions from renal cells were collected and then used in immunoprecipitation assays against Apaf-1. The level of caspase-9 was detected by western blot to indicate the formation of apoptosome complex. (C) The relative mRNA levels of caspase-3, -8 and -9. The Saanengoat was treated with different dose of E. adenophorum for 3 months and the mRNA of renal cells was extraced and used for qRT-PCR assay. E. adenophorum induced the activiation of caspase-3, -9.(D) Caspase activities in renal cells. BCA assay was used to equal protein amounts and the enzymatic activities of caspases-8, -9, and -3 were measured using the colorimetric assay kits. Data are presented with the means±SD and mean values of three independent experiments. *p<0.05 and **p<0.01, compared with the control group.
E. adenophorum treatment activates the mitochondrial apoptotic pathway
The two distinct signaling pathways involving in apoptosis are the death receptor pathway and the mitochondrial pathway. The death receptor pathway is usually triggered by ligation of death receptors such as Fas or tumornecrosis factor receptor, which recruits fas associated protein with FADD and procaspase-8 to form a death-inducing signaling complex, leading to caspase-8 proteolytic activation. It is known that activated caspase-8 can cleave Bid to tBid. Mitochondria play a vital role in apoptosis triggered by chemical agents[35, 36]. Mitochondrial membrane integrity is regulated by pro-apoptotic and anti-apoptotic members of the Bcl-2 family such as Bcl-2 and Bax. Bcl-2 protect cells from the induction of apoptosis through interacting with Bax, blocking the release of Cyt c from the mitochondria to cytosol. The Cyt c, Fas, FasL, Bcl-2, Bid and Bax levels were examined to explore the effects of E. adenophorum on renal cells by western blot, qRT-PCR. As it shown, E. adenophorum increased the protein level of Bax and Cyt c and decreased protein level of Bcl-2 in a dose-dependent manner in renal cells. Consistent with the lack of activation of caspase-8 in this study, the levels of Bid did not show significant variations, suggesting that the activation of mitochondrial pathway was independent of the activation of caspase-8 and Bid (Fig 4A). qRT-PCR indicated that the activation of Bax was increased and Bcl-2 was decreased, resulting in the ratio of Bax/Bcl-2, which incline to the activation of the mitochondrial pathway(Fig 4B). Western blot indicated that E. adenophorum failed to affect the levels of Fas and FasL, suggesting that E. adenophorum might not activate Fas-mediated death receptor pathway in renal cells (Fig 4C). PARP is a downstream target for caspases during apoptosis. The western blot showed that PARP was shown to be cleaved from 116 to 85 kDa fragments obviously in the renal cells adminitrated with E. adenophorum (Fig 4D). The location of Bax and Cyt c in the proteins extracts from both mitochondrial and cytosolic fractions of renal cells was detected. A translocation of Bax from cytosol to mitochondria was observed. Consistent with this, a dose-dependent decrease in mitochondrial Cyt c and a concomitant increase in the cytosolic fraction were also observed (Fig 4E). These results suggested that E. adenophorum-induced apoptosis was mainly through the activation of mitochondrial pathway.
Fig 4
The renal cells apoptosis induced by E. adenophorum was mediated by mitochondrial pathway.
(A)
E. adenophorum did not promote the cleavage of Bid, but increased the protein levels of Cyt c and Bax, and decrease the protein level of Bcl-2. (B)
E. adenophorum decreased ralative mRNA level of Bcl-2, but increased the level of Bax, resulting in the change of Bax/Bcl-2.(C) The protein levels of Fas or FasL measured by western blot did not reveal any changes.(D) The renal cells were subjected to western blot analysis to detectfull-length and cleaved PARP. (E)
E. adenophorum induced Bax translocation and Cyt c release. The cytosolic and mitochondrial fraction proteins were collected and then detected by western blot. COX 4 and β-actin were used as internal controls for the mitochondrial fractions and the cytosolic fraction, respectively.
The renal cells apoptosis induced by E. adenophorum was mediated by mitochondrial pathway.
(A)
E. adenophorum did not promote the cleavage of Bid, but increased the protein levels of Cyt c and Bax, and decrease the protein level of Bcl-2. (B)
E. adenophorum decreased ralative mRNA level of Bcl-2, but increased the level of Bax, resulting in the change of Bax/Bcl-2.(C) The protein levels of Fas or FasL measured by western blot did not reveal any changes.(D) The renal cells were subjected to western blot analysis to detectfull-length and cleaved PARP. (E)
E. adenophorum induced Bax translocation and Cyt c release. The cytosolic and mitochondrial fraction proteins were collected and then detected by western blot. COX 4 and β-actin were used as internal controls for the mitochondrial fractions and the cytosolic fraction, respectively.
Mitochondrial localization of p53 promotes mitochondrial apoptosis pathways
Previous reports confirmed that p53 promotes apoptosis through transcription-independent mechanisms, primarily signals through the mitochondrial pathway[37]. Previous studies demonstrated that a fraction of wild-type p53 protein rapidly migrates to the mitochondria early in the course of p53-dependent apoptosis[38]. Activation of p53-dependent apoptosis leads to mitochondrial apoptotic changes via the intrinsic and extrinsic pathways triggering cell death execution most notably by release of Cyt c and activation of the caspase cascade. Although it was previously believed that p53 induces apoptotic mitochondrial changes exclusively through transcription-dependent mechanisms, recent studies suggest that p53 also regulates apoptosis via a transcription-independent action at the mitochondria[39]. We conducted the study to verify that mitochondrial p53 accumulation is associated with E. adenophorum-induced apoptosis of renal cells. As shown in Fig 5A, E. adenophorum induced mitochondrial p53 translocation from cytosol to mitochondrion. To investigate the downstream of the mitochondrial p53 pathway, that Cyt c release to the cytosol from mitochondrion, caspase-9 activation and mitochondrial membrane potential(ΔΨm) in renal cells were examined. The collapse of ΔΨm was also observed in renal cells as compared to control (Fig 5B). A significant increase in cytosolic Cyt c (Fig 5C), and caspase-9 activation (Fig 5D) were observed. These results indicated that p53 molecules accumulated into the mitochondria and activated mitochondrial apoptosis pathway.
Fig 5
Mitochondrial p53 activates mitochondrial pathway in renal cells.
To determine localization of p53, renal cells were incubated as indicated (A) Western blot analyzed the effect of E. adenophorum on p53 mitochondrial translocation. COX 4, mitochondrial loading control. (B) Flow cytometry and JC-1 measure the effet of E. adenophorum on ΔΨm. (C) Western blot was conducted to analyze the release of Cyt c in renal cells. (D) The effect of E. adenophorum on enzymatic activity of caspase-9 was measured and was expressed relative to the control. Date are presented with the means±SD and mean values of three independent experiments. *p<0.05 and **p<0.01 compared with the control group.
Mitochondrial p53 activates mitochondrial pathway in renal cells.
To determine localization of p53, renal cells were incubated as indicated (A) Western blot analyzed the effect of E. adenophorum on p53 mitochondrial translocation. COX 4, mitochondrial loading control. (B) Flow cytometry and JC-1 measure the effet of E. adenophorum on ΔΨm. (C) Western blot was conducted to analyze the release of Cyt c in renal cells. (D) The effect of E. adenophorum on enzymatic activity of caspase-9 was measured and was expressed relative to the control. Date are presented with the means±SD and mean values of three independent experiments. *p<0.05 and **p<0.01 compared with the control group.
Ultrastructural morphology changes
The apoptotic features of renal cells were further confirmed by electron microscopy. Transmission electron microscope observation showed that renal cells displayed characteristically morphological changes after E. adenophorum-administration. In contrast to necrotic cells, the plasma membrane of apoptotic cells remains intact, under high-power (×10000), renal cells had an intact plasma membrane and a markedly reduced cytoplasmic volume. Besides the high-power views showed condensation of nuclear chromatin, which were the features typical of apoptosis that does not occur in necrosis. Chromatin condenses against the nuclear membrane, producing the crescentic pattern in early apoptosis. Then chromatin condenses into solid, rounded masses that undergo fragmentation (arrowheads in Fig 6). whereas the control cells did not appear significant changes in cell nuclei and cell membrane integrity.
Fig 6
Ultrastructural morphology changes of renal cells.
(A) Saanen goats were administrated with various doses of E. adenophorum for 3 months, and the ranal cells of saanen goats were conducted with ultrastructural observation. After a series of washing, fixation, dehydration and stained, cells were visualized under transmission. Magnification, x10000.
Ultrastructural morphology changes of renal cells.
(A) Saanengoats were administrated with various doses of E. adenophorum for 3 months, and the ranal cells of saanengoats were conducted with ultrastructural observation. After a series of washing, fixation, dehydration and stained, cells were visualized under transmission. Magnification, x10000.
Discussion
E. adenophorum, a worldwide noxious invasive weed, has become a major threat to economy and ecology in some regions of the world[40]. Regular ingestion of E. adenophorum caused chronic pulmonary disease in horses[1] and Verma’s studies reported that using E. adenophorum growing in India as diet supplement caused cattle anorexia, suspension of rumination and photosensitization[41]. In mice, feeding containing E. adenophorum freeze-dried leaf powder caused hepatotoxicity. However, no toxic effects were seen in goats when the comprising of E. adenophorum up to 67% of their intake[42]. The experiment period was probably the reason why our result was on the contrary. These studies provide rational for exploring E. adenophorum as a cause of nephrotoxicity and an inducer of apoptosis in renal cells of saanengoat.Apoptosis, a highly regulated process, is used to eliminate dysplastic and damaged cells from multicellular organisms[43]. By means of flow cytometry[44], We found that the renal cells that stained positive for (FITC+/PI+) and (FITC+/PI-) were increased, this indicated that E. adenophorum reduced the survival and inhibited the growth of the renal cells through induction of apoptosis and cell cycle arrest, suggesting that renal cells was sensitive to E. adenophorum in Saanengoat. In cell level, the study showed that E. adenophorum induced renal cells apoptosis with the typical morphological characteristics including cellular shrinkage, chromatin condensation, DNA fragmentation. Here we showed that E. adenophorum decreased the expression of Bcl-2 while increased that of Bax both in protein and mRNA levels, and promoted the translocation of Bax from cytoplasm to mitochondria and that of Cyt c from mitochondria to cytoplasm, indicating that mitochondrial pathway was activated[45, 46]. The mitochondrial pathway requires the release of mitochondrial Cyt c and the formation of a large multiprotein complex comprising Cyt c, Apaf-1 and procaspase-9. In renal cells, the Cyt c released from mitochondria into cytosol to form apoptosomes together with Apaf-1 and procaspase-9, followed by the activation of caspse-9, -3 and the cleavage of PARP. Besides, E. adenophorum failed to activate Fas, FasL, Bid and the death receptor-mediated caspase-8 pathway, suggesting that mitochondria-mediated apoptosis pathway is activated by E. adenophorum administration and E. adenophorum induced apoptosis through the Cyt c-mediated and caspase-dependent pathway. Furthermore, the dysregulation of mitochondria integrity associated molecules Bcl-2 and Bax in E. adenophorum-administration renal cells further suggest that the activation of mitochondria-mediated apoptosis pathway is the main events in the process of apoptosis occurrence. We found that E. adenophorum could induce p53's mitochondrial translocation, followed by the release of Cyt c and caspase-9 activation, as well as aggravated ΔΨm decrease in renal cells. Thus, it is evident that the p53 in renal cells translocated to mitochondria where it triggered mitochondrial apoptotic pathways. These results indicated that E. adenophorum can induce renal cells apoptosis and cause kidney impairment by induction of mitochondrial dysfunction, and further confirm that mitochondria as the center of cell metabolism play an essential role in maintaining the normal physiological function of renal cells. The study indicated that mitochondrial dysfunction in renal cells induced by E. adenophorum was considered to responsible for the apoptosis occurrence[47]. The cell cycle detection and PI value showed E. adenophorum intake could effectively inhibit the growth of renal cells by causing cell cycle arrest.The present study demonstrated that E. adenophorum significantly inhibits the growth of renal cells by causing G0/G1 phase cell cycle arrest and the induction of apoptosis. The E. adenophorum-induced apoptosis is dependent on the mitochondria-mediated caspase activation and involvement of the regulation of Bcl-2 and Bax, followed by the significant increases in activation of caspases-9 and -3, the release of Cyt c to cytosol and the cleavage of PARP. This study provides us a new insight into understanding the mechanisms of saanengoat renal cells apoptosis caused by E. adenophorum.
Authors: J Schlegel; I Peters; S Orrenius; D K Miller; N A Thornberry; T T Yamin; D W Nicholson Journal: J Biol Chem Date: 1996-01-26 Impact factor: 5.157