Literature DB >> 26301579

Association between the Lipid Levels and Single Nucleotide Polymorphisms of ABCA1, APOE and HMGCR Genes in Subjects with Spontaneous Preterm Delivery.

Lin Li1, Jin Hua1, Huang Jian-Ping1, Long Yan1.   

Abstract

Spontaneous preterm delivery (SPTD) with gestational age between 28 and 37 complete weeks was reported to have a genetic predisposition in lipids metabolism. This study aimed to investigate the association between the lipid levels and gene polymorphisms of ABCA1 (rs2422493), APOE (rs7412) and HMGCR (rs12916) in Chinese pregnant women with SPTD. A case-control study was conducted at the baseline randomization in 200 SPTD and 178 healthy full term delivery (FTD) women. Maternal blood lipids were detected close to delivery of fetus in SPTD group and in FTD group with gestational age-matched. Cord blood lipids were detected after delivery in two groups. Three genotypes both in maternal and cord blood were determined by real time PCR. The results showed that the levels of total cholesterol (TCHO), triglyceride (TG), high density lipoprotein (HDL), and low-density lipoprotein cholesterol (LDL) in the maternal blood in the SPTD group were significantly lower than those in the FTD group, while the levels of TCHO, HDL, and LDL in the cord blood in the SPTD group were significantly higher than those in the FTD group. In the SPTD subjects, the levels of TG and LDL in the maternal blood were associated with different genotypes of HMGCR gene rs12916 loci. These results indicate that abnormal lipid metabolism may exist in SPTD women and the premature fetus and the HMGCR gene may be a susceptible gene for SPTD.

Entities:  

Mesh:

Substances:

Year:  2015        PMID: 26301579      PMCID: PMC4547703          DOI: 10.1371/journal.pone.0135785

Source DB:  PubMed          Journal:  PLoS One        ISSN: 1932-6203            Impact factor:   3.240


Introduction

Preterm delivery (PTD) is the leading cause of prenatal morbidity and mortality. The incidence of PTD is approximately 7.5–12.5% worldwide [1]. The probabilities of having cardiovascular disease and other adverse consequences are higher in PTD babies than those in full-term delivery (FTD) babies [2]. Despite many efforts that have been made by researchers and doctors, the incidence of preterm birth has not been significantly decreased. The major clinical subtypes of preterm delivery include iatrogenic (medically indicated) preterm delivery and spontaneous preterm delivery. Intrauterine infection and premature rupture of membranes are the common causes for SPTD, there are still one half patients without any clear reason [3]. Epidemiological studies have demonstrated that PTD has a genetic predisposition [4]. Previous studies [5,6] have mainly focused on the genes and proteins that are related to infection. But the genes that contribute to prenatal nutrition status have not been extensively investigated. The abnormal change of lipid profiles in pregnant women is a risk factors for PTD [7]. Fetal serum cholesterol and lipoprotein concentrations differ between preterm and term born neonates [8]. Thus, we hypothesized that the variation of genes involved in lipid metabolism both in mother and fetus may regulate the level of lipid profiles, which contributing to the occurrence of SPTD. Here we focus on SPTD instead of PTD to exclude iatrogenic preterm delivery, which were not clarified in most previous studies. The ABCA1, APOE and HMGCR genes play a critical role in lipid metabolism related to premature coronary artery disease [9-11]. However, little is known about the correlation between the polymorphisms of these genes and SPTD. The ABCA1 gene, a member of the ATP-binding cassette A (ABCA1) transporter superfamily, encodes a membrane protein that facilitates the cellular efflux of cholesterol and phospholipids. The 477C/T single nucleotide polymorphism (SNP) in the ABCA1 gene promoter region is a factor that affects plasma HDL level in the Chinese Han population [9]. APOE protein, encoded by APOE gene, plays an important role in the transport, storage, utilization and excretion of lipid. The frequency of this gene among various races and regions is different, and is closely related with hyperlipidemia, atherosclerosis and coronary heart disease [10]. The human HMGCR gene encodes the β-hydroxy-β-methylglutaryl coenzyme. A reductase is the rate-controlling enzyme of the mevalonate pathway that produces cholesterol and other isoprenoids. In a pharmacokinetic study [11], the polymorphism of the rs12916 locus in the HMGCR gene was found in a Chinese population, and a decreased low-density lipoprotein cholesterol (LDL) level was found to be related to the rs12916 locus in the HMGCR gene. Little was known about the contribution of variants in fetal and maternal cholesterol metabolism genes ABCA1, APOE and HMGCR in SPTD. Thus, in this study we aimed to examine the lipid levels in the mother and fetus and to investigate the association between the lipid levels and polymorphisms of three major genes in Chinese SPTD patients.

Materials and Methods

Subjects

SPTD women with gestational age between 28 and 37 complete weeks and FTD control subjects (delivery ≥37 weeks) were recruited from the Department of Obstetrics at Beijing Friendship Hospital, Capital Medical University, and Beijing Maternal and Child Health Hospital in Haidian District between January 2011 and April 2012. Written consent was obtained from all subjects. This study was approved by the ethics committee of Capital Medical University. All included subjects met the following criteria: 21–35 years old, non-smoking, non-vegetarian, confirmed single live birth by ultrasound, and body mass index (BMI) of 19–25 kg/m2. The subjects with existing infection, pregnancy complications, adverse pregnancy history and iatrogenic preterm delivery were excluded from this study. Neonates of singleton pregnancies with birth weight inadequate for gestational age (lower than the 10th percentile and larger than the 90th percentile), fetal anomalies, abnormal fetal karyotype, and positive TORCH screening results were excluded.

Detection of blood lipids

In SPTD subjects, 3.5 ml of venous blood were collected close to delivery of fetus, while in the FTD subjects, the same volume of venous blood were collected between 28+0 and 36+6 gestational week matched with SPTD subjects. Three and one-half milliliter of umbilical arterial blood in two groups were collected after delivery. Blood samples were sent to the Clinical Laboratory Center in Beijing Friendship Hospital. The levels of TCHO, HDL, LDL and TG were measured with an AU2700 automatic biochemical analyzer (OLIMPUS, Toyko, Japan).

Detection of gene polymorphisms in the maternal blood and umbilical cord blood

The blood cells from maternal venous blood and umbilical arterial blood were separated by centrifugation at 3,000 rpm for 20 min. DNA was extracted with a genomic DNA extraction kit (TIANGEN Beijing Co., Ltd., Beijing, China). The primers and probes were designed and synthesized by Applied Biosystems (Life Technologies, Grand Islands, NY). Two probes were designed for each SNP with VIC or FAM dye labels. The probes and primers of three SNP loci were mixed as a 40× stock solution (40× TaqMan SNP Genotyping Assay Mix). The details of the three loci are shown in Table 1. The PCR reaction system was carried out in a 10μl volume containing 10μl TaqMan Universal PCR Master Mix (2×), 0.5μl primers and probes mixture (20×), and 4.5μl DNA (concentration was more than 10 ng/μl). The amplification reaction was performed at 95°C for 10 min, 50 cycles of denaturation at 92°C for 15 s and annealing/extension at 60°C for 1 min on a 7500 real-time fluorescence PCR system (Applied Biosystems). All SNPs were re-genotyped by direct sequencing in a subset of 120 individuals to check for genotyping discrepancies. Genotyping error rates were ≤0.01 for all SNPs.
Table 1

The basic characteristic of all SNP for ABCA1, APOE and HMGCR.

Gene SNPChromosomal locationAssay Id.Nucleotide exchangeLocalizationHWE P
ABCA1 rs24224939q31.1dC_16235101_10 GCCTAGGCTGGGGTGAGGGGAAGGC[T/C]GACAGTCCTCTGGGTAATGGGCTGC promoter0.1
APOE rs741219q13.32aC_904973_10 CCGCGATGCCGATGACCTGCAGAAG[C/T]GCCTGGCAGTGTACCAGGCCGGGGC Exon non-syn0.18
HMGCR rs129165q13.3bC_7445046_10 CAGTGCAATTGACCTTCTCCCTCAC[C/T]CCTGCCAGTTGAAAATGGATTTTTA 3ˊUTR0.22

Statistical analysis

The chi-squared test was used to determine whether the observed genotype frequencies were compatible with the Hardy-Weinberg equilibrium (HWE) and to test for differences in genotype frequencies between preterm women and term women. The data such as age, BMI, parity, and gestation week were presented as mean ± SD for continuous variables. The differences of dominant or recessive allele between two groups were analyzed with an unpaired t test. The comparison of blood lipids with different genotypes was carried out with analysis of variance (ANOVA). The Bonferroni post hoc test correction was used to correct for multiple comparisons. A generalized linear model (GLM) was used to analyze the relationships between the SNPs and lipids adjusted for age, BMI and gestation of delivery, which were identified as significant variables from the stepwise linear regression model. SPSS 12.0 software (Chicago, IL) was used to perform the statistical analysis. Each SNP were tested separately. All tests were two-side and significance level was set at 0.05.

Results

Demographic characteristics and lipid levels of the study population

The SPTD subjects (n = 200) had an average age of 28.83 ± 3.22 years and a BMI of 21.64 ± 3.02 kg/m2, while the FTD subjects (n = 178) had an average age of 28.85 ± 3.12 years and a BMI of 21.27 ± 2.82 kg/m2. The characteristics and lipid levels of the subjects were presented in Table 2. There were no significant differences in age, parity and BMI between SPTD and FTD groups. A generalized linear model (GLM) analysis also showed that there were no relationships between the SNPs and lipids adjusted for age, BMI and gestation of delivery.
Table 2

Characteristics of the study population (n = 378).

Total(n = 378)Preterm (n = 200)Term(n = 178) P
Age (years)28.84 ± 3.1628.83 ± 3.2228.85 ± 3.120.934
Parity1.5 ±0.241.5 ±0.251.5 ±0.240.550
BMI (Kg/m2)21.42±4.7822.32 ± 4.3021.03 ±5.200.719
Gestation of delivery36.70±2.8934.44± 1.9939.23± 1.090.000
TCHO a 6.26± 1.226.12± 1.316.40± 1.120.027
TG a 3.19± 1.203.04± 1.173.34± 1.210.019
HDL a 1.82± 0.391.77± 0.411.88±0.360.006
LDL a 3.56± 0.763.46± 0.803.65± 0.720.016
TCHO b 1.89± 0.562.05±0.581.65±0.440.000
TG b 0.29± 0.150.28±0.160.30±0.140.372
HDL b 0.76± 0.170.78±0.170.73±0.180.043
LDL b 0.93± 0.341.02±0.340.77±0.270.000

a Lipid levels in maternal peripheral blood

b Lipid levels in cord blood. P: Significance between preterm group and term group

a Lipid levels in maternal peripheral blood b Lipid levels in cord blood. P: Significance between preterm group and term group

Lipid levels in the maternal and cord blood

Compared with FTD subjects, the levels of TCHO, TG, HDL, and LDL in the maternal blood were significantly lower while the levels of TCHO, HDL, and LDL in the cord blood were significantly higher in the SPTD subjects (Fig 1). The level of TG in the cord blood was not significantly different between the two groups (Fig 1).
Fig 1

The level of maternal blood and umbilical blood lipids in preterm and full-term groups.

The genotypes of ABCA1, APOE, and HMGCR genes and allele frequency distribution in maternal and cord blood

HMGCR gene rs12916 locus has three genotypes: CC, CT, and TT. The three genotypes and allele frequency distribution were significantly different in the maternal blood cells between the two groups respectively (χ = 6.398, P = 0.041), while other genes genotypes and allele frequency distribution in the maternal blood cells were not significantly different (P >0.05). Moreover, there were no significant differences in the three genes genotypes and allele frequency distribution in the cord blood cells between the SPTD and FTD groups (P >0.05) (Table 3).
Table 3

ABCA1, APOE and HMGCR genes polymorphism and variant in maternal blood and umbilical cord blood in full-term and PTBs groups.

The figure in the bracket means allele frequency rate.

Polymorphism and variantMaternal blood in preterm groupMaternal blood in full-term groupUmbilical cord blood in preterm groupUmbilical cord blood in full-term group
ABCA1(rs2422493)
 CC35(0.21)37(0.24)34(0.19)13(0.14)
 CT74(0.44)64(0.42)91(0.52)54(0.57)
 TT58(0.35)51(0.35)51(0.29)28(0.30)
Total16715217695
Allele frequency C/T0.43/0.570.45/0.550.45/0.550.42/0.58
APOE(rs27412)
 CC135(0.82)129(0.85)146(0.86)80(0.85)
 CT28(0.17)22(0.14)21(0.12)14(0.15)
 TT1(0.01)1(0.01)4(0.02)0(0%)
Total16415217194
Allele frequency C/T0.91/0.090.92/0.080.92/0.080.93/0.07
HMGCR(rs12916)
 CC41(0.24)* 22(0.14)* 40(0.23)16(0.17)
 CT66(0.39)* 77(0.51)* 82(0.47)51(0.54)
 TT62(0.37)* 53(0.35)* 54(0.31)28(0.30)
Total16915217695
Allele frequency C/T0.44/0.56* 0.40/0.60* 0.46/0.540.44/0.56

* P <0.05

ABCA1, APOE and HMGCR genes polymorphism and variant in maternal blood and umbilical cord blood in full-term and PTBs groups.

The figure in the bracket means allele frequency rate. * P <0.05

The association between lipid levels and different genotypes of ABCA1, APOE, and HMGCR genes in the maternal and cord blood

In the SPTD group, the TG level in the maternal blood was associated with the different genotypes of the HMGCR gene rs12916 loci CC, CT, and TT (P = 0.007). The TT group showed the highest TG level, which was significantly higher than that in the CC(P = 0.043) and CT groups(P = 0.002). The TG level was not significantly different between the CC and CT groups (Table 3). Moreover, the LDL level was associated with the different genotypes of the HMGCR gene rs12916 loci CC, CT, and TT in the maternal blood in the SPTD group (P = 0.041). Through pairwise comparisons, the TT subjects showed the highest LDL level, which was significantly higher than that in the CC and CT groups (P = 0.042, P = 0.033). There was no significant difference in the LDL level between the CC and CT groups. The lipid levels in the subjects were not associated with different genotypes of the HMGCR gene rs12916 loci in the cord blood. Moreover, the lipid levels were not associated with different genotypes of ABCA1 gene rs2422493 and APOE genes rs7412 determined from the maternal and cord blood of all subjects (Tables 4 and 5).
Table 4

The level of maternal blood lipids in different SNPs of ABCA1 rs2422493, APOE rs7412 and HMGCR rs12916(, mmol/L).

Lipids ABCA1 rs2422493 genotypes APOE rs7412 genotypes HMGCR rs12916 genotypes
Preterm groupCC (n = 34)CT (n = 71)TT (n = 55)CC (n = 129)CT (n = 27)TT (n = 1)CC (n = 37)CT (n = 66)TT (n = 57)
TCHO6.20±1.505.97±1.136.40±1.426.15±1.306.22±1.405.296.12±1.326.01±1.256.37±1.41
TG3.06±1.242.93±1.113.29±1.253.02±1.123.29±1.384.42.95±0.93* 2.80±0.91* 3.44±1.46*
HDL1.69±0.341.78±0.371.82±0.461.74±0.411.89±0.371.271.83±0.411.74±0.421.77±0.38
LDL3.47±0.843.38±0.703.64±0.893.49±0.803.50±0.762.973.37±0.75* 3.41±0.79* 3.71±0.79*
Full-term goupCC(n = 36)CT(n = 61)TT(n = 50)CC(n = 124)CT(n = 22)TT(n = 1)CC(n = 23)CT(n = 72)TT(n = 52)
TCHO6.42±1.036.28±1.256.58±1.146.41±1.136.39±1.405.696.05±0.996.41±1.186.56±1.21
TG3.31±1.523.26±1.103.51±1.183.31±1.183.57±1.293.83.05±0.973.48±1.353.31±1.18
HDL1.90±0.391.86±0.341.92±0.401.85±0.372.04±0.361.861.85±0.381.87±0.371.93±0.38
LDL3.65±0.683.59±0.803.78±0.743.66±0.733.69±0.873.083.45±0.663.66±0.773.78±0.76

* P<0.05

Table 5

The level of umbilical cord blood lipids in different SNPs of ABCA1 rs2422493, APOE rs7412 and HMGCR rs12916(, mmol/L).

There is no significant difference in lipid level between different genotypes of rs12916 and rs2422493 and rs7412 in cord blood.

Lipids ABCA1 rs2422493 genotypes APOE rs7412 genotypes HMGCR rs12916 genotypes
Preterm groupCC (n = 32)CT (n = 71)TT (n = 42)CC (n = 122)CT (n = 16)TT (n = 4)CC (n = 33)CT (n = 71)TT (n = 43)
TCHO1.95±0.532.07±0.592.04±0.542.05±0.581.88±0.461.69±0.392.06±0.472.02±0.562.04±0.63
TG0.28±0.170.25±0.130.33±0.190.28±0.160.22±0.110.32±0.190.29±0.170.27±0.150.30±0.17
HDL0.77±0.160.78±0.170.76±0.170.76±0.170.94±0.280.74±0.100.78±0.180.77±0.170.77±0.16
LDL0.97±0.321.04±0.351.00±0.291.02±0.330.82±0.280.81±0.201.02±0.281.00±0.321.03±0.37
Full-term goupCC(n = 10)CT(n = 49)TT(n = 25)CCn = 72)CT(n = 12)TT(n = 0)CC(n = 15)CT(n = 44)TT(n = 26)
TCHO1.62±0.501.66±0.501.69±0.351.68±0.461.49±0.351.69±0.461.61±0.461.73±0.43
TG0.27±0.130.29±0.150.30±0.140.29±0.130.31±0.170.28±0.120.31±0.150.26±0.13
HDL0.73±0.220.73±0.180.76±0.140.73±0.180.74±0.150.80±0.180.71±0.180.75±0.16
LDL0.76±0.270.78±0.330.79±0.200.79±0.300.66±0.180.81±0.290.73±0.270.83±0.30
* P<0.05

The level of umbilical cord blood lipids in different SNPs of ABCA1 rs2422493, APOE rs7412 and HMGCR rs12916(, mmol/L).

There is no significant difference in lipid level between different genotypes of rs12916 and rs2422493 and rs7412 in cord blood.

Discussion

This study demonstrated that the lipid profiles varied greatly in maternal and cord blood in two groups. Women had lower concentrations of TCHO, TG, HDL and LDL in maternal blood in SPTD group than in FTD group with gestational age-matched, while had higher concentrations of TCHO, HDL and LDL in cord blood in SPTD group than in FTD group. The results of the lipid profiles in this study were different from the previous studies. Janet et al. [12] reported that high cholesterol and triglycerides at <15 weeks were associated with an increased risk for preterm birth. Lanay et al. [13] reported that extremely low TC, HDLc, and LDLc were also associated with a modest increased risk of PTD, whereas high TC, LDLc and TG increased the risk of spontaneous PTD. In a recent cohort study [14], TCHO level in the first trimester and its change between trimesters were used to predict preterm birth. However, Robin et al.[15] found that lower serum cholesterol was strongly associated with PTD in white mothers. The different results mentioned in the above showed that the disorder of lipid metabolism, whether too high or too low level of lipids, may contribute to the occurrence of the PTD. We also emphasized that in this study the subjects were recruited strictly to minimize the effect of other factors on the level of lipids such as infection, medically indication and cervical incompetence, which were not illustrated clearly on subtype of PTD in most of the literatures. In a prospective longitudinal study of Turgay' group [16], the levels of TG, TCHO, HDL, LDL increased significantly as pregnancy progressed and lower level of TG was the high risk factors of preterm labor. In order to avoid the bias from the different gestational week we selected the FTD subjects whose gestational age matched to SPTD in our study. More interestingly, the findings of lipid level and SPTD case control status associations in this study were opposite in direction, between maternal peripheral blood and umbilical blood. This result indicated that the fetal lipid metabolism differed remarkably from the maternal and may play a key role in development of SPTD. In Pecks’ study [8], they had provided the evidence for a difference of sera from preterm and term neonates in the ability to promote the reverse cholesterol transport (RCT). The pathogenesis of abnormal lipid metabolism for SPTD is not clear. Lipoproteins participate in the development of atherosclerosis. An increased cholesterol influx and the oxidation of LDL to oxLDL particles are prerequisites for rapid accumulation of LDL in the macrophages in the vascular wall, leading to foam cell formation and fatty plaque development. Atherosclerotic-like lesions with cholesterol-laden macrophages in the maternal spiral arteries have been found in pathological specimens from pregnancies complicated by preeclampsia, IUGR and PTD [17]. The lipid metabolism between the mother and fetus requires specific receptors (such as VLDL, LDL, HDL, scavenger receptors and LDL receptor-binding protein, etc.) and many placental lipases (such as lipoprotein lipase, phospholipase A2, and intracellular lipase) [18]. Michael et al [19]. reported that high levels of HDL and apolipoprotein A1 were found in the mothers of small for gestational age (SGA) cases, suggesting defective placental transport of HDL. The placenta also seemed to play a important role in the interaction of maternal-fetus lipid metabolism. Recently, some researchers have investigated the etiologies regarding genetic susceptibility and gene-environment interactions in PTD patients [20,21]. Thus, We hypothesized that the variation of the genes involved in lipid metabolism regulated the lipases expression in the tissue of the mother, fetus, and placental, resulting the different level of lipid profiles between the maternal peripheral and cord blood. Here, we investigate the association between the lipid levels and gene polymorphisms of three major genes ABCA1 (rs2422493), APOE (rs7412) and HMGCR (rs12916) involved in cholesterol metabolism in Chinese pregnant women with SPTD. Liu et al [9]. reported that 477C/T SNP in the ABCA1 gene promoter region exists in the normal Chinese Han population. The HDL-C level in the population with a TT genotype was significantly lower than that in the population with a CC genotype. Here, we observed that the lipid levels in the maternal blood and cord blood were not associated with SNP of 477C/T in the ABCA1 gene promoter region. The three subtypes (E2, E3 and E4) of APOE gene are determined by rs429358 and rs7412 [10]. Steffen et al [20]. observed that the polymorphism of APOE gene rs7412 loci had a relationship with PTD. However, our results showed that APOE gene rs7412 in the maternal blood and cord blood was not associated with CC, CT, or TT genotypes and the allele frequency distribution was not significantly different between the SPTD and FTD subjects. The polymorphism loci of the HMGCR gene rs12916 is located in the non-coding region of HMGCR gene 3' UTR, but it may associate with other functional polymorphic loci and affect HMGCR gene expression, and thus regulate changes in serum lipoprotein levels. Some researchers [22,23] have found that polymorphism of the HMGCR gene rs12916 loci affected serum TCHO, and LDL levels. Other researchers found the HMGCR gene expressed in placenta for fetal-placental lipid metabolism was different between women with type 1 diabetes (T1DM) and women with no complications [24]. Our results showed that the polymorphisms of the HMGCR gene rs12916 loci were associated with changes in the TG and LDL levels in the maternal blood of SPTD subjects, but this association was not found in the umbilical cord blood. Further research are needed to reveal the expression of HMGCR gene in the tissue of the mother, fetus, and placental on the pathway of SPTD. Gene polymorphisms of the APOE gene rs7412 and the ABCA1 gene rs2422493 showed neither a correlation with preterm nor term delivery in this study, which was inconsistent with the literatures. The different results may be explained by special status in conception or non-conception, inadequate samples, different population and coordinated action of multiple genes related to the onset and development of preterm. In addition, this study was designed to set the genome of mother and fetus as research objects, the effect of the fathers’ genome on preterm was not considered. Thus, a large sample size is needed to appropriately evaluate the effect of these genetic variants on SPTD. In summary, compared with FTD subjects, the levels of TCHO, TG, HDL and LDL in the maternal blood were decreased while the levels of TCHO, HDL and LDL in the umbilical cord blood were increased in the SPTD subjects. Moreover, the levels of TG and LDL in the maternal blood were associated with different genotypes of the HMGCR gene rs12916 loci, suggesting that HMGCR may be a susceptible gene for preterm birth. The findings of lipid level in SPTD cases were opposite in direction between maternal peripheral blood and umbilical blood, which also indicated that the HMGCR gene would express differently in placenta between SPTD and FTD, Further research was needed to give evidences.
  22 in total

Review 1.  The management of preterm labor.

Authors:  Robert L Goldenberg
Journal:  Obstet Gynecol       Date:  2002-11       Impact factor: 7.661

Review 2.  Could an infectious trigger explain the differential maternal response to the shared placental pathology of preeclampsia and normotensive intrauterine growth restriction?

Authors:  Peter von Dadelszen; Laura A Magee
Journal:  Acta Obstet Gynecol Scand       Date:  2002-07       Impact factor: 3.636

3.  Common sequence variants in pharmacodynamic and pharmacokinetic pathway-related genes conferring LDL cholesterol response to statins.

Authors:  Kuo-Liong Chien; Kuei-Chen Wang; Yen-Ching Chen; Chia-Lung Chao; Hsiu-Ching Hsu; Ming-Fong Chen; Wei J Chen
Journal:  Pharmacogenomics       Date:  2010-03       Impact factor: 2.533

4.  Maternal and fetal variation in genes of cholesterol metabolism is associated with preterm delivery.

Authors:  K M Steffen; M E Cooper; M Shi; D Caprau; H N Simhan; J M Dagle; M L Marazita; J C Murray
Journal:  J Perinatol       Date:  2007-09-13       Impact factor: 2.521

5.  Common SNPs in HMGCR in micronesians and whites associated with LDL-cholesterol levels affect alternative splicing of exon13.

Authors:  Ralph Burkhardt; Eimear E Kenny; Jennifer K Lowe; Andrew Birkeland; Rebecca Josowitz; Martha Noel; Jacqueline Salit; Julian B Maller; Itsik Pe'er; Mark J Daly; David Altshuler; Markus Stoffel; Jeffrey M Friedman; Jan L Breslow
Journal:  Arterioscler Thromb Vasc Biol       Date:  2008-09-18       Impact factor: 8.311

6.  Nonesterified fatty acids and spontaneous preterm birth: a factor analysis for identification of risk patterns.

Authors:  Janet M Catov; Marnie Bertolet; Yi-Fan Chen; Rhobert W Evans; Carl A Hubel
Journal:  Am J Epidemiol       Date:  2014-04-08       Impact factor: 4.897

7.  Plasma lipids and lipoproteins during pregnancy and related pregnancy outcomes.

Authors:  Turgay Emet; Işık Ustüner; Seda Güvendağ Güven; Gülşah Balık; Ulkü Mete Ural; Yeşim Bayoğlu Tekin; Senol Sentürk; Figen Kır Sahin; Ayşe Filiz Avşar
Journal:  Arch Gynecol Obstet       Date:  2013-02-12       Impact factor: 2.344

8.  Maternal lipids and small for gestational age birth at term.

Authors:  Michael S Kramer; Susan R Kahn; Mourad Dahhou; James Otvos; Jacques Genest; Robert W Platt; Rhobert W Evans
Journal:  J Pediatr       Date:  2013-06-28       Impact factor: 4.406

9.  A proposed method to predict preterm birth using clinical data, standard maternal serum screening, and cholesterol.

Authors:  Brandon W Alleman; Amanda R Smith; Heather M Byers; Bruce Bedell; Kelli K Ryckman; Jeffrey C Murray; Kristi S Borowski
Journal:  Am J Obstet Gynecol       Date:  2013-03-15       Impact factor: 8.661

10.  Whole blood gene expression profile associated with spontaneous preterm birth in women with threatened preterm labor.

Authors:  Yujing Jan Heng; Craig Edward Pennell; Hon Nian Chua; Jonathan Edward Perkins; Stephen James Lye
Journal:  PLoS One       Date:  2014-05-14       Impact factor: 3.240

View more
  5 in total

Review 1.  Spontaneous preterm birth: advances toward the discovery of genetic predisposition.

Authors:  Jerome F Strauss; Roberto Romero; Nardhy Gomez-Lopez; Hannah Haymond-Thornburg; Bhavi P Modi; Maria E Teves; Laurel N Pearson; Timothy P York; Harvey A Schenkein
Journal:  Am J Obstet Gynecol       Date:  2017-12-14       Impact factor: 8.661

2.  Serum apolipoprotein E concentration and polymorphism influence serum lipid levels in Chinese Shandong Han population.

Authors:  ShuYi Han; YiHui Xu; MeiHua Gao; YunShan Wang; Jun Wang; YanYan Liu; Min Wang; XiaoQian Zhang
Journal:  Medicine (Baltimore)       Date:  2016-12       Impact factor: 1.889

3.  Placental ABCA1 Expression Is Increased in Spontaneous Preterm Deliveries Compared with Iatrogenic Preterm Deliveries and Term Deliveries.

Authors:  Xie Cheng-Mao; Long Yan; Lin Li; Jin Hua; Wang Xiao-Ju; Zhang Jie-Wen
Journal:  Biomed Res Int       Date:  2017-05-29       Impact factor: 3.411

4.  Impact of Apolipoprotein E gene polymorphism during normal and pathological conditions of the brain across the lifespan.

Authors:  Diego Iacono; Gloria C Feltis
Journal:  Aging (Albany NY)       Date:  2019-01-24       Impact factor: 5.682

5.  The Association Between FokI Vitamin D Receptor Polymorphisms With Metabolic Syndrome Among Pregnant Arab Women.

Authors:  Maysa Alzaim; Nasser M Al-Daghri; Shaun Sabico; Mona A Fouda; Sara Al-Musharaf; Malak N K Khattak; Abdul Khader Mohammed; Abdulrahman Al-Ajlan; Dalal N Binjawhar; Richard Wood
Journal:  Front Endocrinol (Lausanne)       Date:  2022-02-24       Impact factor: 5.555

  5 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.