| Literature DB >> 26217355 |
Kar-Chun Tan1, Huyen T T Phan1, Kasia Rybak1, Evan John1, Yit H Chooi2, Peter S Solomon3, Richard P Oliver1.
Abstract
Necrotrophic diseases of wheat cause major losses in most wheat growing areas of world. Tan spot (caused by Pyrenophora tritici-repentis) and septoria nodorum blotch (SNB; Parastagonospora nodorum) have been shown to reduce yields by 10-20% across entire agri-ecological zones despite the application of fungicides and a heavy focus over the last 30 years on resistance breeding. Efforts by breeders to improve the resistance of cultivars has been compromised by the universal finding that resistance was quantitative and governed by multiple quantitative trait loci (QTL). Most QTL had a limited effect that was hard to measure precisely and varied significantly from site to site and season to season. The discovery of necrotrophic effectors has given breeding for disease resistance new methods and tools. In the case of tan spot in West Australia, a single effector, PtrToxA and its recogniser gene Tsn1, has a dominating impact in disease resistance. The delivery of ToxA to breeders has had a major impact on cultivar choice and breeding strategies. For P. nodorum, three effectors - SnToxA, SnTox1, and SnTox3 - have been well characterized. Unlike tan spot, no one effector has a dominating role. Genetic analysis of various mapping populations and pathogen isolates has shown that different effectors have varying impact and that epistatic interactions also occur. As a result of these factors the deployment of these effectors for SNB resistance breeding is more complex. We have deleted the three effectors in a strain of P. nodorum and measured effector activity and disease potential of the triple knockout mutant. The culture filtrate causes necrosis in several cultivars and the strain causes disease, albeit the overall levels are less than in the wild type. Modeling of the field disease resistance scores of cultivars from their reactions to the microbially expressed effectors SnToxA, SnTox1, and SnTox3 is significantly improved by including the response to the triple knockout mutant culture filtrate. This indicates that one or more further effectors are secreted into the culture filtrate. We conclude that the in vitro-secreted necrotrophic effectors explain a very large part of the disease response of wheat germplasm and that this method of resistance breeding promises to further reduce the impact of these globally significant diseases.Entities:
Keywords: effectors; necrotrophic fungi; nodorum; phaeosphaeria; septoria; stagonospora
Year: 2015 PMID: 26217355 PMCID: PMC4495316 DOI: 10.3389/fpls.2015.00501
Source DB: PubMed Journal: Front Plant Sci ISSN: 1664-462X Impact factor: 5.753
Primers used to construct the SnTox1 deletion vector.
| Primer | Sequence (5′ – 3′) |
|---|---|
| 5_Tox1Fbar | CCGCAAGCAGATACAGCCGA |
| 5_Tox1Rbar | |
| 3_Tox1Fbar | |
| 3_Tox1Rbar | GATTGAGGGTGAGGGGCGGG |
| Bar-strp-R | CTAAATCTCGGTGACGGGCA |
| PtrpC-strt-F | GTCGACAGAAGATGATATTGA |
| pGEMTEasy_EcoRI_Tox1 | |
| pGEMTEasy_NotI_Tox1 |
Parastagonospora nodorum strains used in this study.
| Strain | Description | Source |
|---|---|---|
| SN15 | Wildtype | Department of agriculture WA |
| SN15 deleted in | ||
| This study | ||
| This study |