Detection of both vanA & vanB genes in vanA phenotypes of Enterococci by Taq Man RT-PCR.

Twenty seven isolates of vancomycin resistant Enterococci based on the disk diffusion and E- test have been screened; being found eight (0.3%) clinical isolates of vanA & vanB through Taq Man Real Time PCR assay. This study shows the presence of both vanA & vanB genotypes in vanA phenotypes clinical isolates in the three hospitals in Iran.

Enterococci as an opportunistic microbiota are one of the most important microorganisms found in the environment. In some condition they can become pathogen, causing urinary tract infection (UTI), skin infections, respiratory infections, endocarditis and sepsis ( Emaneini ). This genus of bacteria due to various different of antibiotic resistance genes, intrinsically has shown resistance against some antibiotics including aminoglycosides, macrolids, β-lactams and semisyntetic penicillin’s (Kacmaz et al. , 2009). Following the first isolated vancomycin resistant enterococci (VREs) in 1980; these microorganisms have emerged as important nosocomial pathogens in worldwide ( Japoni , Feizabadi ). Many studies have mentioned that the resistance to vancomycin is complex process and needs to presence of multiple genes (Malathum et al. , 2005, Kacmaz et al. , 2009). According to the Malathum (2005), seven genes clusters were investigated in vancomycin resistance enterococci including: ( vanA , vanB , vanc1 , vanc2 , vanD , vanE , and vanG ). Common resistance mechanism to glycopeptides such as vancomycin concerned with, dipeptide like termini (D-Ala- D-Lac) encoded by vanA and vanB clusters which, prompt to low affinity for vancomycin (Malathum et al. , 2005). Mobile genetic elements (transposons and plasmids), previously have been noticed as main resistance genes transferring among Enterococci spp (Palladino et al. , 2008, Emaneini , Japoni ). Genes ( vanA and vanB ) encoding dipeptide like termini are responsible for high or moderate level vancomycin resistance (Malathum et al. , 2005, Palladino , Arbeur ).

In this study, during 2011, one hundred eighty five strains of enterococci were isolated from clinical laboratories from three hospitals (Dr., Shariati, Sina, Masih Daneshvari) in Tehran, Iran. Isolated strains were identified using the conventional microbial tests according to the scheme utilized as previously described ( Forbes , Louis ). Following the incubation of inoculated isolates in Azid maltose agar culture medium (Himedia, India) at the 35 °C for 24 h, bacterial suspensions were prepared in sterile saline to obtain a turbidity of 0.5 MacFarland standard, equivalent to 1.5 × 10 8 cfu/mL. Turbidity was measured by spectrophotometer instrument (Gensyse 10 UV spectrum, USA). Susceptibility testing for Enterococci isolates was performed by disk diffusion and E-test according to the clinical laboratory standard institute guideline ( CLSI 2010 ). Disk diffusion method by utilizing disk containing 30 μg vancomycin (BD BBL TM Sensi Disc TM ) and E-test technology (AB BIODISK, Solna Sweden) as the recommended methods in CLSI 2010 were applied for detection of VREs strains. To carry out the techniques of disk diffusion and E-test Petri dishes with Mueller-Hinton (Merck, Germany) were applied. Bacteria were inoculated on the recommended media after dipped swabs in bacterial suspension, being implanted disks and E-test strips. Subsequently, plates were incubated in 35 °C for 24 h. Minimum inhibitory concentrations (MICs) breakpoints for vancomycin were determined by manufacturer’s recommendation. Enterococcus faecalis ATTC 29212 and Enterococcus faecium BM4147 were used as sensitive and resistant strains, respectively. Both vanA & vanB positive genotypes underlined. See Table 1 .

Table 1

Phenotype and genotype characteristics in VREs strains.

Enterococci	Phenotypes		Genotypes
VREs	Disc diffusion zone diameter	(MIC) μg/mL	vanA gene	vanB gene	vanA & vanB genes
E. faecium	0(R)	> 256 μg/mL	P	N	N
E. faecium	0(R)	256 μg/mL	P	N	N
E. faecium	1(R)	256 μg/mL	P	N	N
E. faecium	0(R)	256 μg/mL	P	N	N
E. faecium	0(R)	256 μg/mL	P	N	N
E. faecium	8(R)	196 μg/mL	P	N	N
E. faecium	8(R)	196 μg/mL	P	N	N
E. faecium	12(R)	96 μg/mL	N	P	N
E. faecium	0(R)	> 256 μg/mL	P	P	P
E. faecium	0(R)	> 256 μg/mL	P	P	P
E. faecium	1(R)	256 μg/mL	P	P	P
E. faecalis	0(R)	> 256 μg/mL	P	P	N
E. faecalis	0(R)	256 μg/mL	P	P	N
E. faecalis	12(R)	128 μg/mL	P	P	N
E. faecalis	11(R)	128 μg/mL	P	P	N
E. faecalis	11(R)	128 μg/mL	P	P	N
E. faecalis	14 (R)	64 μg/mL	N	P	N
E. faecalis	14 (R)	64 μg/mL	N	P	N
E. faecalis	14(R)	32 μg/mL	N	P	N
E. faecalis	14(R)	32 μg/mL	N	P	N
E. faecalis	14(R)	32 μg/mL	N	P	N
E. faecalis	12 (R)	96 μg/mL	N	P	N
E. faecalis	8(R)	196 μg/mL	P	P	P
E. faecalis	0(R)	256 μg/mL	P	P	P
E. faecalis	0(R)	> 256 μg/mL	P	P	P
E. faecalis	1(R)	256 μg/mL	P	P	P
E. faecalis	6(R)	196 μg/mL	P	P	P

R, resistant; VREs, vancomycin resistant Enterococci ; MIC, minimum inhibitory concentration; μg/mL, microgram per milliliter; P, positive; N, negative.

After susceptibility testing (E-test), Enterococci isolates with MIC ≥ 32 breakpoint were screened. Using a commercial kit (Roche, Diagnostics GmbH, Mannheim, Germany) genomic DNA from each VREs isolates was extracted. Purified DNA was dissolved in 50 μL distilled water. Quantity of extracted DNA was measured by NANO-DROP ®ND-1000 instrument (spectrophotometer 1000, USA) and adjusted to 500 ng.μL −1 .

Purified DNA was reconfirmed by polymerase chain reaction (PCR) by utilizing rrs gene (16s rRNA). Amplification protocol originally described by previously published study ( Japoni ). PCR was performed utilizing 5 μL genomic DNA as template in total volume 25 μL containing; 10 μL master amplicon (Biolab, New England, UK), Forward primer (5′-GGATTAGATACCC TGGTGGTAGTCC-3′) 1 μM, Reverse primer (5′-TCGTTGCGCACCTTAACCAAC-3′) 1 μM and 8 μL mineral oil. PCR process was optimized with purified DNA of Enterococcus faecalis V583 and Enterococcus faecium BM4147 as positive genotypes. Amplification was performed on Gene Amp PCR system (Applied Biosystem, USA) using a program as follow: an initial cycle of denaturation 95 °C for 5 min followed by 35 cycles of 95 °C for 1 min, 50 °C for 1 min and 72 °C for 1 min, with final extension ( Japoni ). Amplified products were visualized on 1.5% agarose gel (Max pure agarose, Spain) stained by etidium bromide by Gel logic 212 pro.

For precise and rapid detection of high and moderate vancomycin resistant Enterococci ( vanA and vanB genes in this study), vancomycin resistance determinants vanA and vanB were targeted by Taq Man Real Time PCR assay. Determination of mentioned genes was performed using ABI 7500 USA instrument. ( Figure 1 ). Specific primers and probes were designed as follow; reference vanA and vanB sequences representing each of vanA and vanB ( vanB1/vanB2/vanB3 ) were assembled from the GenBank data base ( http://www.ncbi.nlm.gov/GenBank ). The utilized accession numbers were vanA ( M97297 ) and vanB ( U00456 .1) respectively. Sequences were aligned using computer software beacon designer version 7. Sequence of designed primers and probes and Real Time PCR condition are listed in Table 2 .

Figure 1

Standard linear amplification plot for vanA & vanB positive.

Table 2

Sequence of designed primers and probes and Taq Man Real Time PCR assay condition.

van primers	Forward (5′-3′)	Reverse (5′-3′)
vanA primer:	TGGAGCGACAGACATAACAGAT	ACACCTACGGGCGAGTTTC
vanA probe	JOE-TATTATTGCTCGTTTACCGTA -BHQ1
vanB primer:	TGATTGTCGGCGAAGTGGAT	GCGTGGATAGCGGCTGTA
vanB probe:	HEX- TCAGAGAATGCGATGATTATC-Tamra

Real Time PCR optimization: Denature: 95 °C for 15 s, Annealing: 55 °C for 15 s, Extension: 72 °C for 1 min, 35 cycles.

Real Time PCR condition: 10 μL Real Time PCR master Mix, 2.5 pmol of each primer, 1.5 pmol of each probe, 5 μL template, Final volume 23 μL.

In this study statistical analyze was done by SPSS software version 16 by using Fisher exact test and p < 0.05 was considered significant.

Out of 185 Enterococci isolates 27 (0.14%) VREs strains consisting of 16/27 (0.59%) Enterococcus faecalis and 11/27 (0.41%) Enterococcus faecium were detected. Our study shows that Enterococcus faecalis and Enterococcus faecium were predominant isolates in VREs. Subsequently prevalence of vanA & vanB from vanA phenotypes were 3/27 (0.11%) Enterococcus faecium and 5/27 (0.18%) Enterococcus faecalis. Giridhara (2009) reported that, since 1980 (first report of isolated VREs) colonization and related infections by VREs as main causative nosocomial infections agents were enhanced ( Giridhara ). Several Real Time PCR protocols have been developed for rapid and precise detection of resistance genes such as vancomycin resistance. According to the Mirzaei (2013) concentration of primer and probes, annealing, temperature, amplification cycle with pure and defined concentration of template DNA were carefully adjusted in order to optimize to Taq Man Real Time PCR assay ( Mirzaei ). Our optimized Taq Man Real Time PCR assay had 96% similarity of phenotypic methods such as E-test and disk diffusion methods for a description of VREs.

The results of Taq Man Real Time PCR assay disclosed the isolates with vanA positive gene were predominant. VanB were detected, while vanA observed in eight (0.03%) high level resistant Enterococci . According to the Xiomara (2002) and Sharifi (2012) the phenotypic methods such as E-test are the convenient and useful methods for determining of minimum inhibitory concentration (MIC) for vancomycin in Enterococci ( Xiomara , Sharifi ). Our study affirmed mentioned studies and showed that Taq Man Real Time PCR assay is the useful methods for rapid and precise screening of VREs too. This method is more specific than traditional phenotypic methods for determination of both vanA and vanB genotypes in VREs phenotypes. Precise and rapid detection of vancomycin resistance genes lead to enhance the accuracy of VREs screening and consequently could help clinicians to timely administer appropriate antibiotics which may be life saving ( Mirzaei ). According to the some mentioned studies dissemination of VREs due to vanA and vanB genes in Iran has presented serious challenges for the medical community ( Feizabadi , Japoni , Sharifi , Mirzaei ) Current study reconfirmed previously published studies. After performing Taq Man Real Time PCR, three strains of Enterococcus faecium and five strains of Enterococcus faecalis were both vanA and vanB positive. According to the Wood ford (1997) during hospital outbreak of VREs, two vanA glycopeptides resistances Enterococcus faecium were isolated with plasmid mediated vanB resistance. Both were found to be identical to the vanB outbreak strain by pulsed field gel electrophoresis (PFGE). The genotype of this strain changed from vanB to vanA through an intermediate isolate that contained both the vanA and vanB genes clusters on distinct plasmids. In our study by using Taq Man Real Time PCR both vanA and vanB genes were detected too ( Wood ford ). Michel (2001) reported that gene transferring in bacteria has an important role for the dissemination of resistance genes. Although primarily vanA cluster (in TN1546 and TN5482 ) was identified in Enterococcus faecium also this cluster has been detected in Enterococcus faecalis . VanB gene cluster exist in TN1546 and has been identified in Enterococcus faecalis and Enterococcus faecium strains. Instability in Enterococci genome and transduction process or up and down regulation of genes probably can be considered as main reasons ( Michel , Van den Braak ). According to the previously published study by Japoni (2009) vanA gene was detected as predominant determinant in VREs. Also, all of the isolates showed high level resistance to vancomycin itself ( Japoni ). In this study, in addition to high levels of resistance to vancomycin, in eight of the samples both genes as the main determinants for resistance to vancomycin were observed. Due to the high sensitivity the utilized method in the current study, present of both associate indicators to resistance in some VREs are predictable. However, in most cases, only one of the genes for resistance is adequate (Malathum et al. , 2005).

The current study has shown; Taq Man Real Time PCR assay is the useful, precise and rapid method for detection of vancomycin resistance genes in the clinical microbiology laboratory. Although biochemical methods such as E-testing technology for the detection of antibiotics resistance could be more economically efficient, but given the time needed to identify the resistance, using molecular methods such as Taq Man Real Time assay can make a substantial contribution to save a patient’s life.