Literature DB >> 26273281

Oleanolic acid and ursolic acid inhibit peptidoglycan biosynthesis in Streptococcus mutans UA159.

Soon-Nang Park1, Sug-Joon Ahn2, Joong-Ki Kook1.   

Abstract

In this study, we revealed that OA and UA significantly inhibited the expression of most genes related to peptidoglycan biosynthesis in S. mutans UA159. To the best of our knowledge, this is the first report to introduce the antimicrobial mechanism of OA and UA against S. mutans.

Entities:  

Keywords:  Streptococcus mutans UA159; oleanolic acid; peptidoglycan biosynthesis; ursolic acid

Mesh:

Substances:

Year:  2015        PMID: 26273281      PMCID: PMC4507558          DOI: 10.1590/S1517-838246246220130209

Source DB:  PubMed          Journal:  Braz J Microbiol        ISSN: 1517-8382            Impact factor:   2.476


Ursolic acid (UA, (3β)-hydroxy-urs-12-en-28-oic acid), oleanolic acid (OA, 3β-3-hydroxyolean-12-en-28-oic acid), and betulinic acid (BA, 3β-3-hydroxy-lup-20(29)-en-28-oic acid) are derivatives of triterpenoid saponins (Liu, 1995; Fontanay ). These compounds are naturally found in a large variety of vegetables, medicinal herbs, and plants that have been investigated for antibacterial activity (Fontanay ). The antimicrobial activity of OA and UA is stronger than that of BA (Fontanay ). OA and UA inhibit growth of Gram-positive bacteria but not Gram-negative bacteria (Fontanay ), but their antimicrobial mechanism is unknown. Previously, we reported that OA and UA have strong antimicrobial activity against Streptococcus mutans (Kim ; Kim ) but BA had no antimicrobial activity against S. mutans (data not shown). One of the characteristic differences between Gram-positive and Gram-negative bacteria is the thickness of the peptidoglycan layer. Considering this difference, it has been suggested that the mechanism of OA and UA antimicrobial activity may be related to inhibition of peptidoglycan biosynthesis (Horiuchi ). Thus, the objective of this study was to investigate the effect of BA, OA, and UA on peptidoglycan biosynthesis in S. mutans UA 159 using the quantitative real-time polymerase chain reaction (qPCR) method to identify the antimicrobial mechanism against S. mutans. S. mutans UA159 was a kind gift from Dr. Robert A. Burne, Department of Oral Biology, College of Dentistry, University of Florida. The strain was cultured in brain heart infusion (BHI) broth (Difco, Lab., Detroit, MI, USA) or on BHI agar plates in a 37 °C incubator. Overnight cultures (1 mL) of S. mutans UA 159 were transferred to 9 mL BHI broth and grown at 37 °C to the mid-log phase (OD600 = 0.35). UA (Sigma, St. Louis, MO, USA), OA (Sigma), or BA (Sigma) solutions were added to each tube to a final concentration of 64 μg/mL. The bacterial culture solutions were incubated in a 37 °C incubator for 90 min and then harvested by centrifugation at 10,000 × g for 10 min at 4 °C. After discarding the supernatant, liquid nitrogen was immediately added to the tube. The frozen bacterial pellets were homogenized using a mortar and pestle (Smile Science, Seoul, Korea). Total RNAs were extracted from the homogenized bacteria following the manufacturer's instructions of the RNAqueous® kit (Ambion, Austin, TX, USA). DNase I treatment was conducted to completely remove the bacterial genomic DNAs using a TURBO DNA-free™ Kit (Ambion) according to the manufacturer's protocol. RNA concentration was determined at 260 nm 280 nm with a UV spectrophotometer (Ultrospec 2000, Pharmacia Biotech., UK). We consulted the KEGG pathway database to determine the target genes related to S. mutans UA159 peptidoglycan biosynthesis (KEGG pathway). qPCR primers were designed based on the nucleotide sequences of the target genes (GenBank accession no. AE014133.2) using the MegAlign and PrimerSelect programs (Lasergene™ 8.0, DNAStar, Inc., Madison, WI, USA) (Table 1). The qPCR primers were synthesized by Bioneer Co. (Daejeon, Korea).
Table 1

Quantitative real-time polymerase chain reaction (qPCR) primers used in this study.

GenesPrimer names and oligonucleotide sequences (5 – > 3)Size of amplicon (bp)
glmU UA159-glmU-F: TGATCCTTTCGGTTATGGTCGTATUA159-glmU-R: CGTTCCCGTGTTAATTTCTTTGA118
murA UA159-murA-F1: CCTCCGGGCATAGAAACCTTAGUA159-murA-R1: ATTTTAGATGTGGCTCCTTATGAA110
murB UA159-murB-F1: CGAGATATGCGCTTTGGTTUA159-murB-R1: AACGCTGCATTTCCTGACTG121
murC UA159-murC-F1: GGTAACCATTTTCGAGAGCATAGGUA159-murC-R1: ACACGGATTGGAAAAAGCAGGAA140
murC2 UA159-murC2-F: CAAATGGATCGTTACGGTGAAATUA159-murC2-R: TTGGCGTTAAAGAGTGGGCTATC116
murD UA159-murD-F: TCAAACGCAGGCAAAGATTATTCUA159-murD-R: TTTCAACATTATGGCTTCCTGGTA143
murE UA159-murE-F1: CGTCCGGCCATGATTTCTACCAUA159-murE-R1: GCTCTCGGGGGTTGTTAGTTTTGA81
alr UA159-alr-F: AGAAGGCGGGAGCGACTGUA159-alr-R: CAATTGACTGATAAGGGTGGTAAA116
ddI UA159- D-Ala-F: AGATGTGGCTTTTTATGATTACGAUA159- D-Ala-R: AAAGTCCACAGCAGCCCAAAGT146
murI UA159-murI-F: AATGGGCCGTAAAAGTGGATAATGUA159-murI-R: TGCCCCAAATTTGTTCCTAT147
murF UA159-murF-F1: GGTGCTGGCAGATATGAAAGAATUA159-murF-R1: AGTGGTCCAAAAAGAAAAATACGA111
bacA UA159-bacA-F: AACGGCCTTTTTCATTGGTCTGUA159-bacA-R: GTTGCGACTTGCCGACTGG114
mraY UA159-mraY-F: CTTTGCATTTGGGCGTGTTTTAUA159-mraY-R: GAAGCCAAGCCATCAATACCATC100
murG UA159-murG-F: AAGGTGGGTTTGTTTCAGTTCCUA159-murG-R: GCAATTCGGTTAGCCAGTCC106
murM SM159-murM-F: TATTTTTGGCAGTACGGATGGATSM159-murM-R: ATGGCTGGGACAAACAAGTGA131
murN UA159-murN-F: AAACAAAGAGACTGCCTGCTAAGAUA159-murN-R: AAAACCAATTGCGTGAACTGTC123
pbp1a UA159-pbp1a-F: TTGATGCCGCTGGATTAGATACTGUA159-pbp1a-R: CACTGCTGGCACCATACTTTTGTT132
pbp1b UA159-pbp1b-F: ATGGTGCTTCTCTTGATGATGUA159-pbp1b-R: CAAAGGCGTGATTATTCTGAT132
pbp2a UA159-pbp2a-F: TATGTTGAAGGGTCCGGGTATCTAUA159-pbp2a-R: CGGTTCCCCATTCCCACTTT150
pbp2b UA159-pbp2b-F1: ACCGCGTTGGAACATCTTATCTUA159-pbp2b-R1: TAGTCCCTTTGGCAGTGGTCTTA129
pbp2X UA159-pbp2X-F: AAAGACGGACAAGTGACCTACCAAUA159-pbp2X-R: CCATCTGCGTTTCCAAATAAGTCT145
dacA UA159-dacA-F: GTACCGCCAACTTTTTCAGCUA159-dacA-R: CAGCGCCAGCAATGTCC120
16S rDNASM159-16S -F: CACACCGCCCGTCACACCACSM159-16S -R: CCAGCCGCACCTTCCGATACG137

glmU, UDP-N-acetylglucosamine pyrophosphorylase gene; murA, UDP-N-acetylglucosamine 1-carboxyvinyltransferase gene; murB, UDP-N-acetylenolpyruvoylglucosamine reductase gene; murC, UDP-N-acetyl muramate-alanine ligase gene; murC2, UDP-N-acetylmuramyl tripeptide synthetase gene; murD, UDP-N-acetylmuramoyl-L-alanyl-D-glutamate synthetase gene; murE, UDP-N-acetylmuramoyl-L-alanyl-D-glutamate-L-lysine ligase gene; alr, alanine racemase gene; ddI, D-alanine-D-alanine ligase gene; murI, glutamate racemase gene; murF, UDP-N-acetylmuramoyl-tripeptide—D-alanyl-D-alanine ligase gene; bacA, undecaprenyl pyrophosphate phosphatase gene; mraY, phospho-N-acetylmuramoyl-pentapeptide-transferase gene; murG, undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase gene; murM, UDP-N-acetylmuramoylpentapeptide-lysine N6-alanyltransferase gene; murN, alanine adding enzyme gene; pbp1a, penicillin binding protein 1a gene; pbp1b, penicillin binding protein 1b gene; pbp2a, penicillin binding protein 2a gene; pbp2b, penicillin binding protein 2b gene; pbp2X, penicillin binding protein 2× gene; dacA, serine-type D-Ala-D-Ala carboxypeptidase (DD-transpeptidase, DacA) gene; 16S rDNA, 16S ribosomal RNA gene.

glmU, UDP-N-acetylglucosamine pyrophosphorylase gene; murA, UDP-N-acetylglucosamine 1-carboxyvinyltransferase gene; murB, UDP-N-acetylenolpyruvoylglucosamine reductase gene; murC, UDP-N-acetyl muramate-alanine ligase gene; murC2, UDP-N-acetylmuramyl tripeptide synthetase gene; murD, UDP-N-acetylmuramoyl-L-alanyl-D-glutamate synthetase gene; murE, UDP-N-acetylmuramoyl-L-alanyl-D-glutamate-L-lysine ligase gene; alr, alanine racemase gene; ddI, D-alanine-D-alanine ligase gene; murI, glutamate racemase gene; murF, UDP-N-acetylmuramoyl-tripeptide—D-alanyl-D-alanine ligase gene; bacA, undecaprenyl pyrophosphate phosphatase gene; mraY, phospho-N-acetylmuramoyl-pentapeptide-transferase gene; murG, undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase gene; murM, UDP-N-acetylmuramoylpentapeptide-lysine N6-alanyltransferase gene; murN, alanine adding enzyme gene; pbp1a, penicillin binding protein 1a gene; pbp1b, penicillin binding protein 1b gene; pbp2a, penicillin binding protein 2a gene; pbp2b, penicillin binding protein 2b gene; pbp2X, penicillin binding protein 2× gene; dacA, serine-type D-Ala-D-Ala carboxypeptidase (DD-transpeptidase, DacA) gene; 16S rDNA, 16S ribosomal RNA gene. First-strand cDNAs synthesis was performed with 4 μg of total RNA, random hexamers, and an AccuPower ® RocketScript™ RT PreMix (Bioneer Co., Deajeon, Korea) using the Exicycler™ 96 Real-Time Quantitative Thermal Block (Bioneer Co.) and following the manufacturer's protocol. qPCR was performed with the AccuPower® GreenStar™ qPCR PreMix (Bioneer Co.) using the Exicycler™ 96 Real-Time Quantitative Thermal Block. Each PCR reaction was performed in a total volume of 20 μL containing 1 μL each of the forward and reverse primers (final concentration, 500 nM each), 0.63 μL cDNA, and the appropriate dose of sterilized DNase-RNase-free water in PreMix PCR tubes. The qPCR conditions were initial denaturation at 95 °C for 3 min, 40 cycles of denaturation at 95 °C for 15 sec, primer annealing and extension at 55 °C for 15 sec, and final cooling at 25 °C for 1 min. Each qPCR reaction was performed in triplicate. The expression levels of each target gene in the group were normalized with those of 16S rDNA. The normalized expression of each gene (N) was determined as: Relative expression of the target genes between each experimental group (BA, OA, or UA) and the negative control group (1% DMSO) was calculated as [N of each experimental group (BA, OA, or UA)/N of the negative control group]. Data are expressed as mean ± standard deviation. Independent sample two-tailed t-tests were conducted to calculate the p-values using SPSS version 12 software (SPSS Inc., USA). A p-value ≤ 0.05 was considered statistically significant. We determined the BA, OA, and UA concentration of 64 μg/mL by investigating the antimicrobial mechanism against S. mutans UA159 by calculating the growth curve at 16, 32, and 64 μg/mL BA, OA, and UA for 60, 90, 120, and 180 min in S. mutans UA159 at the mid-log phase (OD600 = 0.35). The growth of S. mutans UA159 was in a static (inhibited) state at concentrations of 64 and 32 μg/mL of OA and UA, but in the exponential state at concentrations of 64 and 32 μg/mL in the BA-treated and control groups (data not shown). We decided to further explore using 64 μg/mL BA, OA, and UA. The synthesis of UDP-N-acetylglucosamine (UDP-GlcNAc) and UDP-N-actetylmuramic acid (UDP-MurNAc), the building blocks of peptidoglycan, is the first phase of first stage (stage I) of intracellular peptidoglycan assembly (Bugg and Walsh, 1992). UDP-GlcNAc is synthesized from GlcNAc-1-P by UDP-N-acetylglucosamine pyrophosphorylase (GlmU). UDP-MurNAc is synthesized from UDP-GlcNAc by UDP-N-acetylglucosamine 1-carboxyvinyltransferase (MurA) and UDP-N-acetylenolpyruvoylglucosamine reductase (MurB) (Bugg and Walsh, 1992). The data showed that UA and OA, but not BA, significantly downregulated glmU, murA, and murB expression (Figure 1A). Interestingly, glmU was overexpressed by a factor of two in the BA-treated group compared to that in the control group. The second phase of stage I of peptidoglycan biosynthesis is the assembly of the UDP-MurNAc-pentapeptide (Bugg and Walsh, 1992). The D-amino acids, D-alanine, D-glutamate, and DL-diaminopimelate, occur in peptidoglycan (Bugg and Walsh, 1992). For S. mutans UA159, D-alanine and D-glutamate are catalyzed by alanine racemase (Alr) and glutamate racemase (MurI), respectively (the KEEG pathway). Biosynthesis of DL-diaminopimelate (DL-DAP) is catalyzed by DAP epimerase or meso-DAP D-dehydrogenase (Bugg and Walsh, 1992). These genes are missing in S. mutans UA159, even though UDP-N-acetylmuramyl tripeptide synthetase (MurC2) which catalyzes adding DL-DAP to UDP-MurNAc-L-alanine-D-glutamate occurs (KEEG Pathway). The reason for the discrepancy is unclear, but it is possible that DL-DAP is synthesized through an unknown pathway or that DL-DAP is not used in peptidoglycan synthesis in S. mutans UA159. Generally, DL-DAP is added as the third residue in the pentapeptide of Gram-negative bacteria and some Gram-positive bacteria, whereas lysine is added in other Gram-positive bacteria (http://www.enzyme-database.org/reaction/polysacc/PepGly1.html). Using these D-amino acids and D-Ala-D-Ala formed by D-alanine-D-alanine ligase (DdI), two types of UDP-MurNAc-pentapeptide, UDP-MurNAc-L-Ala-γ-D-Glu-DL-DAP-D-Ala-D-Ala (UDP-MurNAc-pentapeptide I) and UDP-MurNAc-L-Ala-γ-D-Glu-DL-DAP-D-Ala-D-Ala (UDP-MurNAc-pentapeptide II) are synthesized by UDP-N-acetyl muramate-alanine ligase (MurC), UDP-N-acetylmuramoyl-L-alanyl-D-glutamate synthetase (MurD), MurC2 or UDP-N-acetylmuramoyl-L-alanyl-D-glutamate-L-lysine ligase (MurE), and UDP-N-acetylmuramoyl-tripeptide-D-alanyl-D-alanine ligase (MurF) (the KEGG Pathway). The data showed that second stage-related genes were downregulated by OA and UA, but murE was downregulated only by BA (Figure 1A). These results reveal that OA and UA inhibited expression from the first stages of S. mutans UA159 peptidoglycan biosynthesis, whereas BA induced overexpression of UDP-GlcNAc, the first substrate for peptidoglycan synthesis.
Figure 1

Relative expression of genes related to peptidoglycan biosynthesis, (A) stage I and (B) stage II and III, in Streptococcus mutans UA159 following treatment with betulinic acid (BA), oleanolic acid (OA), or ursolic acid (UA). glmU, UDP-N-acetylglucosamine pyrophosphorylase; murA, UDP-N-acetylglucosamine 1-carboxyvinyltransferase; murB, UDP-N-acetylenolpyruvoylglucosamine reductase; murC, UDP-N-acetyl muramate-alanine ligase; murC2, UDP-N-acetylmuramyl tripeptide synthetase; murD, UDP-N-acetylmuramoyl-L-alanyl-D-glutamate synthetase; murE, UDP-N-acetylmuramoyl-L-alanyl-D-glutamate-L-lysine ligase; alr, alanine racemase; ddI, D-alanine-D-alanine ligase; murI, glutamate racemase; murF, UDP-N-acetylmuramoyl-tripeptide—D-alanyl-D-alanine ligase; bacA, undecaprenyl pyrophosphate phosphatase; mraY, phospho-N-acetylmuramoyl-pentapeptide-transferase; murG, undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase; murM, UDP-N-acetylmuramoylpentapeptide-lysine N6-alanyltransferase; murN, alanine adding enzyme; pbp1a, penicillin binding protein 1a; pbp1b, penicillin binding protein 1b; pbp2a, penicillin binding protein 2a; pbp2b, penicillin binding protein 2b; pbp2x, penicillin binding protein 2x, dacA, serine-type D-Ala-D-Ala carboxypeptidase (DD-transpeptidase, DacA). *p ≤ 0.05, significantly downregulated or upregulated compared with the control group.

The second stage (stage II) of peptidoglycan biosynthesis is transport of the MurNAc-pentapeptide portion of the UDP-MurNAc-pentapeptide across the cytoplasmic membrane by a undecaprenyl lipid carrier, undecaprenyl phosphate (UP), which is synthesized from undecaprenyl pyrophosphate (UPP) by undecaprenyl pyrophosphate phosphatase (BacA) (Higashi ; Bouhss ). The coupling of UDP-MurNAc-pentapeptide to UP to produce UPP-MurNAc-pentapeptide (Lipid I) and UMP is catalyzed by phospho-N-acetylmuramoyl-pentapeptide-transferase (MraY). Then, another glucosamine residue, GlcNAc, is attached to Lipid I by undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase (MurG) and forms UPP-MurNAc-(GlcNAc)-pentapeptide (Lipid II). 2 L-Alanine (L-Ala) is added to UDP-MurNAc-(GlcNAc)-L-Ala-γ-D-Glu-L-Lys-D-Ala-D-Ala by UDP-N-acetylmuramoylpentapeptide-lysine N6-alanyltransferase (MurM) and another alanine-adding enzyme (MurN) to form UDP-MurNAc-(GlcNAc)-L-Ala-γ-D-Glu-L-Lys-(L-Ala)2-D-Ala-D-Ala (the KEGG pathway). The data showed that OA and UA significantly inhibited expression of bacA, mraY, murG, murM, and murN and that BA also downregulated these genes, except murM and murN (Figure 1B). These findings reveal that OA, UA, and BA inhibited translocation of the MurNAc-pentapeptide, an intermediate or monomer of peptidoglycan in the cell wall. The last stage (stage III) of peptidoglycan biosynthesis is transglycosylation, transpeptidation, and trimming of the peptidoglycan, which are catalyzed by penicillin-binding proteins (PBPs) and transpeptidase (Pinho ; Lee ; Mainardi ; Fan ). S. mutans UA159 has five PBPs such as PBP1a, PBP1b, PBP2a, PBP2b, and PBP2X, as well as serine-type D-Ala-D-Ala carboxypeptidase (DacA), which is involved in the last stage of peptidoglycan biosynthesis (the KEEG pathway). The data showed that these genes, except PBP1a and PBP1b, were downregulated 52–85% and 31–56% in the OA and UA groups compared to those in the control group. Our qPCR data showed that OA and UA significantly downregulated the PBP genes, except pbp1a and pbp1b, whereas BA significantly upregulated these genes, except pbp1b and pbp2a (Figure 1B). These results indicate that OA and UA inhibit polymerization between a newly synthesized peptidoglycan monomer and the existing peptidoglycan, and that BA increased polymerization in S. mutans UA159. In summary, OA and UA inhibited the expression of peptidoglycan biosynthesis-related genes of S. mutans UA159 at the transcriptional level which might be the one of the antimicrobial mechanism of OA and UA against S. mutans.
  10 in total

1.  A mechanism-based inhibitor targeting the DD-transpeptidase activity of bacterial penicillin-binding proteins.

Authors:  Mijoon Lee; Dusan Hesek; Maxim Suvorov; Wenlin Lee; Sergei Vakulenko; Shahriar Mobashery
Journal:  J Am Chem Soc       Date:  2003-12-31       Impact factor: 15.419

Review 2.  Intracellular steps of bacterial cell wall peptidoglycan biosynthesis: enzymology, antibiotics, and antibiotic resistance.

Authors:  T D Bugg; C T Walsh
Journal:  Nat Prod Rep       Date:  1992-06       Impact factor: 13.423

3.  Biosynthesis of the peptidoglycan of bacterial cell walls. XXI. Isolation of free C55-isoprenoid alcohol and of lipid intermediates in peptidoglycan synthesis from Staphylococcus aureus.

Authors:  Y Higashi; J L Strominger; C C Sweeley
Journal:  J Biol Chem       Date:  1970-07-25       Impact factor: 5.157

4.  A novel peptidoglycan cross-linking enzyme for a beta-lactam-resistant transpeptidation pathway.

Authors:  Jean-Luc Mainardi; Martine Fourgeaud; Jean-Emmanuel Hugonnet; Lionel Dubost; Jean-Paul Brouard; Jamal Ouazzani; Louis B Rice; Laurent Gutmann; Michel Arthur
Journal:  J Biol Chem       Date:  2005-09-06       Impact factor: 5.157

5.  Complementation of the essential peptidoglycan transpeptidase function of penicillin-binding protein 2 (PBP2) by the drug resistance protein PBP2A in Staphylococcus aureus.

Authors:  M G Pinho; S R Filipe; H de Lencastre; A Tomasz
Journal:  J Bacteriol       Date:  2001-11       Impact factor: 3.490

Review 6.  Pharmacology of oleanolic acid and ursolic acid.

Authors:  J Liu
Journal:  J Ethnopharmacol       Date:  1995-12-01       Impact factor: 4.360

7.  Diversity of penicillin-binding proteins. Resistance factor FmtA of Staphylococcus aureus.

Authors:  Xin Fan; Yuhong Liu; Daryl Smith; Lars Konermann; K W Michael Siu; Dasantila Golemi-Kotra
Journal:  J Biol Chem       Date:  2007-10-09       Impact factor: 5.157

8.  Ursolic, oleanolic and betulinic acids: antibacterial spectra and selectivity indexes.

Authors:  Stéphane Fontanay; Marion Grare; Joséphine Mayer; Chantal Finance; Raphaël Emmanuel Duval
Journal:  J Ethnopharmacol       Date:  2008-09-12       Impact factor: 4.360

Review 9.  The biosynthesis of peptidoglycan lipid-linked intermediates.

Authors:  Ahmed Bouhss; Amy E Trunkfield; Timothy D H Bugg; Dominique Mengin-Lecreulx
Journal:  FEMS Microbiol Rev       Date:  2007-12-10       Impact factor: 16.408

10.  Antimicrobial activity of oleanolic acid from Salvia officinalis and related compounds on vancomycin-resistant enterococci (VRE).

Authors:  Kumiko Horiuchi; Sumiko Shiota; Tsutomu Hatano; Takashi Yoshida; Teruo Kuroda; Tomofusa Tsuchiya
Journal:  Biol Pharm Bull       Date:  2007-06       Impact factor: 2.233

  10 in total
  5 in total

1.  Antimicrobial Mechanism of Oleanolic and Ursolic Acids on Streptococcus mutans UA159.

Authors:  Soon-Nang Park; Yun Kyong Lim; Mi-Hwa Choi; Eugene Cho; Iel Soo Bang; Jung Min Kim; Sug-Joon Ahn; Joong-Ki Kook
Journal:  Curr Microbiol       Date:  2017-08-29       Impact factor: 2.188

2.  Proteomic Characterization and Target Identification Against Streptococcus mutans Under Bacitracin Stress Conditions Using LC-MS and Subtractive Proteomics.

Authors:  Sahar Zaidi; Tulika Bhardwaj; Pallavi Somvanshi; Asad U Khan
Journal:  Protein J       Date:  2022-01-06       Impact factor: 4.000

3.  The Synergistic Effect of Triterpenoids and Flavonoids-New Approaches for Treating Bacterial Infections?

Authors:  Natalia Wrońska; Michał Szlaur; Katarzyna Zawadzka; Katarzyna Lisowska
Journal:  Molecules       Date:  2022-01-27       Impact factor: 4.411

4.  Does Secondary Plant Metabolite Ursolic Acid Exhibit Antibacterial Activity against Uropathogenic Escherichia coli Living in Single- and Multispecies Biofilms?

Authors:  Zuzanna Sycz; Dorota Wojnicz; Dorota Tichaczek-Goska
Journal:  Pharmaceutics       Date:  2022-08-14       Impact factor: 6.525

Review 5.  Anti-Planktonic and Anti-Biofilm Properties of Pentacyclic Triterpenes-Asiatic Acid and Ursolic Acid as Promising Antibacterial Future Pharmaceuticals.

Authors:  Zuzanna Sycz; Dorota Tichaczek-Goska; Dorota Wojnicz
Journal:  Biomolecules       Date:  2022-01-07
  5 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.