| Literature DB >> 26180509 |
Jiayi Zheng1, Fen Li2, Jinfen Liu3, Zhiwei Xu3, Haibo Zhang3, Qihua Fu4, Jian Wang5, Kun Sun6.
Abstract
The purposes of this study are to investigate somatic NKX2-5 mutations in Chinese children with congenital heart disease (CHD) and assess the reliability of somatic mutation detection in formalin-fixed, paraffin-embedded (FFPE) tissues. The study cohort included frozen and FFPE cardiac tissues as well as blood samples from 85 Chinese children with CHD who had the cardiac operations. The right atrial appendage far from the diseased heart was used as normal control. Genomic DNA was isolated from cardiac tissues and blood samples using TIANamp Blood DNA kit. Two exons and exon-intron boundaries of NKX2-5 were amplified by polymerase chain reaction (PCR) and sequenced by dideoxynucleotide chain termination approach. The acquired sequences were aligned with GenBank sequences to identify the sequence variations. No somatic mutation in the NKX2-5 gene was observed in both frozen and FFPE cardiac tissues in 85 Chinese children with CHD. Nonetheless, a common single nucleotide polymorphism (SNP), c.63 A > G (E21E), was identified in all the three kinds of DNA samples with the same allele frequency 82.3%. Moreover, another common SNP c.606 G > C (L202L) was found in 2.3% of our patients. There were no significant differences in the allele frequencies of two SNPs between the cardiac diseased tissues and right atrial appendage (P > 0.05). PCR artefact as mutations was not found in the FFPE tissues stored for one year. Our findings demonstrate that somatic NKX2-5 mutations do not represent an important aetiologic pathway in Chinese children with congenital heart disease.Entities:
Keywords: Congenital Heart Disease (CHD); NKX2-5; formalin-fixed; paraffin-embedded (FFPE) tissues; single nucleotide polymorphisms (SNP); somatic mutation
Mesh:
Substances:
Year: 2015 PMID: 26180509 PMCID: PMC4502057 DOI: 10.7150/ijms.11700
Source DB: PubMed Journal: Int J Med Sci ISSN: 1449-1907 Impact factor: 3.738
Primer sequences for the amplification of NKX2-5 fragments
| Primer | Exon | Forward (5'-3') | Reverse (5'-3') | Length (bp) |
|---|---|---|---|---|
| A | 1 | CTTGTGCTCAGCGCTACCT | CTGAGTTTCTTGGGGACGAA | 550 |
| B | 2 | AGTGCACTTGGCAGAGTGAG | CTAGGTCTCCGCAGGAGTGA | 922 |
| C | 2 | AGTGCACTTGGCAGAGTGAG | ATAGGCGGGGTAGGCGTTAT | 586 |
| D | 2 | AAGCCATGCCTAGGGGACT | CTCATTGCACGCTGCATAAT | 500 |
Figure 1NKX2-5 sequence variations. (A) A NKX2-5 homozygous sequence variant c.65A/A. (B) A NKX2-5 heterozygous sequence variant c.65A>G (E21E). (C) A NKX2-5 homozygous sequence variant c.65G/G. (D) A NKX2-5 homozygous sequence variant c.606G/G. (E) A NKX2-5 homozygous sequence variant c.606 G > C (L202L).
Frequencies of genotypes and alleles of NKX2-5 sequence variations
| Frequency (%) of genotypes | Frequency (%) of alleles | |||||
|---|---|---|---|---|---|---|
| AA | AG | GG | A | G | ||
| All CHD | 15 (17.6) | 32 (37.6) | 38 (44.7) | 62 (36.5) | 108 (63.5) | |
| TOF | 5 (21.7) | 8 (34.8) | 10 (43.5) | 18 (39.1) | 28 (60.9) | |
| Other CHD | 10 (16.1) | 24 (38.7) | 28 (45.1) | 44 (35.5) | 80 (64.5) | |
| Z | -0.343 | - 0.438 | ||||
| P | 0.732 | 0.662 | ||||
| GG | GC | CC | G | C | ||
| All CHD | 82 (96.5) | 3 (3.53) | 0 (0) | 167 (98.2) | 3 (1.8) | |
| TOF | 21 (91.3) | 2 (8.7) | 0 (0) | 44 (95.6) | 2 (4.3) | |
| Other CHD | 61 (98.4) | 1 (1.6) | 0 (0) | 123 (99.2) | 1 (0.8) | |
| Z | -1.563 | -1.553 | ||||
| P | 0.118 | 0.12 | ||||
Genotypes of NKX2-5 sequence variations in CHD patients
| CHD | Genotype of c.63 | Genotype of c.606 | ||||
|---|---|---|---|---|---|---|
| AA | AG | GG | GG | GC | ||
| TOF | 5 | 8 | 10 | 21 | 2 | |
| VSD | 8 | 16 | 24 | 47 | 1 | |
| ASD (II) | 1 | 3 | 1 | 5 | 0 | |
| CAVC | 0 | 0 | 1 | 1 | 0 | |
| CoA/VSD | 0 | 0 | 2 | 2 | 0 | |
| IAA/VSD | 0 | 1 | 0 | 1 | 0 | |
| PTA/VSD | 0 | 1 | 0 | 1 | 0 | |
| PA/VSD | 1 | 0 | 0 | 1 | 0 | |
| DORV/VSD | 0 | 1 | 0 | 1 | 0 | |
| TR/PFO | 0 | 1 | 0 | 1 | 0 | |
| Cor triatriatum/TR | 0 | 1 | 0 | 1 | 0 | |
Comparison of DNA quantity in frozen and FFPE tissues
| DNA quantity (ug) | Ratio (λ) | ||
|---|---|---|---|
| Frozen tissue (n = 38) | FFPE tissue (n = 38) | ||
| Median | 7.6 | 1.8 | 4.0 |
| Mean | 7.6 | 1.9 | 4.0 |
| Range | 4.2 - 11.6 | 1.2 - 3.1 | 2.8 - 5.4 |
| SD | 1.9 | 0.5 | 0.6 |
| P value | 3.3E-36 | ||