Sejeong Kim1, Yohan Yoon1, Kyoung-Hee Choi2. 1. Department of Food and Nutrition, Sookmyung Women's University, Seoul, Korea. 2. Department of Oral Microbiology, College of Dentistry, Wonkwang University, Iksan, Korea.
Abstract
Pseudomonas aeruginosa is a pathogen that can cause serious infections and usually coexists with other pathogens, such as Staphylococcus aureus. Virulence factors are important for maintaining a presence of the organisms in these multispecies environments, and DesB plays an important role in P. aeruginosa virulence. Therefore, we investigated the effect of DesB on S. aureus reduction under competitive situation. Liquid cultures of P. aeruginosa wild type (WT) and its desB mutant were spotted on agar plates containing S. aureus, and the size of the clear zones was compared. In addition, interbacterial competition between P. aeruginosa and S. aureus was observed over time during planktonic coculture. The transcriptional profiles of the WT and desB mutant were compared by qRT-PCR and microarray to determine the role of DesB in S. aureus reduction at the molecular level. As a result, the clear zone was smaller for the desB mutant than for P. aeruginosa PAO1 (WT), and in planktonic coculture, the number of S. aureus cells was reduced in the desB mutant. qRT-PCR and microarray revealed that the expression of MvfR-controlled pqsA-E and phnAB operons was significantly decreased, but the mexEF-oprN operon was highly expressed. The results indicate that intracellular levels of 4-hydroxy-2-heptylquinoline (HHQ), a ligand of MvfR, are reduced due to MexEF-OprN-mediated efflux in desB mutant, resulting in the decrease of MvfR binding to pqsA-E promoter and the reduction of 4-hydroxy-2-alkylquinolines (HAQs) synthesis. Overexpression of mexEF-oprN operon in desB mutant was phenotypically confirmed by observing significantly increased resistance to chloramphenicol. In conclusion, these results suggest that DesB plays a role in the inhibition of S. aureus growth by controlling HAQ synthesis.
Pseudomonas aeruginosa is a pathogen that can cause serious infections and usually coexists with other pathogens, such as Staphylococcus aureus. Virulence factors are important for maintaining a presence of the organisms in these multispecies environments, and DesB plays an important role in P. aeruginosa virulence. Therefore, we investigated the effect of DesB on S. aureus reduction under competitive situation. Liquid cultures of P. aeruginosa wild type (WT) and its desB mutant were spotted on agar plates containing S. aureus, and the size of the clear zones was compared. In addition, interbacterial competition between P. aeruginosa and S. aureus was observed over time during planktonic coculture. The transcriptional profiles of the WT and desB mutant were compared by qRT-PCR and microarray to determine the role of DesB in S. aureus reduction at the molecular level. As a result, the clear zone was smaller for the desB mutant than for P. aeruginosa PAO1 (WT), and in planktonic coculture, the number of S. aureus cells was reduced in the desB mutant. qRT-PCR and microarray revealed that the expression of MvfR-controlled pqsA-E and phnAB operons was significantly decreased, but the mexEF-oprN operon was highly expressed. The results indicate that intracellular levels of 4-hydroxy-2-heptylquinoline (HHQ), a ligand of MvfR, are reduced due to MexEF-OprN-mediated efflux in desB mutant, resulting in the decrease of MvfR binding to pqsA-E promoter and the reduction of 4-hydroxy-2-alkylquinolines (HAQs) synthesis. Overexpression of mexEF-oprN operon in desB mutant was phenotypically confirmed by observing significantly increased resistance to chloramphenicol. In conclusion, these results suggest that DesB plays a role in the inhibition of S. aureus growth by controlling HAQ synthesis.
The gram-negative opportunistic pathogen Pseudomonas aeruginosa is a causative agent of nosocomial and life-threatening infections in injured, burned, and immunocompromised patients [1]. This human pathogen produces multiple extracellular factors, such as elastases, proteases, and rhamnolipids that break down host proteins, such as elastin and collagen, as well as phospholipids in the lungs, which consequently impair host tissue function [2]. In addition, the pathogen releases a variety of virulence factors, such as exotoxins, pyocyanin, proteases, hemolysins, and quorum sensing (QS) molecules, such as pseudomonasquinolone signal (PQS) to infect host cells or outcompete other microorganisms in mixed microbial communities [3,4,5].In clinical settings, most microbes exist primarily in polymicrobial communities, which affect interspecies interaction and alter clinical outcomes. Bacterial pathogens such as Staphylococcus aureus and Candida albicans are commonly isolated from clinical samples along with P. aeruginosa [6,7,8]. In polymicrobial infections involving P. aeruginosa, synergistic, mutual interactions that contribute to disease pathogenesis are frequently observed. Microbes in mixed communities are capable of enhancing their own growth, virulence, and persistence [6]. Therefore, studies with single-species-based analysis are not relevant to clinical conditions. Mixed infections with P. aeruginosa and S. aureus are more virulent than single-species infections, cause more severe disease, and are frequently associated with chronic wound and lung infections [6,9,10]. Nevertheless, in this ecological niche, the relationship between P. aeruginosa and S. aureus is competitive rather than cooperative. P. aeruginosa secretes toxic substances, such as alkyl-hydroxyquinoline N-oxides, hydrogen cyanide, and pyocyanin, that impede the proliferation of S. aureus [6,11]. In addition, P. aeruginosa strains that produce LasA endopeptidase induce the lysis of S. aureus by cleaving specific bonds in its peptidoglycan, further promoting P. aeruginosa growth [12]. During in vivo coculture, lysed S. aureus cells provide useable iron for P. aeruginosa growth under low-iron conditions [13]. In addition, peptidoglycan released from S. aureus can stimulate the production of several virulence factors, including pyocyanin and elastase, by P. aeruginosa and enhances its virulence in a Drosophila infection model [14]. Therefore, in a polymicrobial community, P. aeruginosa exhibits increased virulence in the presence of S. aureus.However, the growth of S. aureus is not completely inhibited by P. aeruginosa. S. aureus has defense mechanisms that help the organism outcompete P. aeruginosa in the same infection; thus, it coexists as a persister [15]. For example, 4-hydroxy-2-heptylquinoline-N-oxide (HQNO) produced by P. aeruginosa inhibits the growth of S. aureus strains, and leads to the development of small-colony variants (SCVs) that are resistant to antibiotics and contribute to bacterial persistence [16,17].Virulence factor production by P. aeruginosa is extremely important for growth and pathogenesis in multispecies environments. Our previous studies demonstrated that P. aeruginosaDesB, an aerobic desaturase, plays an important role in virulence [18]. A mutant harboring a transposon insertion in the desB gene exhibited significantly reduced production of various exoproducts, including pyocyanin, protease, elastase, and rhamnolipids, as well as decreased motility [18]. In addition, a Caenorhabditis elegans infection study demonstrated that DesB is involved in virulence [18]. Similarly, a study using transposon site hybridization (TraSH) method in a mouse infection model showed that Mycobacterium bovis DesA3, a membrane-bound aerobic desaturase, is also necessary for survival and pathogenesis [19]. However, the role of DesB in interspecies interactions during coculture with other pathogens has not yet been studied.Therefore, in this study, we aimed to determine if DesB plays a role in the relationship between P. aeruginosa and S. aureus during coculture, and if so, what role does it play.
Materials and Methods
Bacterial strains and culture conditions
The bacterial strains used in this study are listed in Table 1. All bacterial strains were kind gift. Among these strains, desA, desT, and fabA mutants are P. aeruginosaPAOl harboring each truncated gene, and desB mutant harbors an insertion of an ISlacZ/hah transposon in desB gene. The strains were routinely maintained on Luria-Bertani medium (LB; 10 g/L tryptone, 5 g/L yeast extract, 10 g/L NaCl; Difco) and grown at 37°C.
S. aureus was incubated in LB broth at 37°C for 18h. This overnight culture was then diluted to 1:25 with fresh LB broth and incubated to mid-log growth phase. An aliquot of this subculture then was mixed with 2 mL of LB medium containing 0.8% agar to an optical density at 600 nm (OD600) of 0.2. After allowing the plate to solidify, 3 μL of an overnight culture of P. aeruginosa was spotted onto the plate, and it was incubated at 37°C for 24 h. After incubation, the plate was imaged using a universal digital camera.
Interspecies growth competition assay using planktonic cultures
The interbacterial competition assay was performed as described previously with minor modifications [22]. S. aureus and P. aeruginosa strains were streaked on LB agar plates and incubated at 37°C for 24 h. The next day, colonies of approximately the same size were selected from the plates, inoculated in 5 mL of LB broth, and incubated for 18 h. The overnight cultures were washed with 1 mL of PBS and resuspended to an OD600 of 1.0 and 2.5 for P. aeruginosa and S. aureus, respectively. P. aeruginosa and S. aureus were mixed at 1:1 (vol/vol). A 10-μL aliquot of the mixture was spotted on a cellulose acetate filter disc and placed on the LB agar plate, which was incubated at 37°C. The growth of individual bacterial species was analyzed by resuspending the filter disc in 0.5 mL of PBS and plating the suspension on Cetrimide agar (CA; Sigma, St. Louis, MO, USA) plates for P. aeruginosa and on Mannitol saltagar (MSA; Difco) plates for S. aureus.
P. aeruginosa strains were grown overnight (18 h) and subcultured in 5 mL of sterile LB broth to log phase (OD600 0.7–1.0). The culture was diluted with LB broth to OD600 0.1. Then, 100 μL aliquots of serial two-fold dilutions of chloramphenicol in LB broth were prepared in a 96-well plate at final concentrations of 0–512 μg/mL, and an equal volume of bacterial culture (at OD600 0.1) was added. After a 24-h incubation, inhibition of P. aeruginosa growth was assessed by measuring the OD600 using a microplate reader (Bio Tek Instruments, Inc., Winooski, VT, USA). The MIC was defined as the concentration at which was no growth was observed.
Serial dilution spotting assay
P. aeruginosa strains were cultured in LB broth at 37°C for 18 h, and then the overnight culture (approximately density: 108 CFU/mL) was serially diluted (10-fold, 100−106 CFU/mL) in PBS. 2 μL of the diluents was vertically spotted on LB agar containing 0, 8, 16, 32, 64, or 128 μg/mL chloramphenicol. After 24 h of incubation at 37°C, spot formation was assessed, and the chloramphenicol resistance of the WT and desB mutant strain was compared.
Quantitative RT-PCR (qRT-PCR)
P. aeruginosa colonies freshly grown on LB agar plates were inoculated into 5 mL of LB broth and incubated at 37°C for 18 h. These overnight cultures were diluted 1:25 in fresh LB broth, and grown to an OD600 of 0.4–0.5. Total RNA was extracted from 1 mL cultures of P. aeruginosa strains using the Qiagen RNase mini kit (Qiagen, Hilden, Germany) according to the manufacturer’s instructions. Then, one U of RNase-free DNase I (Invitrogen, CA, USA) was added to one μg of extracted total RNA, and the reaction mixture was incubated for 15 min at room temperature. Next, the enzyme was inactivated by adding 1 μL of 25 mM EDTA, and heating the mixture at 65°C for 10 min. cDNA was synthesized from the RNA using the Superscript III first-strand synthesis system (Invitrogen). The PCR reaction mixture (20 μL) contained 10 μL of VeriQuest SYBR Green qPCR master mix (USB, Affymetrix), 1 μL of 10 μM forward primer, 1 μL of 10 μM reverse primer, 2 μL of cDNA, and 6 μL of sterile distilled water. The reaction mixtures were denatured by incubation at 95°C for 10 min, which was followed by 35 cycles of 95°C for 15 s and at 60°C for 1 min. The target genes mvfR, pqsA, mexE, mexF, mesT, and oprN were amplified using the designed primers listed in Table 2. The constitutively expressed housekeeping gene rpoD was used to normalize gene expression. The relative expression of the genes was obtained from the calculated Ct values.
Table 2
Primers used for qRT PCR.
Gene (Product size)
Primer name
Sequence (5ʹ-3ʹ)
pqsA (71 bp)
pqsA-F
CTGGACGACAACCAGATCCT
pqsA-R
ATGTGCGAGGGAATCTGTTC
mvfR (96 bp)
mvfR-F
CGTACTGCTCGACGATTTCA
mvfR-R
ATATCGATTTCCGCGTTGTC
mexE (88 bp)
mexE-F
CACCCTGATCAAGGACGAAG
mexE-R
GCGGTAGACGGTCTTGTTGT
mexF (100 bp)
mexF-F
TCTACGACCCGACCATCTTC
mexF-R
AGGAACAGGATCACCACCAG
mexT (80 bp)
mexT-F
GCCGCGCCAACTATCTATT
mexT-R
CAGTTCGTCGGTGTAGCTGA
oprN (87 bp)
oprN-F
GCAACCTGGAGAACCAGAAG
oprN-R
CGCGCAGTACGTCGAGTT
rpoD (75 bp)
rpoD-F
CTGCAATTCCTCGACCTGAT
rpoD-R
GCGACGGTATTCGAACTTGT
Microarray analysis
Total RNA was prepared from the P. aeruginosa strains using the same as procedure as described for qRT-PCR, except that a greater volume of culture was used. The quality of the purified RNA was confirmed using an Agilent 2100 Bioanalyzer System. cDNA was generated and labeled using the Bioprime labeling kit (Invitrogen), and the microarray hybridization was performed using Hybridization solution (MYcroarray.com). The microarray data were normalized and analyzed using Genowiz 4.0 (Ocimum Biosolutions, India). Total 5544 genes were analyzed, and among these, the comparative transcriptional profile of HAQ-related genes between WT and desB mutant was used for data interpretation.
Statistical analysis
Interspecies growth competition assay was repeated with two samples in each repeat, and MIC assay was repeated with six samples in each repeat. The bacterial cell counts (log CFU mL-1) and OD values at several timepoints or chloramphenicol concentrations were analysed by the mixed model procedure (SAS Institute, Cary, NC, USA). Pairwise t-tests were performed for comparisons of least squares means among the interactions at alpha = 0.05. All experiments except for microarray analysis were performed in replicate, but microarray data were confirmed by qRT-PCR.
Results and Discussion
DesB is involved in S. aureus reduction
Other microbes are usually detected in P. aeruginosa infections. It was previously shown that P. aeruginosa lyses S. aureus during coculture [23]. P. aeruginosa and S. aureus affect each other, and interspecies communication is required for the expression of various virulence factors [24]. Certain virulence factors obstruct the proliferation of S. aureus by lysis or growth inhibition. Schweizer and Choi [18] found that DesB, an aerobic desaturase expressed by P. aeruginosa, is closely associated with the production of virulence factors, particularly elastase, rhamnolipids, and pyocyanin. Therefore, we hypothesized that DesB also plays a role in S. aureus reduction under mixed culture conditions. Accordingly, we conducted comparative analyses of the virulence of WT and desB mutant strains during coculture with S. aureus. In addition to desB, genes involved in unsaturated fatty acids (UFAs) synthesis, such as desA, desT, and fabA was also evaluated in order to investigate if UFA synthesis is involved in S. aureus reduction. In the spot assay, the desB mutant showed clear zones with smaller diameters than those surrounding the WT strain (Fig 1), whereas the desA (phospholipid acyl desaturase) and desT (TetR family transcriptional regulator) mutants showed clear zones of similar diameter to those surrounding the WT strain. In addition, the fabA mutant showed slightly lower activity of cell number decrease than the WT strain, and the fabA desB double mutant showed no S. aureus reduction (Fig 1). The P. aeruginosa fabA gene encodes β-hydroxydecanoyl-ACP dehydrase, which is involved in fatty acid synthesis under aerobic and anaerobic conditions [25]. In our previous study, we found that the fabA mutant used in the present study has a very low growth rate compared to other mutants, including desA, desB, and desT mutants [21]. Therefore, the decreased S. aureus reduction ability of the fabA mutant, and the zero-activity of the fabAdesB double mutant are not due to a deficiency of FabA activity but result from the slow-growth phenotype of the fabA mutant. This result indicates that DesB is an important factor for S. aureus reduction.
Fig 1
Spot assay for Staphylococcus aureus reduction.
Overnight cultures of Pseudomonas aeruginosa PAO1 strains (wild type [1] and various mutants ΔdesT [2], ΔdesA [3], desB [4], ΔfabA [5], and ΔfabA desB [6]) were spotted onto an LB agar plate containing Staphylococcus aureus ATCC25923. After incubation at 37°C for 24 h, the diameter of the clear zone was measured.
Spot assay for Staphylococcus aureus reduction.
Overnight cultures of Pseudomonas aeruginosa PAO1 strains (wild type [1] and various mutants ΔdesT [2], ΔdesA [3], desB [4], ΔfabA [5], and ΔfabA desB [6]) were spotted onto an LB agar plate containing Staphylococcus aureus ATCC25923. After incubation at 37°C for 24 h, the diameter of the clear zone was measured.Furthermore, a time-course growth competition assay between P. aeruginosa and S. aureus was conducted to confirm the deficiency phenotype of S. aureus reduction in the desB mutant in planktonic culture. Mutation of the desB gene did not influence the growth of P. aeruginosa; however, it did affect the extent of S. aureus reduction in coculture (Fig 2). The total S. aureus cell count decreased after 10 h of coculture with the WT strain, whereas a decrease in the number of S. aureus cells was observed after 12 h of coculture with the desB mutant strain, suggesting that S. aureus reduction by the desB mutant was retarded due to the lack of functional DesB. In addition, a greater number of S. aureus cells were maintained in a coculture with the desB mutant than in a coculture with WT over the same incubation period. However, comparatively smaller difference between two strains was observed at the 24 h timepoint than at the 10 h and 12 h timepoints. It can be inferred that the phenotype of desB mutant at this timepoint was attributed to delayed production of lysis- or growth inhibition-associated virulence factors.
Fig 2
Interspecies growth competition assay.
Mixtures of P. aeruginosa (PA) wild type (WT) or desB mutant (desB) strains and S. aureus (SA) were spotted on a cellulose acetate filter disc and placed on an LB agar plate. During incubation, the growth of the individual bacterial species was analyzed by resuspending the filter disc in 0.5 mL of PBS and plating the suspension on selective agar. Means with (*) are significantly different (P < 0.05) in same timepoint.
Interspecies growth competition assay.
Mixtures of P. aeruginosa (PA) wild type (WT) or desB mutant (desB) strains and S. aureus (SA) were spotted on a cellulose acetate filter disc and placed on an LB agar plate. During incubation, the growth of the individual bacterial species was analyzed by resuspending the filter disc in 0.5 mL of PBS and plating the suspension on selective agar. Means with (*) are significantly different (P < 0.05) in same timepoint.Also, it may be possible that S. aureus responds to WT or desB mutant in terms of SCV formation in S. aureus under coculture condition. Pyocyanin stimulates SCV selection in S. aureus and the SCVs appeared after 24h of cocultivation [11]. Since desB mutant displayed reduced pyocyanin production [18], SCVs may be formed less in desB mutant than in WT. However, SCVs were not found in this study because coculture experiment was conducted until 24 h of coculture.This indicated that P. aeruginosaDesB is involved in S. aureus reduction. P. aeruginosa produces various extracellular antimicrobial substances associated with a decrease in S. aureus cell number that are mostly regulated by the pqsA-E operon [26-28]. In addition, P. aeruginosa secretesLasA protease, which lyses S. aureus, and transcription of the lasA gene is controlled by LasR [23,29]. Thus, we assumed that the reduction of S. aureus cells may result from correlation between DesB and production of these factors. However, it should be pointed out that the desB mutant retains some reduction ability. This finding could be explained by the presence of DesB-independent factors that participate in S. aureus reduction even in the absence of DesB activity [14,27,30]. It was discussed more detailedly later in this paper.
DesB positively regulates the transcription of the MvfR-regulated genes pqs and phn
qRT-PCR and microarray analyses were conducted to determine the possible molecular mechanism underlying DesB-involved S. aureus reduction. Mashburn et al. [13] reported that a P. aeruginosapqsA mutant exhibited reduced S. aureus lysis during coculture, indicating that PqsA or anthranilate-coenzyme A ligase [31] is essential for complete S. aureus lytic activity. Thus, we investigated the possibility of a correlation between desB and two other genes, pqsA and its regulator mvfR. The results showed that in the desB mutant, the transcription of mvfR was slightly reduced, whereas pqsA expression was reduced approximately 50-fold compared to the levels in WT (Fig 3). This result suggested that DesB plays a significant role in P. aeruginosa-catalyzed S. aureus reduction in mixed culture by controlling pqsA gene expression. PqsA is required for HAQ synthesis, which regulates the production of the cell-to-cell communication factors and virulence factors of P. aeruginosa, including elastase and pyocyanin [32,33]. However, from this result, we could not predict how DesB regulates pqsA expression at the molecular level. Consequently, a microarray analysis was performed to elucidate the molecular mechanism underlying DesB-related S. aureus reduction. Based on the fact that DesB controls pqsA, transcriptional levels of HAQ-related genes including QS genes in WT and desB mutant were compared.
Fig 3
qRT-PCR analysis.
Total RNA was extracted from 1 mL of the wild type (WT) and desB mutant (desB) P. aeruginosa PAO1 strains grown until an OD600 of 0.4–0.5, and then cDNA was synthesized. The relative gene expression of mvfR, pqsA, mexE, mexF, mexT, and oprN in WT and desB was compared by qRT-PCR. The results are expressed as the fold-change of the relative gene expression in desB compared to that in WT.
qRT-PCR analysis.
Total RNA was extracted from 1 mL of the wild type (WT) and desB mutant (desB) P. aeruginosa PAO1 strains grown until an OD600 of 0.4–0.5, and then cDNA was synthesized. The relative gene expression of mvfR, pqsA, mexE, mexF, mexT, and oprN in WT and desB was compared by qRT-PCR. The results are expressed as the fold-change of the relative gene expression in desB compared to that in WT.The expression patterns of pqsA and mvfR in the qRT-PCR analysis were also consistent with microarray data (Table 3). The levels of all the pqs genes, including pqsA, were significantly reduced in the desB mutant, whereas the expression levels of two other S. aureus lysis-related genes, lasA (encoding LasA protease) and lasR (required for lasA transcription) in the desB mutant and WT strains were similar.
Table 3
Selected microarray analytical data to compare the expression of HAQ-related genes in WT and desB mutant.
desB /WT 1
Name
Product
Locus_tag
S. aureus lysis
1.1
lasR
Transcriptional regulator LasR
PA1430
1.0
lasA
LasA protease precursor
PA1871
Anthranilate synthesis
-1.4
trpE
Anthranilate synthetase component I
PA0609
1.0
trpG
Anthranilate synthase component II
PA0649
-17.5
phnA
Anthranilate synthase component I
PA1001
-6.5
phnB
Anthranilate synthase component II
PA1002
1.0
kynU
Hypothetical protein
PA2080
-1.2
kynB
Kynurenine formamidase, KynB
PA2081
1.6
kynA
Hypothetical protein
PA2579
QS-regulatory systems
-1.1
vfr
Transcriptional regulator Vfr
PA0652
1.1
lasR
Transcriptional regulator LasR
PA1430
-1.6
rsaL
Regulatory protein RsaL
PA1431
1.2
lasI
Autoinducer synthesis protein LasI
PA1432
1.5
qscR
Quorum-sensing control repressor
PA1898
-1.1
gacA
Response regulator GacA
PA2586
-3.0
rhlI
Autoinducer synthesis protein RhlI
PA3476
-1.8
rhlR
Transcriptional regulator RhlR
PA3477
-8.82
pqsA
Probable coenzyme A ligase
PA0996
-6.9
pqsB
Homologous to beta-keto-acyl-acyl-carrier
PA0997
-10.5
pqsC
Homologous to beta-keto-acyl-acyl-carrier
PA0998
-6.2
pqsD
3-oxoacyl-[acyl-carrier-protein] synthase III
PA0999
-5.8
pqsE
Quinolone signal response protein
PA1000
-17.5
phnA
Anthranilate synthase component I
PA1001
-6.5
phnB
Anthranilate synthase component II
PA1002
-1.2
mvfR
Transcriptional regulator
PA1003
-1.8
pqsH
Probable FAD-dependent monooxygenase
PA2587
Efflux pump
10.8
mexS
Probable oxidoreductase
PA2491
1.2
mexT
Transcriptional regulator MexT
PA2492
61.4
mexE
Resistance-nodulation-cell division (RND)
PA2493
1.6
mexF
Resistance-nodulation-cell division (RND)
PA2494
9.0
oprN
Multidrug efflux outer membrane protein OprN
PA2495
1 Fold change is reported as relative gene expression of desB mutant compared to WT (= 1).
2 The gene for more than 2-fold change in expression is bold.
1 Fold change is reported as relative gene expression of desB mutant compared to WT (= 1).2 The gene for more than 2-fold change in expression is bold.Recently, Beaume et al [34] reported that lasA is involved in S. aureus lysis, whereas pqs is responsible for S. aureus growth inhibition rather than lysis. Therefore, this indicates that desB mutant have reduced ability in S. aureus growth inhibition by a considerable decrease in pqs expression. Also, microarray analysis revealed that LasA plays a role in S. aureus lysis as a DesB-independent factor in the absence of functional DesB. In addition, Beaume et al. [34] demonstrated that a carB gene, involved in pyrimidine biosynthesis, is required for S. aureus growth inhibition without any influence on PQS synthesis. Thus, CarB also contributes to S. aureus growth inhibition in a DesB-independent manner [34].P. aeruginosa produces S. aureus growth inhibition-associated materials, such as 4-hydroxy-2-alkylquinolines (HAQs), which have antimicrobial activity. These HAQs include 4-hydroxy-2-heptylquinoline (HHQ), 4-hydroxy-2-nonylquinoline (HNQ), pseudomonasquinolone signal (PQS), and 4-hydroxy-2-heptylquinoline N-oxide (HQNO) [35]. Synthesis of these HAQs is mainly controlled by the P. aeruginosapqs system, which comprises pqsA-E and pqsH. PqsA-D catalyzes the synthesis of HHQ molecules, which are converted to PQS by PqsH. The pqsA-E genes are expressed under the control of the transcriptional regulator MvfR, whereas pqsH is regulated by LasR, but not by MvfR. Thus, the transcriptional pattern of pqsA-E is distinct from that of pqsH in the desB mutant. The PQS system is interlinked with two quorum-sensing systems, las and rhl [36]. MvfR, a regulator of the pqs system, is positively controlled by LasR and negatively regulated by RhlR [37]. Comparative transcriptional analysis showed that in the desB mutant, expression of the pqs operon was reduced, whereas the rhl and las QS genes were normally expressed, indicating that rhlR and lasR are not involved in the reduced pqs expression observed in the desB mutant. However, rhlI expression was reduced by desB mutation compared to the levels in WT. Since, according to McKnight et al. [38], rhlI expression is positively regulated by PQS, we could assume that the decreased rhlI transcription observed in the desB mutant may be attributed to reduced levels of PQS.In addition, expression of phnA and phnB in the desB mutant was significantly lower than that in WT. In addition to the pqs operon, transcription of the phnAB genes is also under the control of MvfR. The phnAB-encoded proteins are responsible for conversion of shikimic acid to anthranilate, which is continually used in HAQs synthesis catalyzed by PqsA-D. TrpE and TrpG also catalyze anthranilate synthesis from chorismic acid, and the anthranilate produced by this pathway is known to be utilized for either tryptophan or HAQ synthesis [39]. In addition to the PhnAB pathway, there is an alternative anthranilate synthesis pathway, called the kynurenine pathway, which consists of KynA, KynB, and KynU, and catalyzes the conversion of tryptophan to anthranilate. However, dissimilar to pqs expression, transcriptional expression of kynA, kynB, kynU, and trpEG was not reduced in the desB mutant. Consequently, the above results indicate that anthranilate synthesis is controlled by DesB, and that only MvfR-regulated phnAB expression is associated with this regulation (Table 3). Although pqsA-E and phnAB are co-regulated by MvfR [40], only a small difference in mvfR expression between the desB mutant and WT was observed in the microarray analysis. This phenomenon could be explained by MvfR activation. HHQ functions as a ligand for the LasR-type transcriptional regulator MvfR and enhances MvfR binding to the pqsA-E promoter [41], thereby activating the pqsABCDE and phnAB operons, which is followed by increased production of HAQs. Therefore, in the desB mutant, HHQ was not sufficient to stimulate MvfR binding to the promoter, even if mvfR was expressed at a similar level to that in the WT strain; thus, resulting in decreased MvfR-governed activation of the downstream pqs and phn genes in the desB mutant and reduced production of HAQs.In addition, the amounts of crude PQS produced by WT and desB mutant were indirectly measured by spot assay for S. aureus growth inhibition in order to compare PQS levels between two strains. As a result, extract of desB mutant exhibited the considerable decrease of S. aureus growth inhibition compared to the one of WT, meaning that desB mutant produced much less PQS than WT (data not shown).
The mexEF-oprN operon is overexpressed in the desB mutant
We hypothesized that the low levels of HHQ and concomitant decrease of PQS might lead to the reduced S. aureus growth inhibition via a yet unknown regulatory mechanism. Interestingly, we showed, both by qRT-PCR and by microarray analyses, that the mexEF-oprN operon was highly overexpressed in the desB mutant compared to the levels in WT (Table 3, Fig 3). Although the mexF expression levels in the microarray analysis appear to differ from the levels in the qRT-PCR analysis due to the relatively lower accuracy of microarray data compared to qRT-PCR, the same tendency for transcriptional expression of mexEF-oprN was shown in the results of both methods. The mexEF-oprN operon in P. aeruginosa encodes a resistance-nodulation-cell division (RND)-type efflux pump, MexEF-OprN. The MexEF-OprN system is not induced in most P. aeruginosa strains, thereby allowing the expression of QS-regulated virulence determinants [42]. The mexEF-oprN multidrug efflux operon is highly expressed in the presence of antibiotics, nitrosative stress, or disulfide stress [43,44]. Expression of the mexEF-oprN operon is known to be positively regulated by MexT, which is encoded by a gene located immediately upstream of the mexEF-oprN operon, and the mexT gene is negatively regulated by MexS, an oxidoreductase [45,46]. This pump is an important factor for antibiotic resistance, and it transports various molecules, such as chloramphenicol, fluoroquinolones, triclosan, and trimethoprim [47]. Fukuda et al. [48] reported a norfloxacin-resistant mutant of P. aeruginosa PAO1, called an nfxC-type mutant, and showed that an nfxC-type mutant overexpresses the MexEF-OprN efflux pump. Kohler et al. [49] reported that the nfxC-type mutant shows decreased rhlI expression, and the resulting overexpression of the efflux system negatively affects cell-to-cell signaling in P. aeruginosa. The transcriptional profile of the desB mutant is similar to that of the nfxC-type mutant in terms of the levels of pqsA, phnAB, and type III secretion system-related gene expression [50], but different in terms of lasB and rhlAB expression. The wild-type PAO1 strain used in this study contains a 8-bp insertion in mexT, which encodes an inactive and uninducible protein, whereas its isogenic nfxC mutant harbors a deletion of the 8-bp insert and produces functional MexT [42]. However, our transcriptional analyses revealed that the mexEF-oprN operon was greatly overexpressed in desB mutant, even if mexT expression was not altered due to suppression via increased mexS expression (Table 3, Fig 3). According to Kohler et al. [45], nfxC-type mutant produces the effector of MexT, thus causing MexT activation at the posttranslational level and consequently constant overexpression of the mexEF-oprN operon. In addition, MexT also positively regulates several other genes such as PA1744, PA1970, PA2759, PA3229, PA4623, and PA4881 [51], and our transcriptional analysis revealed that these genes were highly expressed in desB mutant (data not shown). Hence, we could assume that posttranslationally activated MexT contributes to the overexpression of mexEF-oprN and other additional genes. Alternatively, the results suggest that mexEF-oprN overexpression in the desB mutant is MexT independent. Kumar and Schweizer [52] observed that large colony variants lacking several efflux pumps exhibited mexEX-oprN overexpression, even though they harbor nonfunctional MexT [52]. This finding suggested that metabolic stress due to the fitness impairment of the variants caused overexpression of the MexEF-OprN efflux pump via a yet uncharacterized regulatory mechanism in the absence of MexT activation [52]. Likewise, our findings could be explained by a disruption of normal metabolism due to the desB mutation, which affects cell fitness and facilitates MexEF-OprN overexpression in the absence of MexT-controlled regulation.In order to confirm the phenotype of mexEF-oprN efflux pump overexpression in the desB mutant, we determined the MIC of chloramphenicol, a representative substrate for MexEF-OprN and performed serial dilution-spotting assays. The results showed that the desB mutant was considerably more resistant to chloramphenicol that the WT, and the MIC of the desB mutant was greater than 512 μg/mL, compared to 128 μg/mL for WT (Fig 4A). In the serial dilution-spotting assay, all ten-fold dilutions of the desB mutant grew normally up to 128 μg/mL of chloramphenicol, whereas growth of WT was reduced starting at 16 μg/mL (Fig 4B). This result demonstrated that the desB mutant is highly resistant to antibiotics due to MexEF-OprN overexpression. Lamarche and Deziel [53] demonstrated that besides antibiotics, the MexEF-OprN efflux pump also exports HHQ, which results in low levels of HHQ and PQS inside the bacterial cells. Likewise, overexpressed MexEF-OprN in the desB mutant also led to reduced production of HAQs. In addition, Olivares et al. [50] reported that PQS in P. aeruginosa overexpressing mexEF-oprN was not detected in early stationary phase but PQS was produced in late stationary phase. Thus, it can be explained that reduced S. aureus growth inhibition in desB mutant comes from delayed PQS production (Fig 2).
Fig 4
Chloramphenicol resistance of Pseudomonas aeruginosa PAO1 wild type (WT) and desB mutant (desB) strains: MIC (A) and serial dilution-spotting assay (B).
(A) WT and desB were exposed to chloramphenicol (0–512 μg/mL). After 24-h incubation, the optical density at 600 nm (OD600) was measured to determine bacterial growth in the presence of chloramphenicol. (B) Overnight cultures of WT and desB were 10-fold serially diluted and then spotted on chloramphenicol-containing agar plates (0, 8, 16, 32, 64, and 128 μg/mL). After incubation, growth was observed. Means with (*, **) are significantly different (P < 0.05) in WT or desB mutant.
Chloramphenicol resistance of Pseudomonas aeruginosa PAO1 wild type (WT) and desB mutant (desB) strains: MIC (A) and serial dilution-spotting assay (B).
(A) WT and desB were exposed to chloramphenicol (0–512 μg/mL). After 24-h incubation, the optical density at 600 nm (OD600) was measured to determine bacterial growth in the presence of chloramphenicol. (B) Overnight cultures of WT and desB were 10-fold serially diluted and then spotted on chloramphenicol-containing agar plates (0, 8, 16, 32, 64, and 128 μg/mL). After incubation, growth was observed. Means with (*, **) are significantly different (P < 0.05) in WT or desB mutant.
Conclusion
This study demonstrated that the desB mutation results in overexpression of MexEF-OprN, which subsequently contributes to 1) decreased HAQs levels inside the cells, 2) reduced MvfR binding to the pqsA-E promoter, and 3) suppression of HAQ synthesis. Ultimately, these events lead to impaired production of the virulence factors involved in S. aureus growth inhibition (Fig 5). In other words, P. aeruginosaDesB is very involved in S. aureus growth inhibition in mixed microbial communities. However, further studies are needed to determine how desB mutation is linked to MexT-independent mexEF-OprN expression at the molecular level.
Fig 5
Diagram of the metabolic pathway and possible mechanism related to the effect of Pseudomonas aeruginosa DesB on Staphylococcus aureus growth inhibition.
Microarray data comparing gene expression of P. aeruginosa PAO1 (WT) and its desB mutant (desB mutant).
Authors: Jorge Olivares; Carolina Alvarez-Ortega; Juan F Linares; Fernando Rojo; Thilo Köhler; José Luis Martínez Journal: Environ Microbiol Date: 2012-03-15 Impact factor: 5.491
Authors: James P Coleman; L Lynn Hudson; Susan L McKnight; John M Farrow; M Worth Calfee; Claire A Lindsey; Everett C Pesci Journal: J Bacteriol Date: 2007-12-14 Impact factor: 3.490
Authors: Irena Pastar; Aron G Nusbaum; Joel Gil; Shailee B Patel; Juan Chen; Jose Valdes; Olivera Stojadinovic; Lisa R Plano; Marjana Tomic-Canic; Stephen C Davis Journal: PLoS One Date: 2013-02-22 Impact factor: 3.240
Authors: Mikael Tognon; Thilo Köhler; Bartosz G Gdaniec; Youai Hao; Joseph S Lam; Marie Beaume; Alexandre Luscher; Angus Buckling; Christian van Delden Journal: ISME J Date: 2017-05-26 Impact factor: 10.302
Authors: Isabel M Oliveira; Marisa Gomes; Luciana C Gomes; Manuel F R Pereira; Olívia S G P Soares; Filipe J Mergulhão Journal: Nanomaterials (Basel) Date: 2022-01-22 Impact factor: 5.076