Ana Brennand1, Eva Rico2, Daniel J Rigden3, Patrick Van Der Smissen4, Pierre J Courtoy4, Paul A M Michels1. 1. Research Unit for Tropical Diseases, de Duve Institute, and Laboratory of Biochemistry, Université catholique de Louvain, Brussels, Belgium. 2. Research Unit for Tropical Diseases, de Duve Institute, and Laboratory of Biochemistry, Université catholique de Louvain, Brussels, Belgium; Departamento de Bioquímica y Biología Molecular, Campus Universitario, Universidad de Alcalá, 28871 Alcalá de Henares, Madrid, Spain. 3. Institute of Integrative Biology, Biosciences Building, University of Liverpool, Liverpool, United Kingdom. 4. Cell Biology Unit, de Duve Institute, Université catholique de Louvain, Brussels, Belgium.
Abstract
We have previously identified homologs for nearly half of the approximately 30 known yeast Atg's in the genome database of the human sleeping sickness parasite Trypanosoma brucei. So far, only a few of these homologs have their role in autophagy experimentally confirmed. Among the candidates was the ortholog of Atg24 that is involved in pexophagy in yeast. In T. brucei, the peroxisome-like organelles named glycosomes harbor core metabolic processes, especially glycolysis. In the autotrophic yeast, autophagy is essential for adaptation to different nutritional environments by participating in the renewal of the peroxisome population. We hypothesized that autophagic turnover of the parasite's glycosomes plays a role in differentiation during its life cycle, which demands adaptation to different host environments and associated dramatic changes in nutritional conditions. We therefore characterized T. brucei ATG24, the T. brucei ortholog of yeast Atg24 and mammalian SNX4, and found it to have a regulatory role in autophagy and differentiation as well as endocytic trafficking. ATG24 partially localized on endocytic membranes where it was recruited via PI3-kinase III/VPS34. ATG24 silencing severely impaired receptor-mediated endocytosis of transferrin, but not adsorptive uptake of a lectin, and caused a major enlargement of the flagellar pocket. ATG24 silencing approximately doubled the number of autophagosomes, suggesting a role in repressing autophagy, and strongly accelerated differentiation, in accordance with a role of autophagy in parasite differentiation. Overexpression of the two isoforms of T. brucei ATG8 fused to GFP slowed down differentiation, possibly by a dominant-negative effect. This was overcome by ATG24 depletion, further supporting its regulatory role.
We have previously identified homologs for nearly half of the approximately 30 known yeast Atg's in the genome database of the humansleeping sickness parasite Trypanosoma brucei. So far, only a few of these homologs have their role in autophagy experimentally confirmed. Among the candidates was the ortholog of Atg24 that is involved in pexophagy in yeast. In T. brucei, the peroxisome-like organelles named glycosomes harbor core metabolic processes, especially glycolysis. In the autotrophic yeast, autophagy is essential for adaptation to different nutritional environments by participating in the renewal of the peroxisome population. We hypothesized that autophagic turnover of the parasite's glycosomes plays a role in differentiation during its life cycle, which demands adaptation to different host environments and associated dramatic changes in nutritional conditions. We therefore characterized T. bruceiATG24, the T. brucei ortholog of yeastAtg24 and mammalianSNX4, and found it to have a regulatory role in autophagy and differentiation as well as endocytic trafficking. ATG24 partially localized on endocytic membranes where it was recruited via PI3-kinase III/VPS34. ATG24 silencing severely impaired receptor-mediated endocytosis of transferrin, but not adsorptive uptake of a lectin, and caused a major enlargement of the flagellar pocket. ATG24 silencing approximately doubled the number of autophagosomes, suggesting a role in repressing autophagy, and strongly accelerated differentiation, in accordance with a role of autophagy in parasite differentiation. Overexpression of the two isoforms of T. bruceiATG8 fused to GFP slowed down differentiation, possibly by a dominant-negative effect. This was overcome by ATG24 depletion, further supporting its regulatory role.
Sleeping sickness, a parasitic disease severely affecting man and cattle in sub-Saharan Africa, is caused by the protist Trypanosoma brucei that belongs to the Kinetoplastea clade. The life cycle of T. brucei involves sequential differentiation from the long-slender (LS) into short-stumpy (SS) forms when residing in the mammalian blood (bloodstream forms, BSF), then from the SS forms into the procyclic forms (PCF) adapted to the midgut of the tsetse fly vector. Kinetoplastids' unique features include packing of the majority of glycolytic enzymes inside peroxisome-like organelles, named glycosomes [1]. This compartmentalization is essential for the survival of the LS BSF, as well as the PCF when cultured in glucose-rich conditions [2-4].The molecular machineries allowing formation of all organelles belonging to the peroxisome family appear well conserved. In particular, biogenesis of glycosomes is similar to that of peroxisomes in different organisms, although some important differences have been reported [5]. As in peroxisomes, the enzymatic content of glycosomes is adapted to the nutritional conditions faced by the cells. T. brucei BSF freely grow in the mammalian bloodstream and feed on its highly abundant and constantly available glucose. They depend entirely on the metabolism of glucose through glycolysis for their ATP supply, with pyruvate excreted as the major end-product [6]. In sharp contrast, PCF cells need to survive in different regions of the tsetse fly’s digestive system, where glucose supply is irregular (only being available for short periods after bloodmeals), but where amino acids, especially proline, are more abundant and constantly available [7]. As a consequence, the enzymatic content of glycosomes changes when cells differentiate from the BSF to the PCF stage, whereas mitochondrial metabolism, that is largely repressed in BSF trypanosomes, becomes predominant in PCF cells. The differences in enzymatic content between these two major stages of the parasite have been recently highlighted in a proteomics study [8]. The need of T. brucei to adapt to these different environments, especially the requirement to dispose of BSF-specific glycosomes when differentiating into PCF, is highly reminiscent of yeast adaptation to changes in carbon source. This requires the expression of a new set of proteins, some to be imported into peroxisomes, as well as the removal of redundant peroxisomes by autophagy [9].Autophagy is a well-conserved mechanism by which cytoplasmic material, soluble proteins or entire organelles, are sequestered into the cell's degradative organelle(s), namely lysosomes or the vacuole in yeast, for degradation and recycling. Autophagy occurs at a basal level as a housekeeping process to dispose of misfolded proteins as well as senescent or inadequate organelles, so as to maintain cell fitness. Autophagy can be up-regulated under widely diverse natural conditions, not only starvation or stress, but also during cell differentiation or sporulation [10].Specific autophagic degradation of peroxisomes, known as pexophagy, has been shown to participate in the adaptation of methylotrophic yeasts from growth on (m)ethanol to glucose as source of energy (for a review see [11]). In these cells, growth on alcohol requires multiple large peroxisomes containing alcohol oxidase, which can account for most of the cell volume. When shifted to a glucose-rich environment, pexophagy is observed. The term of pexophagy is extended to the autophagy of glycosomes, which exhibit multiple similarities to peroxisomes.AuTophaGy-related proteins (ATGs) are required for the induction of autophagy. Some ATGs are broadly distributed, such as those involved in the two ubiquitin-like complexes (centered around ATG8 and ATG12) that participate in the expansion of the phagophore membrane. Other ATGs, mainly those responsible for pathway specificity, seem to be restricted to only one species or a narrow group of species [12].The occurrence of autophagy in T. brucei is long known, thanks to early electron microscopic studies showing an increasing number of autophagosomes in BSF cells differentiating from the LS to the SS form [13]. Following molecular characterization of autophagy in yeasts, we identified several ATG homologs in trypanosomatids [14]. We later observed that autophagy in T. brucei was increased during starvation as well as during differentiation in vivo and in vitro. Upon in vivo differentiation of BSF from proliferating LS to non-proliferating SS, glycosomal aldolase showed increasing co-localization with p67, a marker for lysosomes, indicating up-regulation of autophagic degradation of the organelles; when the SS forms were induced in vitro to further differentiate into PCF cells, co-localization further increased [15]. These results raised the hypothesis that trypanosomes adapt their metabolism to the new conditions thanks to ‘en-bloc’ replacement of ‘old’ glycosomes optimally equipped for glycolysis with a new set of glycosomes more appropriate to the completely different nutritional conditions prevailing in the fly’s midgut [16]. Production of new enzymes in the cytosol and subsequent import into the glycosomal matrix via the action of so-called peroxins (abbreviated as PEXs) can certainly provide adaptation to such changes. However, it is also likely that part of the glycosomal population, considered as “mature organelles”, is no longer able to import newly synthesized enzymes from the cytosol, as observed for mature peroxisomes of Hansenula polymorpha. In these yeast cells, a significant change in nutritional conditions not only induces pexophagy, but two peroxins involved in peroxisome biogenesis, Pex14 and Pex3, also participate in their degradation [17,18]. Although the mechanism by which Pex14 is involved is not yet completely understood, exposure of its N-terminal region seems required [18]. Furthermore, peroxisome degradation in the vacuole appears to be triggered by Pex3 removal from the peroxisomal membrane followed by its degradation via the ubiquitin-proteasome system [18,19].While there is no proof that a similar mechanism signals for degradation of glycosomes in T. brucei, their disposal via autophagy is clearly upregulated during in vivo and in vitro differentiation. In BSF, the metabolic organization, biogenesis and matrix-protein import into glycosomes are essential for parasite survival and thus validated as drug targets [20]. However, little is known about how the parasite changes the metabolic content of its glycosome population from one stage to the other. Here, we characterize the putative ATG24 in T. brucei. Its yeast ortholog (in Pichia pastoris and Saccharomyces cerevisiae) is involved in specific types of autophagy [21,22]. The same T. brucei protein was previously identified as a VPS5 by Koumandou and colleagues [23] and shown to be associated to retromer. We demonstrate in this paper that silencing of this ATG24/VPS5 homolog increases autophagosome numbers and promotes differentiation. In T. brucei, ATG24 silencing increases autophagosome numbers and promotes differentiation. Taken together, these observations demonstrate the link between the two processes and suggest that, in normal conditions, ATG24 is a repressor of autophagy and a lock of differentiation. Like S. cerevisiaeAtg24 and the corresponding mammalian protein (SNX4—sorting nexin 4), T. bruceiATG24 is recruited to intracellular membranes by the phosphatidylinositol 3-kinase (PI3 kinase) activity of VPS34 and is essential for receptor-mediated endocytosis. T. bruceiATG24 is also involved in the homeostasy of the flagellar pocket. Altogether, these results thus indicate that TbATG24 may act as a link between autophagy and endocytic membrane trafficking.
Results
Bioinformatics analysis of T. brucei ATG24
TbATG24 (Tb927.9.13380, formerly known as Tb09.211.4240) was identified in the databases by homology searches with S. cerevisiaeAtg24 as described previously [14]. The protein shares 24% sequence identity with its yeast counterpart. However, the protein was recently identified as the T. brucei equivalent of Vps5/SNX1 [23]. To explore the relationship of TbATG24 with yeast homologs more thoroughly, sequences were aligned (Fig 1A) and three phylogenetic trees, one of which is shown in Fig 1B (the other two in the Supporting Information, S1 Fig), were constructed based on calculations with different methods. Although many bootstrapping values are low, these suggest that the T. brucei protein is evolutionarily more closely related to Atg24/SNX4 than to Vps5/SNX1.
Fig 1
Identification of TbATG24 by sequence homology.
A) Amino acid sequence alignment of several SNXs from different species where the domain boundaries are boxed and key PI3P-binding residues are shown. Sc—Saccharomyces cerevisiae, Hs–Homo sapiens, Ce–Caenorhabditis elegans, Dm–Drosophila melanogaster
B) Phylogenetic tree of the two PX-BAR-containing proteins from T. brucei (Tb; one of which Tb927.9.13380, is here referred to as TbATG24) and PX-BAR containing proteins from other organisms. The relationships were inferred by the Minimum Evolution method. The branches are drawn to scale, with lengths in the same units (the number of base differences per site; indicated by the bar) as those of the evolutionary distances used to infer the phylogenetic tree. The evolutionary distances were computed as described in the Materials and Methods. The tree is bootstrapped; the numbers near the nodes indicate the percentage of replicate trees in which the associated taxa clustered together in the bootstrap test (500 replicates). Phylogenetic reconstructions using the Neighbor-Joining and Maximum Parsimony methods (S1 Fig) gave essentially the same topology. Proteins considered important for the discussion are boxed.
Identification of TbATG24 by sequence homology.
A) Amino acid sequence alignment of several SNXs from different species where the domain boundaries are boxed and key PI3P-binding residues are shown. Sc—Saccharomyces cerevisiae, Hs–Homo sapiens, Ce–Caenorhabditis elegans, Dm–Drosophila melanogaster
B) Phylogenetic tree of the two PX-BAR-containing proteins from T. brucei (Tb; one of which Tb927.9.13380, is here referred to as TbATG24) and PX-BAR containing proteins from other organisms. The relationships were inferred by the Minimum Evolution method. The branches are drawn to scale, with lengths in the same units (the number of base differences per site; indicated by the bar) as those of the evolutionary distances used to infer the phylogenetic tree. The evolutionary distances were computed as described in the Materials and Methods. The tree is bootstrapped; the numbers near the nodes indicate the percentage of replicate trees in which the associated taxa clustered together in the bootstrap test (500 replicates). Phylogenetic reconstructions using the Neighbor-Joining and Maximum Parsimony methods (S1 Fig) gave essentially the same topology. Proteins considered important for the discussion are boxed.
ATG24 is an endocytic protein
Rabbit antiserum, raised for this study against recombinant full-length ATG24, recognized a single band at the expected size of 48 kDa in whole-cell lysates of both LS-BSF and PCFT. brucei cells (S2A Fig). Confocal immunofluorescence (Fig 2A) as well as direct imaging of the Green Fluorescent Protein (GFP)-tagged version of the protein (Fig 2B and 2C) revealed a dual localization: diffuse in the cytoplasm (i.e. cytosolic) and concentrated in a few puncta generally clustered between the nucleus and kinetoplast, i.e. the typical position of the endocytic apparatus in T. brucei. The expression of the ATG24 with a GFP tag did not affect the growth rate of the cells (not shown). To test for association with endocytic organelles, BSF cells expressing GFP-ATG24 were incubated for up to 30 min at 37°C with fluorescent transferrin (Fig 2B) or concanavalin A (Fig 2C) as respective tracers of receptor-mediated (transferrin:receptor complex) and bulk adsorptive endocytosis (concanavalin A is a general lectin of mannose that binds surface glycoproteins). Both tracers showed partial colocalization with ATG24, as concluded from the determined Pearson correlation coefficient (see legend Fig 2), thus confirming (at least partial) endocytic localization of the protein.
Fig 2
Dual localization of ATG24 in T. brucei cytosol and endosomes.
A) ATG24 subcellular localization by immunofluorescence. Notice that ATG24 immunolabeling (in red) produces a combined dotty pattern (arrowheads) with diffuse cytosolic signal, both in BSF (left panel) and PCF wild-type cells (right panel). Blue is DAPI, N = nucleus, k = kinetoplast. B) Relation with endosomes in wild-type BSF cells expressing ATG24-GFP (green) incubated with the receptor-mediated endocytic tracer, Alexa568-transferrin (red), at 37°C for 30 min. Yellow in the merge at right indicates extensive colocalization. DAPI is shown in blue. C) Relation with endosomes by triple imaging with concanavalin A and DAPI. Wild-type BSF cells expressing ATG24-GFP (green) were incubated with the adsorptive endocytosis tracer, Alexa594-concanavalin A (red) at 37°C for 30 min. All scale bars: 5 μm. In two independent experiments the mean Pearson's correlation of colocalization observed between ATG24 and transferrin was 0.24 and with concanavalin A was 0.21. As positive and negative controls, respectively, endosomal RAB11 had a Pearson's coefficient of 0.34 and DAPI 0.13.
Dual localization of ATG24 in T. brucei cytosol and endosomes.
A) ATG24 subcellular localization by immunofluorescence. Notice that ATG24 immunolabeling (in red) produces a combined dotty pattern (arrowheads) with diffuse cytosolic signal, both in BSF (left panel) and PCF wild-type cells (right panel). Blue is DAPI, N = nucleus, k = kinetoplast. B) Relation with endosomes in wild-type BSF cells expressing ATG24-GFP (green) incubated with the receptor-mediated endocytic tracer, Alexa568-transferrin (red), at 37°C for 30 min. Yellow in the merge at right indicates extensive colocalization. DAPI is shown in blue. C) Relation with endosomes by triple imaging with concanavalin A and DAPI. Wild-type BSF cells expressing ATG24-GFP (green) were incubated with the adsorptive endocytosis tracer, Alexa594-concanavalin A (red) at 37°C for 30 min. All scale bars: 5 μm. In two independent experiments the mean Pearson's correlation of colocalization observed between ATG24 and transferrin was 0.24 and with concanavalin A was 0.21. As positive and negative controls, respectively, endosomal RAB11 had a Pearson's coefficient of 0.34 and DAPI 0.13.
ATG24 requires VPS34 for its correct subcellular localisation
ATG24 contains no transmembrane region, but its N-terminal PX domain allows for its recruitment onto membranes, as shown by studies with yeast and mammalian mutant cells [21,22,24]. This domain interacts primarily with phosphatidylinositol 3-phosphate (PI3P); it also allows lower affinity binding to PtdIns(3,5)P2, whereas mammalianSnx4 also interacts with PtdIns4P. PI3P is a unique modified lipid generated on endosomal membranes by monovalent PI3 kinase type III/VPS34, the only PI3K isoform expressed in T. brucei [25]. To test whether VPS34 was also involved in mediating ATG24 recruitment from the cytosol onto membranes in T. brucei, we incubated PCF wild-type cells with the PI3 kinase inhibitor wortmannin (0.3–30 μM), and followed the effect on the subcellular localization of ATG24 by immunofluorescence (Fig 3A). Treated cells showed a concentration-dependent release of ATG24 from puncta, resulting into more diffuse cytosolic labeling at 3 μM and higher concentrations, indicating that membrane association required PI3 kinase activity. The association of ATG24 to puncta dropped from 62% to 33% in the first experiment and from 42% to 25% in the second one, when comparing cells in normal conditions versus cells exposed for 1 h to 3 μM wortmannin. However, the specificity of this pharmacological inhibition could be questioned, since wortmannin is a broad-spectrum irreversible inhibitor of PI3 kinases. We therefore turned to specific silencing of VPS34 using a BSF RNAi cell line as an alternative approach. This RNAi cell line is considerably (70–80%) retarded in growth, over a 12-day period, from about 24 h after induction of decreased VPS34expression (M. Herman and PM, unpublished result). Indeed, the importance of VPS34 for BSF T. brucei has been demonstrated previously [25]. In these cells, 24 h after VPS34 RNAi induction, ATG24 showed loss of immunolabeled puncta and a more diffuse distribution, confirming that association of ATG24 to endocytic vesicles requires VPS34 (Fig 3B).
Fig 3
ATG24 membrane recruitment in T. brucei depends on VPS34.
A) Pharmacological inhibition. ATG24 immunofluorescence was determined in wild-type PCF cells in the absence of wortmannin and after 1 h of incubation with 0.3 to 30 μM of this compound. Shown here are (in black and white for better contrast and resolution) non-treated trypanosomes (in the left panel) and trypanosomes treated with 3 μM wortmannin for 1 h (in the panel at the right). Quantification of the effect of wortmannin was performed in two experiments with 60 and 150 cells, respectively. B) VPS34 silencing. ATG24 immunofluorescence (red) in wild-type (WT) and VPS34 RNAi BSF at 24 h after induction. Blue shows DAPI. The intensity value assigned to ATG24 fluorescence in endosomes was 3.4 times higher in WT BSF than in VPS34 RNAi BSF 24-h induced cells. Results are from one representative experiment out of two where 45 WT and 10 VPS34 RNAi cells and 18 WT and 21 VPS34 RNAi cells were counted, respectively. All scale bars: 5 μm.
ATG24 membrane recruitment in T. brucei depends on VPS34.
A) Pharmacological inhibition. ATG24 immunofluorescence was determined in wild-type PCF cells in the absence of wortmannin and after 1 h of incubation with 0.3 to 30 μM of this compound. Shown here are (in black and white for better contrast and resolution) non-treated trypanosomes (in the left panel) and trypanosomes treated with 3 μM wortmannin for 1 h (in the panel at the right). Quantification of the effect of wortmannin was performed in two experiments with 60 and 150 cells, respectively. B) VPS34 silencing. ATG24 immunofluorescence (red) in wild-type (WT) and VPS34 RNAi BSF at 24 h after induction. Blue shows DAPI. The intensity value assigned to ATG24 fluorescence in endosomes was 3.4 times higher in WT BSF than in VPS34 RNAi BSF 24-h induced cells. Results are from one representative experiment out of two where 45 WT and 10 VPS34 RNAi cells and 18 WT and 21 VPS34 RNAi cells were counted, respectively. All scale bars: 5 μm.
ATG24 is necessary for receptor-mediated endocytosis and controls flagellar pocket homeostasy
We concluded that T. bruceiATG24 identified here was the most likely counterpart of the Atg24 in S. cerevisiae which participates in endocytosis and autophagy, notably pexophagy. Since endocytic tracing by confocal microscopy presented above indicated VPS34-regulated association of T. bruceiATG24 with the endocytic system, we further tested for a function of ATG24 in receptor-mediated endocytosis by vital imaging of fluorescent transferrin uptake in control versus induced BSF ATG24 RNAi cells. A representative figure for ATG24 depletion during ATG24 RNAi in BSF cells is shown in the Supporting Information (S2A Fig); the ATG24 level in RNAi non-induced cells had dropped to 46% compared to WT cells and to 10% in 24 h-induced cells. ATG24 silencing virtually abrogated intracellular transferrin labeling (Fig 4A); in two independent experiments, intracellular transferrin was detectable in 75% and 92% of the wild-type cells, but only in 11% and 25% of 48 h-induced ATG24 RNAi cells, indicating that ATG24 is indeed a necessary component of the endocytic machinery in this parasite.
Fig 4
ATG24 silencing in T. brucei abrogates receptor-mediated endocytosis and induces enlargement of a single structure.
Each pair combines fluorescence confocal imaging (left) with interference contrast (right). A) Fluorescence of Alexa-568 transferrin. BSF wild-type and ATG24 RNAi cells induced for 48 h were incubated at 37°C for 30 min with 6.25 nM Alexa568-transferrin. As illustrated here, most of the wild-type cells have internalized transferrin (red) into discrete structures, but the majority of ATG24 RNAi-expressing cells show no detectable fluorescence. The arrowhead indicates an enlarged structure not stained by transferrin. Quantification of transferrin labeling involved analyzing 24 wild-type and 107 ATG24 RNAi induced cells in the first experiment and 85 wild-type and 150 ATG24 RNAi cells in the second experiment. B) Fluorescence of concanavalin A. BSF wild-type and ATG24 RNAi-expressing cells (induced for 48 h) were incubated at 37°C for 20 min with 1.9 nM Alexa594-concanavalin A. Note the single concanavalin A-labeled structure (arrowhead). All images are from one representative experiment out of two. In the first experiment 42 wild-type and 61 ATG24 RNAi-induced cells were assessed for concanavalin A labeling, in the second experiment 25 wild-type and 206 ATG24 RNAi cells. All scale bars: 5 μm. The quantification method used is described in the Materials and Methods section.
ATG24 silencing in T. brucei abrogates receptor-mediated endocytosis and induces enlargement of a single structure.
Each pair combines fluorescence confocal imaging (left) with interference contrast (right). A) Fluorescence of Alexa-568transferrin. BSF wild-type and ATG24 RNAi cells induced for 48 h were incubated at 37°C for 30 min with 6.25 nM Alexa568-transferrin. As illustrated here, most of the wild-type cells have internalized transferrin (red) into discrete structures, but the majority of ATG24 RNAi-expressing cells show no detectable fluorescence. The arrowhead indicates an enlarged structure not stained by transferrin. Quantification of transferrin labeling involved analyzing 24 wild-type and 107 ATG24 RNAi induced cells in the first experiment and 85 wild-type and 150 ATG24 RNAi cells in the second experiment. B) Fluorescence of concanavalin A. BSF wild-type and ATG24 RNAi-expressing cells (induced for 48 h) were incubated at 37°C for 20 min with 1.9 nM Alexa594-concanavalin A. Note the single concanavalin A-labeled structure (arrowhead). All images are from one representative experiment out of two. In the first experiment 42 wild-type and 61 ATG24 RNAi-induced cells were assessed for concanavalin A labeling, in the second experiment 25 wild-type and 206 ATG24 RNAi cells. All scale bars: 5 μm. The quantification method used is described in the Materials and Methods section.Whereas uptake of transferrin was affected in RNAi-induced ATG24 cells, no change in uptake of concanavalin A was observed. However, in some of the RNAi-induced cells we noticed an enlargement of a structure that could be labeled by concanavalin A (Fig 4B). Since Koumandou et al. [23] reported that decrease of the level of the protein identified by us as the ATG24 by RNAi resulted in an increase the size of the lysosome in BSF, we performed immunofluorescence for the lysosomal marker p67 in our BSF ATG24 RNAi cell line (not shown), but observed no significant size difference for p67-labeled lysosomes between BSF wild-type, ATG24 RNAi non-induced and ATG24 RNAi 72 h induced cells.Having ruled out the enlarged compartment labeled with concanavalin A in ATG24 RNAi cells as a swollen lysosome, we turned to electron microscopy which unambiguously identified enlarged structures as swollen flagellar pockets (Fig 5; compare panels B and C). An up to four-fold increase in sectioned diameter could be observed in some cells, indicating a >50-fold volume increase. However, we noticed considerable heterogeneity in the extent of flagellar pocket swelling, likely attributed to differences in ATG24 levels between individual RNAi cells. Partial knockdown with heterogeneity in the resulting phenotypic effects in individual trypanosomes is a well-known phenomenon. Considering that concanavalin A labeling was restricted to the flagellar pocket in cells where this structure was enlarged, we also conclude that these cells suffer an important block of bulk endocytosis. Note also that autophagy is seen in panel D, where cellular components including two glycosomes are observed surrounded by a membrane in this single section.
Fig 5
Ultrastructural alterations induced in T. brucei BSF by ATG24 silencing.
Electron microscopy of BSF wild-type cells (A, B) and BSF ATG24 RNAi cells after 72 h of RNAi induction (C, D). The two characteristic effects of ATG24 silencing are (i) enlargement of the flagellar pocket (FP) shown in C, D; compare B with C (notice different scale bars); insert in C better shows a cross-section of the flagellum; and (ii) autophagy [D]. The large vesicle, painted in green, has a single limiting membrane and heterogeneous content including two well-recognizable entrapped glycosomes (G’), undistinguishable from free glycosomes (G) in the cytosol. This structure thus demonstrates active autophagy of glycosomes. The two arrows indicate CV (clathrin-coated vesicles): notice the contrast, thickness and indentation regularity typical of clathrin coat indicated by the black arrow, while the white arrow points to a suggestive additional CV profile. These structures suggest (some) preservation of endocytic entry. All scale bars: 0.5 μm.
Ultrastructural alterations induced in T. brucei BSF by ATG24 silencing.
Electron microscopy of BSF wild-type cells (A, B) and BSF ATG24 RNAi cells after 72 h of RNAi induction (C, D). The two characteristic effects of ATG24 silencing are (i) enlargement of the flagellar pocket (FP) shown in C, D; compare B with C (notice different scale bars); insert in C better shows a cross-section of the flagellum; and (ii) autophagy [D]. The large vesicle, painted in green, has a single limiting membrane and heterogeneous content including two well-recognizable entrapped glycosomes (G’), undistinguishable from free glycosomes (G) in the cytosol. This structure thus demonstrates active autophagy of glycosomes. The two arrows indicate CV (clathrin-coated vesicles): notice the contrast, thickness and indentation regularity typical of clathrin coat indicated by the black arrow, while the white arrow points to a suggestive additional CV profile. These structures suggest (some) preservation of endocytic entry. All scale bars: 0.5 μm.Since receptor-mediated endocytosis is the only significant route for supply of essential nutrients such as iron and cholesterol in BSF trypanosomes [26,27], we next looked at cell growth. Reproducibly, upon ATG24 RNAi, growth of BSF cells was inhibited, noticeable two days after induction, but this effect was lower for PCFs (Fig 6, note the logarithmic scale). The two-day delay could be due to the time required for (partial) silencing and/or may be explained by a possible exhaustion of iron and/or cholesterolstocks in BSF. For PCF, the marginal growth inhibition could reflect incomplete depletion of the protein by RNAi and the less important role of endocytosis in this stage of the parasite’s life cycle than in the BSF.
Fig 6
Growth curve for ATG24 RNAi cell lines.
Minor growth inhibition by ATG24 silencing in T. brucei BSF (A) and PCF (B). Comparison of WT vs non-induced (NI) or induced (I) ATG24 RNAi cell line. WT–squares, NI–circles, I–triangles. Results are from one representative experiment out of three, giving the following population doubling times (PDT; mean ± SD): bloodstream-form wild-type cells 7.45 ± 0.61 h; ATG24 RNAi NI: 7.66 ± 0.48 h; ATG24 RNAi Ind: 11.51 ± 2.0 h. At 120 h the differences in PDT between BSF WT and ATG24 Ind and between ATG24 NI and ATG24 Ind are statistically significant with p-values of 0.012 in both cases, whereas the value for WT versus ATG24 NI is 0.708 and the difference thus not statistically significant. The PDT for procyclic trypanosomes are: WT, 9.16 ± 1.74 h; ATG24 RNAi NI, 10.17 ± 1.62 h; ATG24 RNAi Ind, 13.65 ± 3.6 h. At 120 h the p-value for differences in PDT of PCF WT versus ATG24 Ind is 0.204, ATG24 NI versus ATG24 Ind is 0.315, and WT versus ATG24 NI is 0.201; none of these differences is statistically significant.
Growth curve for ATG24 RNAi cell lines.
Minor growth inhibition by ATG24 silencing in T. brucei BSF (A) and PCF (B). Comparison of WT vs non-induced (NI) or induced (I) ATG24 RNAi cell line. WT–squares, NI–circles, I–triangles. Results are from one representative experiment out of three, giving the following population doubling times (PDT; mean ± SD): bloodstream-form wild-type cells 7.45 ± 0.61 h; ATG24 RNAi NI: 7.66 ± 0.48 h; ATG24 RNAi Ind: 11.51 ± 2.0 h. At 120 h the differences in PDT between BSF WT and ATG24Ind and between ATG24 NI and ATG24Ind are statistically significant with p-values of 0.012 in both cases, whereas the value for WT versus ATG24 NI is 0.708 and the difference thus not statistically significant. The PDT for procyclic trypanosomes are: WT, 9.16 ± 1.74 h; ATG24 RNAi NI, 10.17 ± 1.62 h; ATG24 RNAi Ind, 13.65 ± 3.6 h. At 120 h the p-value for differences in PDT of PCF WT versus ATG24Ind is 0.204, ATG24 NI versus ATG24Ind is 0.315, and WT versus ATG24 NI is 0.201; none of these differences is statistically significant.
ATG8.1 and ATG8.2 as markers of autophagy in T. brucei
To next address the key question as to whether ATG24 silencing impacted on autophagy, we first evaluated ATG8.1 and ATG8.2 isoforms as autophagosome markers in T. brucei. Atg8/LC3, a classical autophagosomal marker protein, is conserved in all organisms where autophagy takes place. Atg8/LC3 function normally requires the proteolytic activity of Atg4/ATG4 to expose a C-terminal glycine residue that binds to phosphatidylethanolamine (PE) at the autophagosomal membrane. T. brucei possesses three different homologs of the single ATG8yeast gene, named ATG8.1 (Tb927.7.5900 also known as ATG8A in TriTrypDB), ATG8.2 (Tb927.7.5910 or ATG8B) and ATG8.3 (Tb927.7.3320 or ATG12). The amino-acid sequences of the first two proteins are 80% identical, differing mainly in their N-terminal region, whereas the third is very different. Importantly, ATG8.1 exposes its C-terminal glycine and apparently does not require the proteolytic activity of ATG4 for interaction with the developing autophagosomal membrane. There is no report of a detrimental effect of overexpression of Atg8/LC3 proteins, however a recent paper surprisingly reported that T. brucei lacking ATG8.1 or ATG8.2 survive better when exposed to starvation conditions [28]. T. bruceiATG8 has been shown to participate in autophagy and to be a suitable marker for following the process [28-30].To study autophagy in the parasite, we used two procyclic cell lines in which genome-inserted GFP-tagged ATG8.1 or ATG8.2 were constitutively expressed under the control of a PCF-specific procyclin promoter (constructs kindly provided by R. Schmidt and Dr P. Bütikofer, Bern, Switzerland). BSF cells possessing this construct were able to express the GFP-tagged proteins when placed in differentiation medium (not shown). In the PCF, autophagy was quantified by counting cells displaying fluorescent puncta, as an indication of GFP-ATG8 association with autophagosomes. Both transfected PCF cell lines showed dotty fluorescence as early as 15 min after transfer into PBS to induce starvation, confirming that both isoforms can participate in autophagosome formation in T. brucei and are valid autophagosomal markers in this organism (Fig 7A). Moreover, the levels of both ATG8 isoforms decreased upon prolonged incubation in PBS, as would be expected to result from lysosomal degradation in autophagy-inducing conditions (S2B Fig).
Fig 7
ATG24 depletion in T. brucei results in an increased number of ATG8-associated puncta.
A) Validation of autophagosome labeling in T. brucei. Starvation-induced dotty labeling with GFP-ATG8.1 or GFP-ATG8.2 upon transfer of transfected PCF cells from control medium (left) to PBS for 15 min (right). All scale bars: 5 μm. B) Quantification of autophagy upon ATG24 silencing in PCF trypanosomes. Comparison of the percentage of increase in number of cells displaying puncta labeled for GFP-ATG8.1 or GFP-ATG8.2 before and after transfer to PBS of non-induced (NI) and induced (I) cells in two separate experiments (Exp1 with 15 min incubation in PBS and Exp2 with 30 min incubation in PBS); 50 to 200 cells were counted in each condition. All cells were fixed in the same manner in order to minimize different effects caused by fixation. Selected were only cells that had retained their structure and in which there was visible fluorescence. The fluorescence distribution in whole cells was analyzed and cells displaying fluorescent puncta versus cells in which GFP-ATG8 had only a cytosolic distribution were counted. C) Quantification of autophagy upon ATG24 silencing in BSF cells. Comparison of the percentage of increase in number of cells displaying puncta associated to GFP-ATG8.1 or GFP-ATG8.2 before and after 24 h in DTM in vitro differentiation medium in wild-type (WT), non-induced (NI) and induced (Ind) cells in two separate experiments (Exp1 and Exp2); at least 100 cells were counted in each condition. After harvesting, the cells were treated and analyzed as in the experiments shown in panel B.
ATG24 depletion in T. brucei results in an increased number of ATG8-associated puncta.
A) Validation of autophagosome labeling in T. brucei. Starvation-induced dotty labeling with GFP-ATG8.1 or GFP-ATG8.2 upon transfer of transfected PCF cells from control medium (left) to PBS for 15 min (right). All scale bars: 5 μm. B) Quantification of autophagy upon ATG24 silencing in PCF trypanosomes. Comparison of the percentage of increase in number of cells displaying puncta labeled for GFP-ATG8.1 or GFP-ATG8.2 before and after transfer to PBS of non-induced (NI) and induced (I) cells in two separate experiments (Exp1 with 15 min incubation in PBS and Exp2 with 30 min incubation in PBS); 50 to 200 cells were counted in each condition. All cells were fixed in the same manner in order to minimize different effects caused by fixation. Selected were only cells that had retained their structure and in which there was visible fluorescence. The fluorescence distribution in whole cells was analyzed and cells displaying fluorescent puncta versus cells in which GFP-ATG8 had only a cytosolic distribution were counted. C) Quantification of autophagy upon ATG24 silencing in BSF cells. Comparison of the percentage of increase in number of cells displaying puncta associated to GFP-ATG8.1 or GFP-ATG8.2 before and after 24 h in DTM in vitro differentiation medium in wild-type (WT), non-induced (NI) and induced (Ind) cells in two separate experiments (Exp1 and Exp2); at least 100 cells were counted in each condition. After harvesting, the cells were treated and analyzed as in the experiments shown in panel B.
ATG24 is a negative regulator of autophagy and in vitro differentiation
To assess if TbATG24 has a role in autophagy, the effect of its silencing on the response to starvation was tested by measuring the percentage of cells displaying GFP-ATG8.1- or GFP-ATG8.2-labeled puncta. In two independent experiments performed by exposing cells to starvation conditions for 15 or 30 min, this percentage was increased upon ATG24 silencing in PCF expressing GFP-ATG8.1, but not detectably for GFP-ATG8.2 (Fig 7B). The observed increase in number of cells displaying puncta in starvation conditions in the absence of ATG24 was approximately 50% after 15 min of starvation. When the cells were exposed for 30 min to starvation, the increase in the number of cells displaying puncta could reach 100%. Efficient differentiation of BSF cells is expected to trigger expression of the procyclin promoter-controlled GFP-ATG8.1 and GFP-ATG8.2. We thus scored the number of cells expressing GFP-ATG8.1 or GFP-ATG8.2, 24 h after transferring BSF cells to DTM, a medium allowing trypanosomes to differentiate. The absence of ATG24 was associated with a higher number of cells presenting puncta (Fig 7C).The increase in ATG8 puncta may either indicate an increase of entry in autophagy or a block in the delivery of autophagosomes to the lysosome. It has been shown that transferring PCF cells from culture medium to PBS causes an increase in lysosomal size and colocalization of glycosomal proteins with the lysosomal marker p67 [15]. It is possible that the increase in GFP-ATG8 puncta caused by ATG24 depletion is not directly related to a role in autophagy, but a secondary effect of its role in endocytosis. Endocytosis in ATG24 depleted PCF cells was not investigated. However, the endocytosis rate in the PCF is much slower than in the BSF, where it is important not only for nutrient uptake but also for a very rapid (every 12 min) turnover of the entire surface coat to clear it from attached antibodies [31,32]. In view of the fast and important effect of ATG24 depletion on autophagy induction in PCF where endocytosis is not as relevant as it is for BSF, we consider therefore most likely that the observed effects are caused by a role of ATG24 in autophagy.Since ATG24 silencing favored autophagy, we finally looked whether this was linked with a promotion of differentiation, using morphological and biochemical criteria. As shown by morphological scoring in Fig 8A, ATG24 silencing promoted by approximately 3-fold the conversion of LS into PCF-like as compared to wild-type cells under in vitro differentiation conditions (as seen also in Fig 7C). We also followed differentiation in cells overexpressing GFP-ATG8.1 or GFP-ATG8.2, using constructs in which expression of the tagged protein is controlled by a PCF-specific promoter. After 24 h in differentiation medium the BSF cells indeed expressed GFP-tagged ATG8.1 and GFP-ATG8.2 (western blots for GFP-ATG8.2 are shown in S2C Fig). Quite interestingly, ATG8.1 or ATG8.2 overexpression instead considerably slowed down differentiation in the absence of ATG24 silencing. This indicated that ATG8 overexpression by itself strongly impaired differentiation, but also that this effect could be overcome by ATG24 RNAi induction, providing additional evidence for a link between autophagy and differentiation. As a biochemical criterion, we used the induction of pyruvate, phosphate dikinase (PPDK; a glycosomal enzyme also known by its systematic name ATP:pyruvate, phosphate phosphotransferase) (Fig 8B), since this enzyme is known to be expressed in PCF but not in BSF cells [33]. This seems to confirm that absence of ATG24 increases the rate of differentiation (as seen by the presence of the PCF marker PPDK). Moreover, cells expressing GFP-ATG8.2 appeared to differentiate faster than cells expressing GFP-ATG8.1, as was evidenced by a higher level of PPDK (Fig 8B). This conclusion was corroborated by the observation of a more developed mitochondrion, by immunofluorescence, using acetate:succinate CoA-transferase (ASCT) as a marker, as observed after 72 h incubation in differentiation medium (Fig 8C). Mitochondrial development is a characteristic of PCF cells. Together, the data in Fig 8 support the notion that differentiation of trypanosomes expressing GFP-ATG8.2, after 72 h in differentiation medium, is more efficient than that of trypanosomes expressing GFP-ATG8.1.
Fig 8
ATG24 silencing accelerates T. brucei differentiation.
A) Morphological evidence. Immunofluorescence image at the upper left compares the typical appearance of a BSF (at left) and a PCF trypanosome (at right) labeled with antiserum against phosphoglycerate kinase (PGK). Quantification of differentiation for wild-type (WT) cells and ATG24 RNAi trypanosomes first induced for 48 h, then transferred to in vitro differentiation medium for 48 h. PCF-like morphology is seen in 31% ± 14% of the wild-type cells, but 93% ± 9% of ATG24 RNAi cells. 50 to 400 cells were counted for each sample from three independent experiments (p value = 0.002). B) PPDK expression was assayed by western blot analysis after 72 h in differentiation medium for wild-type and ATG24 RNAi non-induced (NI) or induced (Ind) trypanosomes expressing GFP-ATG8.1 or GFP-ATG8.2 as indicated. Partial depletion of ATG24 can be observed in these cells. ZFP3 is a loading marker, i.e. a protein known to remain rather constant during differentiation. C) An illustration of mitochondrial morphology, as revealed by ASCT staining, in wild-type BSF and PCF cells (as controls), BSF cells expressing GFP-ATG8.1 or GFP-ATG8.2 with and without ATG24 RNAi 48 h induced before in vitro differentiation (72 h). ASCT (red), DNA (blue, DAPI). Note the developed mitochondrion of the PCF cells in contrast to the BSF trypanosomes. After 72 h in differentiation conditions, the cells expressing GFP-ATG8.2 have a more developed mitochondrion than cells expressing GFP-ATG8.1, while in cells depleted for ATG24 there is no significant difference between those expressing tagged ATG8.1 and ATG8.2. All scale bars: 0.5 μm.
ATG24 silencing accelerates T. brucei differentiation.
A) Morphological evidence. Immunofluorescence image at the upper left compares the typical appearance of a BSF (at left) and a PCF trypanosome (at right) labeled with antiserum against phosphoglycerate kinase (PGK). Quantification of differentiation for wild-type (WT) cells and ATG24 RNAi trypanosomes first induced for 48 h, then transferred to in vitro differentiation medium for 48 h. PCF-like morphology is seen in 31% ± 14% of the wild-type cells, but 93% ± 9% of ATG24 RNAi cells. 50 to 400 cells were counted for each sample from three independent experiments (p value = 0.002). B) PPDK expression was assayed by western blot analysis after 72 h in differentiation medium for wild-type and ATG24 RNAi non-induced (NI) or induced (Ind) trypanosomes expressing GFP-ATG8.1 or GFP-ATG8.2 as indicated. Partial depletion of ATG24 can be observed in these cells. ZFP3 is a loading marker, i.e. a protein known to remain rather constant during differentiation. C) An illustration of mitochondrial morphology, as revealed by ASCT staining, in wild-type BSF and PCF cells (as controls), BSF cells expressing GFP-ATG8.1 or GFP-ATG8.2 with and without ATG24 RNAi 48 h induced before in vitro differentiation (72 h). ASCT (red), DNA (blue, DAPI). Note the developed mitochondrion of the PCF cells in contrast to the BSF trypanosomes. After 72 h in differentiation conditions, the cells expressing GFP-ATG8.2 have a more developed mitochondrion than cells expressing GFP-ATG8.1, while in cells depleted for ATG24 there is no significant difference between those expressing tagged ATG8.1 and ATG8.2. All scale bars: 0.5 μm.The larger number of autophagosomes detected in PCF trypanosomes of the GFP-ATG8.1 cell line compared to the GFP-ATG8.2 cell line upon starvation (see above) might seem contradictory with the observation of a more efficient differentiation of the BSF cell line expressing GFP-ATG8.2, inferring that this efficient differentiation is the result of a higher autophagy rate. Two explanations can be postulated. First, it is possible that the two isoforms of ATG8 act differently in general autophagy and in the possibly controlled type of autophagy that takes place in T. brucei during its differentiation. Similar divergent roles have been observed for the distinct ATG8 families in Leishmania major [34]. Alternatively, ATG8.2 may indeed be more efficient than ATG8.1 in participating in autophagy causing an earlier appearance of a peak in the number of autophagosomes to which this protein is associated than in the cells expressing AGT8.1. At the time point at which cells were analyzed in our experiments, the higher number of autophagosomes labeled with ATG8.1 could reflect the delayed peak in the number of these autophagosomes. Herman et al. [15] reported an increase in the colocalization of glycosomes and the lysosomal marker p67 as soon as 10 min after placing procyclic cells in PBS, indicating that autophagy is rapidly upregulated when these cells are starved.Furthermore, when BSF cells were incubated in differentiation medium for 24 h, the percentage of cells undergoing autophagy was increased upon ATG24 RNAi induction for 48 h as compared to wild-type and non-induced cells (Fig 7C). This might be considered as a strong argument for a genetic link between autophagy and stage differentiation, as will be discussed below.
Discussion
The life cycle of T. brucei involves several stages successively adapted to the mammalian bloodstream and the midgut and salivary glands of the tsetse fly. Adaptation of T. brucei from each stage to the next one involves well-defined morphological and metabolic changes [35]. Our previous identification of colocalization of glycosomes (labeled by aldolase) with a lysosome marker (p67) in all cells differentiating from SS BSF to PCF glycosomes indicates that the population of glycosomes are turned over during the parasite’s differentiation [15], an observation for which autophagy is an attractive explanation. To test this hypothesis at the molecular level, we selected ATG24, because its counterpart in yeast is required for induction of specific autophagy, including pexophagy [21,22].After having performed most of our work on the role of the protein encoded by Tb927.9.13380, identified by us as the equivalent of yeastATG24, we became aware of the paper by Koumandou et al. [23] who had characterized this protein as the trypanosomatid counterpart of Vps5/SNX1. To assess if our previous identification was correct, we created evolutionary trees, using three different methods, with Tb927.9.13380 and PX domain-containing proteins from various organisms. This analysis suggested that Tb927.9.13380 is more closely related to Atg24/SNX4 than to Vps5/SNX1. The concordance in topology between trees calculated using different algorithms supports this conclusion despite the generally low bootstrapping values found.We found that T. bruceiATG24 is expressed in both LS-BSF and in PCF cells, with slightly higher expression levels in the former. ATG24 apparently distributes in two pools, the cytosol and puncta, to which they are recruited in a PI3K/VPS34-dependent process, suppressed by wortmannin or upon VPS34 silencing, as is the case for yeastAtg24 and their mammalian homolog sorting nexin 4 (SNX4) [22,36]. Some of these puncta were identified as endocytic vesicles, based on their prevalent location between the nucleus and kinetoplast and vital labeling by internalized transferrin [37].In our experiments, ATG24 silencing in T. brucei did not severely affect cell growth of either BSF or PCF cells. This observation contrasts markedly with those of Koumandou et al. [23] who reported the protein to be essential for T. brucei, based on BSF death upon ATG24 RNAi. In our experiments, ATG24 RNAi was compatible with survival and even growth although at a slower pace, likely due to partial silencing in our experiments (e.g. see S2A Fig and Fig 8B). The different extent of knockdown could be caused by the different vectors used, the hairpin-RNA encoding pHD677-based construct and a p2T7-based one using opposing promoters, in the work by us and Koumandou et al., respectively. Nonetheless, long-slender BSF cells partially depleted for ATG24 showed clear morphological defects, such as flagellar pocket enlargement in about one third of the cells, and functional impairment of receptor-mediated endocytosis of transferrin. In contrast, the uptake of concanavalin A was not qualitatively affected in most of our RNAi cells, raising the possibility of a specific effect on transferrin receptor recycling. This is in agreement with the key role of the ATG24 ortholog in mammalian cells, known as SNX4, in transferrin receptor recycling [24,38]. Importantly, transferrin import into cells is not associated with retromer components [39-42], another indication that the protein described by us as T. bruceiATG24 is more closely related to Atg24/SNX4 than to Vps5/SNX1.Conceivably, the functions of Tb927.9.13380 encompass both those that are Atg24/SNX4-like, as indicated by its observed role in transferrin import and autophagy (see also below) and those elsewhere carried out by Vps5/SNX1 as observed by Koumandou and colleagues [23]. Possibly, the ancestral role of the protein was in endocytosis. ATG24 then acquired an additional, very different role in autophagy in yeasts and trypanosomatids (see below). One could further speculate that either Vps5/SNX1 was secondarily lost from the trypanosome, with Atg24/SNX4 taking over its function, or that trypanosomatids never possessed it. Based on the phylogenetic analysis and the taxonomic data of Koumandou et al. [23], we cautiously favor the former explanation. The function of the second SNX-like protein detected by our search and indicated in the phylogenetic tree (Tb927.7.4500) remains unknown.Besides phylogenetic analysis, the notion that Tb927.9.13380 functions as an ATG24 is strongly supported by its involvement in autophagy. Both BSF and PCF trypanosome populations with knocked-down protein expression exhibited a higher proportion of cells presenting autophagosomes than wild-type and non-induced cells, and under two different autophagy-inducing conditions: transfer of PCF cells from rich medium into PBS and in vitro differentiation of BSF cells. In yeast cells, Atg24 interacts with components of the Atg1 autophagy-inducing complex and is required for several specific types of autophagy including pexophagy, mitophagy and cytoplasm-to-vacuole targeting of vacuolar enzymes, while its absence has no effect on general autophagy. Our data clearly show that T. bruceiATG24 has a role in general autophagy, quite different from that of its ortholog in yeast. In P. pastoris and S. cerevisiae, Atg24 is required for pexophagy. We found that depletion of TbATG24 affects autophagy during general starvation. However, the ATG24 RNAi-induced population had more cells undergoing autophagy than non-induced cells. This could indicate that in T. bruceiATG24 exerts a suppressor role on autophagy, since autophagy is enhanced when this negative effector is depleted.It has been reported that both endocytosis and autophagy levels increase during differentiation of T. brucei, the former process even to surprisingly high levels in the SS stage [43]. Although our in vitro assay did not specifically address this stage, it provided also indications for increased autophagy during differentiation. Moreover, our work supports the notion that ATG24 is involved in both autophagy and endocytosis, but with opposing effects; endocytosis is reduced in cells partially depleted for the protein, whereas autophagy is increased and differentiation takes place faster than in wild-type cells.Our observations on T. bruceiATG24 are also remarkably similar to those recently reported for TBC1D14 in mammalian cells, where it is located on recycling endosomes and involved in transferrin uptake, but acts as a negative regulator of starvation-induced autophagy. Interestingly, upon amino acid starvation, TBC1D14 relocalizes to the Golgi complex [44]. In BSF T. brucei, membrane recycling in the flagellar pocket takes place at an extremely high rate [26], which likely explains why imbalanced, but not arrested endocytic trafficking could result in such dramatic pocket enlargement. The functional consequences for the parasite deserve to be studied in more detail.Of note, a recent high-throughput assay identified that, along with other components of the endocytic system and lysosomal proteins, ATG24 (Tb927.9.13380) is involved in facilitating the uptake of suramin, the recommended drug for the treatment of first-stage sleeping sickness caused by T. b. rhodesiense [45]. The drug cannot passively cross the membrane due to its large size and high negative charge, and its uptake and delivery to the lysosome seem to involve ATG24 as well as the surface protein ISG75.The strong acceleration of BSF differentiation upon ATG24 silencing is a major result of our study. A linkage with promotion of autophagy is tempting, although independent effects cannot be excluded. In contrast, overexpression of GFP-ATG8.1 or GFP-ATG8.2 under the strong constitutive procyclin promoter slowed down differentiation in the absence of ATG24 silencing. These observations indicate that excess ATG8 in T. brucei may be deleterious, either because autophagy becomes uncontrolled so as to cause excessive degradation of important cytosolic material or organelles, or due to a dominant-negative effect. However, the correct localization to puncta and the widespread use of GFP-tagged ATG8 indicate that the first explanation is more likely. Our observations appear to be in good agreement with a recent study showing that silencing either ATG8.1 and/or ATG8.2 in trypanosomes increased resistance to starvation [28]. However, reversion of growth inhibition upon ATG24 silencing argues against a mere toxic effect and rather points to interaction with the autophagic machinery. Unfortunately, we were not able to measure the autophagy rate in wild-type cells without the tag and therefore could not determine if the cells expressing the tagged ATG8 had a higher or lower autophagy rate when compared to wild-type trypanosomes. The reason why the GFP tag-expressing cells are less successful in differentiating remains unclear.The different effects of the two ATG8 isoforms on autophagy and the differentiation rate deserve some comment. Since both are expressed from the same genomically-inserted vector, similar expression levels should be expected; yet we observed a lower level of ATG8.1 than ATG8.2. The difference is more likely related to a different control by ATG4 peptidase before interaction with the forming phagophore membrane. Indeed, the C-terminal cysteine residue of ATG8.2 likely needs processing by the peptidase activity of ATG4 in contrast to ATG8.1 that has its C-terminal glycine residue already exposed.Taken together we conclude that autophagy and differentiation are closely linked in T. brucei and that ATG24 acts as a repressor of autophagy and has an effect on ATG8, thereby controlling the induction or intensity of the process.
Materials and Methods
Trypanosomes and growth conditions
For all experiments, we used monomorphic BSF and PCF cells of T. brucei Lister 427, cell line 449 (gift from Prof. C. Clayton, Heidelberg) [46]. These parasites constitutively express the Escherichia colitetracycline (Tet) repressor gene from a chromosomally integrated plasmid pHD449, that also endows phleomycin resistance. This cell line is metabolically indistinguishable from the wild type. BSF stage parasites were maintained in HMI-9 medium supplemented with 10% heat-inactivated fetal calf serum (Invitrogen, Gibco-10437-028) as well as 0.18 μg/mL phleomycin (Cayla, ant-ph) and incubated at 37°C under water-saturated air with 5% CO2. PCF cells were cultured in SDM79 medium containing 15% fetal calf serum and 0.5 μg/mL phleomycin, at 28°C under water-saturated air with 5% CO2. Experiments were performed with cells in the exponential phase of growth, i.e. < 2x106 cells/mL for the BSF and <5x107 cells/mL for the PCF.A VPS34 RNAi derivative of the BSF T. brucei 449 cell line [46] has been prepared previously in our laboratory (M. Herman and PM, unpublished data). This cell line, harboring the genomically integrated vector pHD1336 containing a fragment of the VPS34 gene, has shown a severely reduced growth rate upon VPS34 depletion. In the study reported here, the cell line was cultured in the presence of 5 μg/mL blasticidin (Invitrogen, R21001) to maintain selection pressure. VPS34 RNAi was induced for 24 h before samples were collected for immunofluorescence.
Identification of the sequence for T. brucei ATG24, phylogenetic analysis
The identification of the sequence for the trypanosomatids putative homologs of several yeast ATGs including ATG24 has been described by Herman et al. [14]. The gene (TriTryp database: http://tritrypdb.org/tritrypdb/, accession code: Tb927.9.13380, formerly Tb09.211.4240) codes for a protein of approximately 42.8 kDa that contains a Phox (PX) homology domain in its N-terminal region and a BAR (Bin/Amphiphysin/Rvs) in its C-terminal domain. It is 24% identical to its yeast counterpart.To determine evolutionary relationships between the candidate TbATG24 and other proteins comprising both a PX and BAR domain in T. brucei and some other organisms (S. cerevisiae, human, Drosophila melanogaster and Caenorhabditis elegans), their sequences were first aligned for optimal positional identity. Terminal regions upstream of the PX domain and downstream of the BAR domain which were clearly non-homologous were trimmed. The relationships between the truncated sequences were then analyzed by three different methods: the Neighbor-Joining (NJ) method [47], the Minimum Evolution (ME) method [48] and the Maximum Parsimony (MP) method [49]. The analysis involved 27 amino-acid sequences. There were a total of 629 positions in the final dataset. Evolutionary analyses were conducted in MEGA5 [50]. In all three cases, a bootstrap consensus tree was inferred from 500 replicates. When the evolutionary history was inferred using the NJ method, an optimal tree with the sum of branch length = 17.12554452 was prepared. The evolutionary distances were computed using the p-distance method [51] and are expressed in the units of the number of base differences per site. The ME tree was searched using the Close-Neighbor-Interchange (CNI) algorithm [51] at a search level of 1. The NJ algorithm was used to generate the initial tree. In the MP analysis, the most parsimonious tree with length = 5185 was used. The consistency index is (0.638254), the retention index is (0.449044), and the composite index is 0.296880 (0.286604) for all sites and parsimony-informative sites (in parentheses). The MP tree was obtained using the Close-Neighbor-Interchange algorithm [51] with search level 1 in which the initial trees were obtained with the random addition of sequences (10 replicates).
Protein expression and antiserum production
The complete ATG24 gene sequence was amplified by PCR using Phusion polymerase (New England BioLabs Inc., M0530S) and the following pair of primers: 5’-CCACATTCTGAAAATGTCTTTGAGTTCCGT-3’ (forward, containing a NdeI restriction site, shown underlined and the start codon of the gene italicized) and 5’-CCATCTCGAG
CTAATCGTCATCAATCAAATG-3’ (reverse, containing a XhoI restriction site, shown underlined and the stop codon of the gene italicized). The amplified product was purified and ligated into the expression vector pET28a (Novagen, 69864–3), that allows the expression of the protein with a N-terminal (His)6-tag. Purified recombinant protein was used for rabbit immunization to raise a polyclonal antiserum (Gentaur).
Preparation of DNA constructs
A construct for the expression of ATG24 with at its C-terminus fused to GFP was made by PCR, using the following primers: (forward) 5’-CCCAAGCTT
ATGTCTGAAAATGTCTTTGAGTTC-3’ (HindIII site underlined and start codon italicized) and (reverse) 5’-AGGGGATCCATCGTCATCAATCAAATGGT-3’ (no stop codon, BamHI site underlined) and GoTaq DNA polymerase (Promega, M3175). The amplified PCR product was inserted into pGN1, a vector that can be integrated into the T. brucei chromosome and codes for a tetracycline-inducible GFP that can be expressed as a tag fused to the C-terminus of the protein coded by the DNA insert [52]. BSF cells were transfected using the method described by McCulloch et al. [53] and transfected cells were selected by their resistance to 5 μg/mL hygromycin (Sigma-Aldrich, H7772-1G). Transfected cells were maintained under hygromycin selection.The T. bruceiATG24 RNAi construct was made using the pHD677 vector. A region of the gene consisting of 486 bp and a 50 bp shorter and complementary region were amplified from the T. brucei genome using the primers: (forward sense) 5'-GTAAAGCTTCCTGCATGAATTTGGTGTTGC–3' (HindIII site underlined), (forward antisense) 5'–TTACTCGAGTCTGCAGGTCAGCAAACAT–3' (XhoI site underlined), (reverse sense) 5'–TTACTCGAGCACGATGGAAGCGATGAATTT–3' (XhoI site underlined), (reverse antisense) 5'–GTAGGATCCCCTGCATGAATTTGGTGTT-3' (BamHI site underlined). Upon transfection, the NotI linearized pHD677 vector will become inserted into a transcriptionally silent ribosomal RNA gene repeat spacer of the parasite's genome. As there are several positions where the plasmid can be inserted, and more than one plasmid can be inserted, the intensity of the RNAi phenotype may vary in different clones. Selection and maintenance of positive clones was done using hygromycin at 5 μg/mL for bloodstream-form cells and at 50 μg/mL for procyclics. Induction of RNAi was achieved by adding tetracycline at 1 μg/mL and 5 μg/mL for bloodstream- and procyclic-form trypanosomes, respectively. Experiments were performed using mid-log phase cultures.For expression of GFP-tagged ATG8.1 and ATG8.2, BSF and PCF wild-type and ATG24-RNAi cells were transfected with EGFP-tagged TbATG8.1 and TbATG8.2 in the vector pG-EGFP-ΔLIIγ. These two plasmids were kindly provided by Remo Schmidt and Dr Peter Bütikofer (Bern, Switzerland). The linearized vector can integrate upstream of the tandemly-arranged procyclin genes and is controlled by a procyclin promoter. Consequently, the GFP-tagged proteins are constitutively expressed in PCF cells. Positive clones were selected by their resistance to G418 (Invitrogen, Gibco-11811-023) and maintained under G418 selection at a 15 μg/mL for BSF and 50 μg/mL for PCF. Although BSF cell lines expressed undetectable GFP levels by western blotting, dotty fluorescence could be observed by confocal microscopy.
Confocal microscopy
BSF wild-type and ATG24 RNAi cells induced for 48 h were harvested while in the exponential phase of growth by centrifugation at 1,000 x g for 10 min at 4°C. The cells were washed in FCS-free HMI-9 with 1% BSA and resuspended in the same medium. Samples were incubated at 37°C for up to 30 min to assure the presence of ligand-free receptors, then allowed to take up Alexa568-transferrin or Alexa594-concanavalin A (each 5 μg/mL) (Life Technologies, T23365 and C11253, respectively) for up to 30 min, then placed on ice, washed in FCS-free HMI-9 with 1% BSA and processed for fluorescence microscopy.After uptake, cells were washed in cold vPBS (Voorheis’ modified PBS, containing 46 mM sucrose and 10 mM glucose), and slides were mounted with DAKO (Agilent Technologies, S302380).For immunofluorescence, trypanosome cultures were centrifuged at 2,200 x g, resuspended in PBS, fixed in 8% formaldehyde and permeabilized with 0.1% Triton X-100. After centrifugation and resuspension in PBS, cells were placed on poly-L-lysine treated slides. Blocking was performed with 5% BSA in water; antibodies were diluted in 2% BSA in water at the following dilutions. Rabbit anti-PGK-c (1:1,000), anti-ATG24 (1:400), anti-ASCT (gift from Dr F. Bringaud, Bordeaux; 1:750); mouse monoclonal anti-TPI (1:5,000); Alexa568-anti-rabbit (red; 1:500) and Alexa488-anti-mouse (green; 1:500) (both from Invitrogen) at 1:500. Hoechst 33342 was used at 0.2 μg/mL (324 μM). Slides were mounted with Mowiol 4–88 (Calbiochem, 475904-100GM) or DAKO fluorescent mounting medium and observed in a Zeiss Cell Observer Spinning Disc confocal microscope.For p67 immunofluorescence, trypanosomes were centrifuged at 1,900 x g, resuspended in HMI-9, fixed in 2% formaldehyde and resuspended in PBS. The cells were then placed on silanized slides and permeabilized with 0.2% Nonidet P-40 in PBS. Blocking was done with 1% BSA in PBS and primary (monoclonal anti-p67, kindly provided by Prof. Michael Boshart, Ludwig Maximilians Universität, München) and secondary (Alexa594-anti-mouse, Molecular Probes, A-21205) antibodies were diluted 1:1000 in 1% BSA in PBS. 0.1 μg/mL DAPI was used at a 1:1000 dilution. Slides were mounted with VectaShield (Vector Labs, H-1000) and observed in a personal Delta Vision microscope. Images were analysed with the programs ImageJ or Fiji. When indicated, colocalisation between two markers was quantified as Pearson's correlation coefficient, calculated by the JACoP v2.0 Plugin of ImageJ [54].Quantification of the ATG24-associated fluorescence intensity in a region selected because representing endosomes versus a region with only cytosol in the VPS34 RNAi experiment was done with the Fiji program to assign the mean intensity value for each selected area measured. For each cell a selection was made of an area representing the endosome as well as of a different area representing the cytosol and in each picture also an area representing the background was selected. The intensity value of the background was subtracted from both cytosol and endosome values and then the cytosol value was subtracted from the endosome value. The mean of the final endosome values were compared between WT and VPS34 RNAi 24-h induced cells.
Western blotting
Protein samples were boiled for 5 min in Laemmli loading buffer, size-fractionated by SDS/PAGE and transferred to Amersham Hybond-ECL (GE Healthcare, RPN2020D) membranes. After blocking with 5% milk in PBS for at least 1 h at room temperature or overnight at 4°C under agitation, membranes were incubated with antibodies for 1 h at room temperature or overnight at 4°C under agitation in 1% milk in PBS. The primary antibodies, all raised in rabbits, were used at the following dilutions: ATG24 (1:4,000); RAB11 (1:2,000, gift from Prof. M. Field, Dundee); ZFP3 (1:10,000, gift from Prof. K. Matthews, Edinburgh); PPDK (gift from Dr F. Bringaud, Bordeaux; 1:25,000). As secondary antibody, peroxidase-conjugated goat anti-rabbit IgG; Invitrogen) was used at 1:10,000. After extensive washing in PBS then 0.05% NP40 in PBS, blots were revealed using Pierce ECL western blotting substrate (Thermo Scientific, 32106).
In vitro differentiation
Cultures of BSF wild-type, ATG24 RNAi non-induced and 48 h induced trypanosomes, expressing or not the EGFP-ATG8.1 or EGFP-ATG8.2 constructs, were harvested in their exponential phase of growth at 37°C by centrifugation at 1,000 x g for 5 min. The cells were resuspended in pre-warmed (28°C) Differentiating Trypanosome Medium (DTM) [55] in the presence of 3 mM citrate and 3 mM cis-aconitate (from a 300 mM stock in 25 mM Hepes, pH 7.3), and kept at 28°C. Maintenance of clones was assured by culturing in presence of 1 μg/mL hygromycin and/or 15 μg/mL G418 when needed. RNAi induction was initiated by addition of 1 μg/mL tetracycline.Differentiation was assayed by following the expression of the glycosomal procyclic PPDK, changes in cellular morphology in conjunction with changes in the subcellular localisation of PGK, which is mainly observed as a glycosomal protein (PGK-c) in BSF cells and as a cytosolic protein (PGK-b) in PCF cells.
Autophagy-inducing assays
For general autophagy induction, PCF overexpressing GFP-ATG8.1 or GFP-ATG8.2 were centrifuged and resuspended in pre-warmed (28°C) PBS for up to 3 h. For initiating autophagy in BSF cells, in vitro differentiation was induced. When ATG24 depletion was required, autophagy and differentiation experiments were performed after 48 h of RNAi induction.
Electron microscopy
Cells were collected by centrifugation at 1,000 x g for 10 min at 4°C, washed in PBS (pH 7.3), pelleted and centrifuged again, resuspended in PBS-Ca2+/Mg2+ (PBS, pH 7.0, 3.6 mM CaCl2, 3.0 mM MgCl2) and fixed by 2% glutaraldehyde in phosphate buffer at 4°C for 30 min. Cells were then transferred to veronal buffer and post-fixed with 1% osmium tetroxide in same buffer at 4°C for 1 h. Cells were washed again with veronal buffer, and pelleted in 2% agar. Minced pellet fragments were stained “en bloc” using 0.5% uranyl acetate in veronal buffer, overnight at 4°C and protected from light, then extensively washed, dehydrated in graded ethanol and embedded in Spurr. Ultrathin sections (70 nm) were obtained using a Reichert ultramicrotome and sections were further stained with uranyl acetate and lead citrate for 10 min each. Samples were observed in a transmission electron microscope (Philips, CM12) at 80 kV and images were imported to and analysed in AxioVision software (4.8.2; Zeiss, Germany).
Phylogenetic analysis to identify TbATG24.
Bootstrapped Phylogenetic reconstructions using the Neighbor-Joining (A) and Maximum Parsimony methods (B) of the two PX-BAR-containing proteins from T. brucei (Tb; one of which Tb927.9.13380, is here referred to as TbATG24) and PX-BAR containing proteins from other organisms: Sc–Saccharomyces cerevisiae, Hs–Homo sapiens, Ce–Caenorhabditis elegans, Dm–Drosophila melanogaster. The numbers near the nodes indicate the percentage of replicate trees in which the associated taxa clustered together in the bootstrap test (500 replicates).(TIFF)Click here for additional data file.
Western blots of Trypanosoma brucei.
(A) ATG24expression and depletion in bloodstream (BSF WT, left panel) and procyclic wild-type T. brucei cells (PCF WT, right panel) and RNAi cells Non Induced (NI) and 48 h induced, as assayed with anti-TbATG24; cytosolic GAPDH (cGAPDH) was used as a loading control. The anti-ATG24 recognizes a single 48 kDa band in the lysates of the T. brucei cells. (B) GFP-ATG8.1 and GFP-ATG8.2 expression in procyclic T. brucei cells (PCF) in nutrient-rich medium (SDM79) and after 3 h of incubation in PBS to induce starvation, assayed with anti-GFP. ZFP3 (zinc finger protein 3) was used as a loading control. (C) GFP-ATG8.2 expression in two clones of bloodstream-form (BSF) trypanosomes in HMI9 medium and 24 h or 48 h after induction of their differentiation in DTM medium, as assayed with anti-GFP. Anti-PPDK was used as glycosomal marker, to assess the differentiation of BSF trypanosomes to ‘PCF-like’ cells.(TIFF)Click here for additional data file.
Authors: Qi Zhong; Cheri S Lazar; Hélène Tronchère; Trey Sato; Timo Meerloo; Michele Yeo; Zhou Songyang; Scott D Emr; Gordon N Gill Journal: Proc Natl Acad Sci U S A Date: 2002-05-07 Impact factor: 11.205
Authors: Anuradha Gullapalli; Tiana A Garrett; May M Paing; Courtney T Griffin; Yonghua Yang; JoAnn Trejo Journal: Mol Biol Cell Date: 2004-02-20 Impact factor: 4.138
Authors: Daniel J Klionsky; Amal Kamal Abdel-Aziz; Sara Abdelfatah; Mahmoud Abdellatif; Asghar Abdoli; Steffen Abel; Hagai Abeliovich; Marie H Abildgaard; Yakubu Princely Abudu; Abraham Acevedo-Arozena; Iannis E Adamopoulos; Khosrow Adeli; Timon E Adolph; Annagrazia Adornetto; Elma Aflaki; Galila Agam; Anupam Agarwal; Bharat B Aggarwal; Maria Agnello; Patrizia Agostinis; Javed N Agrewala; Alexander Agrotis; Patricia V Aguilar; S Tariq Ahmad; Zubair M Ahmed; Ulises Ahumada-Castro; Sonja Aits; Shu Aizawa; Yunus Akkoc; Tonia Akoumianaki; Hafize Aysin Akpinar; Ahmed M Al-Abd; Lina Al-Akra; Abeer Al-Gharaibeh; Moulay A Alaoui-Jamali; Simon Alberti; Elísabet Alcocer-Gómez; Cristiano Alessandri; Muhammad Ali; M Abdul Alim Al-Bari; Saeb Aliwaini; Javad Alizadeh; Eugènia Almacellas; Alexandru Almasan; Alicia Alonso; Guillermo D Alonso; Nihal Altan-Bonnet; Dario C Altieri; Élida M C Álvarez; Sara Alves; Cristine Alves da Costa; Mazen M Alzaharna; Marialaura Amadio; Consuelo Amantini; Cristina Amaral; Susanna Ambrosio; Amal O Amer; Veena Ammanathan; Zhenyi An; Stig U Andersen; Shaida A Andrabi; Magaiver Andrade-Silva; Allen M Andres; Sabrina Angelini; David Ann; Uche C Anozie; Mohammad Y Ansari; Pedro Antas; Adam Antebi; Zuriñe Antón; Tahira Anwar; Lionel Apetoh; Nadezda Apostolova; Toshiyuki Araki; Yasuhiro Araki; Kohei Arasaki; Wagner L Araújo; Jun Araya; Catherine Arden; Maria-Angeles Arévalo; Sandro Arguelles; Esperanza Arias; Jyothi Arikkath; Hirokazu Arimoto; Aileen R Ariosa; Darius Armstrong-James; Laetitia Arnauné-Pelloquin; Angeles Aroca; Daniela S Arroyo; Ivica Arsov; Rubén Artero; Dalia Maria Lucia Asaro; Michael Aschner; Milad Ashrafizadeh; Osnat Ashur-Fabian; Atanas G Atanasov; Alicia K Au; Patrick Auberger; Holger W Auner; Laure Aurelian; Riccardo Autelli; Laura Avagliano; Yenniffer Ávalos; Sanja Aveic; Célia Alexandra Aveleira; Tamar Avin-Wittenberg; Yucel Aydin; Scott Ayton; Srinivas Ayyadevara; Maria Azzopardi; Misuzu Baba; Jonathan M Backer; Steven K Backues; Dong-Hun Bae; Ok-Nam Bae; Soo Han Bae; Eric H Baehrecke; Ahruem Baek; Seung-Hoon Baek; Sung Hee Baek; Giacinto Bagetta; Agnieszka Bagniewska-Zadworna; Hua Bai; Jie Bai; Xiyuan Bai; Yidong Bai; Nandadulal Bairagi; Shounak Baksi; Teresa Balbi; Cosima T Baldari; Walter Balduini; Andrea Ballabio; Maria Ballester; Salma Balazadeh; Rena Balzan; Rina Bandopadhyay; Sreeparna Banerjee; Sulagna Banerjee; Ágnes Bánréti; Yan Bao; Mauricio S Baptista; Alessandra Baracca; Cristiana Barbati; Ariadna Bargiela; Daniela Barilà; Peter G Barlow; Sami J Barmada; Esther Barreiro; George E Barreto; Jiri Bartek; Bonnie Bartel; Alberto Bartolome; Gaurav R Barve; Suresh H Basagoudanavar; Diane C Bassham; Robert C Bast; Alakananda Basu; Henri Batoko; Isabella Batten; Etienne E Baulieu; Bradley L Baumgarner; Jagadeesh Bayry; Rupert Beale; Isabelle Beau; Florian Beaumatin; Luiz R G Bechara; George R Beck; Michael F Beers; Jakob Begun; Christian Behrends; Georg M N Behrens; Roberto Bei; Eloy Bejarano; Shai Bel; Christian Behl; Amine Belaid; Naïma Belgareh-Touzé; Cristina Bellarosa; Francesca Belleudi; Melissa Belló Pérez; Raquel Bello-Morales; Jackeline Soares de Oliveira Beltran; Sebastián Beltran; Doris Mangiaracina Benbrook; Mykolas Bendorius; Bruno A Benitez; Irene Benito-Cuesta; Julien Bensalem; Martin W Berchtold; Sabina Berezowska; Daniele Bergamaschi; Matteo Bergami; Andreas Bergmann; Laura Berliocchi; Clarisse Berlioz-Torrent; Amélie Bernard; Lionel Berthoux; Cagri G Besirli; Sebastien Besteiro; Virginie M Betin; Rudi Beyaert; Jelena S Bezbradica; Kiran Bhaskar; Ingrid Bhatia-Kissova; Resham Bhattacharya; Sujoy Bhattacharya; Shalmoli Bhattacharyya; Md Shenuarin Bhuiyan; Sujit Kumar Bhutia; Lanrong Bi; Xiaolin Bi; Trevor J Biden; Krikor Bijian; Viktor A Billes; Nadine Binart; Claudia Bincoletto; Asa B Birgisdottir; Geir Bjorkoy; Gonzalo Blanco; Ana Blas-Garcia; Janusz Blasiak; Robert Blomgran; Klas Blomgren; Janice S Blum; Emilio Boada-Romero; Mirta Boban; Kathleen Boesze-Battaglia; Philippe Boeuf; Barry Boland; Pascale Bomont; Paolo Bonaldo; Srinivasa Reddy Bonam; Laura Bonfili; Juan S Bonifacino; Brian A Boone; Martin D Bootman; Matteo Bordi; Christoph Borner; Beat C Bornhauser; Gautam Borthakur; Jürgen Bosch; Santanu Bose; Luis M Botana; Juan Botas; Chantal M Boulanger; Michael E Boulton; Mathieu Bourdenx; Benjamin Bourgeois; Nollaig M Bourke; Guilhem Bousquet; Patricia Boya; Peter V Bozhkov; Luiz H M Bozi; Tolga O Bozkurt; Doug E Brackney; Christian H Brandts; Ralf J Braun; Gerhard H Braus; Roberto Bravo-Sagua; José M Bravo-San Pedro; Patrick Brest; Marie-Agnès Bringer; Alfredo Briones-Herrera; V Courtney Broaddus; Peter Brodersen; Jeffrey L Brodsky; Steven L Brody; Paola G Bronson; Jeff M Bronstein; Carolyn N Brown; Rhoderick E Brown; Patricia C Brum; John H Brumell; Nicola Brunetti-Pierri; Daniele Bruno; Robert J Bryson-Richardson; Cecilia Bucci; Carmen Buchrieser; Marta Bueno; Laura Elisa Buitrago-Molina; Simone Buraschi; Shilpa Buch; J Ross Buchan; Erin M Buckingham; Hikmet Budak; Mauricio Budini; Geert Bultynck; Florin Burada; Joseph R Burgoyne; M Isabel Burón; Victor Bustos; Sabrina Büttner; Elena Butturini; Aaron Byrd; Isabel Cabas; Sandra Cabrera-Benitez; Ken Cadwell; Jingjing Cai; Lu Cai; Qian Cai; Montserrat Cairó; Jose A Calbet; Guy A Caldwell; Kim A Caldwell; Jarrod A Call; Riccardo Calvani; Ana C Calvo; Miguel Calvo-Rubio Barrera; Niels Os Camara; Jacques H Camonis; Nadine Camougrand; Michelangelo Campanella; Edward M Campbell; François-Xavier Campbell-Valois; Silvia Campello; Ilaria Campesi; Juliane C Campos; Olivier Camuzard; Jorge Cancino; Danilo Candido de Almeida; Laura Canesi; Isabella Caniggia; Barbara Canonico; Carles Cantí; Bin Cao; Michele Caraglia; Beatriz Caramés; Evie H Carchman; Elena Cardenal-Muñoz; Cesar Cardenas; Luis Cardenas; Sandra M Cardoso; Jennifer S Carew; Georges F Carle; Gillian Carleton; Silvia Carloni; Didac Carmona-Gutierrez; Leticia A Carneiro; Oliana Carnevali; Julian M Carosi; Serena Carra; Alice Carrier; Lucie Carrier; Bernadette Carroll; A Brent Carter; Andreia Neves Carvalho; Magali Casanova; Caty Casas; Josefina Casas; Chiara Cassioli; Eliseo F Castillo; Karen Castillo; Sonia Castillo-Lluva; Francesca Castoldi; Marco Castori; Ariel F Castro; Margarida Castro-Caldas; Javier Castro-Hernandez; Susana Castro-Obregon; Sergio D Catz; Claudia Cavadas; Federica Cavaliere; Gabriella Cavallini; Maria Cavinato; Maria L Cayuela; Paula Cebollada Rica; Valentina Cecarini; Francesco Cecconi; Marzanna Cechowska-Pasko; Simone Cenci; Victòria Ceperuelo-Mallafré; João J Cerqueira; Janete M Cerutti; Davide Cervia; Vildan Bozok Cetintas; Silvia Cetrullo; Han-Jung Chae; Andrei S Chagin; Chee-Yin Chai; Gopal Chakrabarti; Oishee Chakrabarti; Tapas Chakraborty; Trinad Chakraborty; Mounia Chami; Georgios Chamilos; David W Chan; Edmond Y W Chan; Edward D Chan; H Y Edwin Chan; Helen H Chan; Hung Chan; Matthew T V Chan; Yau Sang Chan; Partha K Chandra; Chih-Peng Chang; Chunmei Chang; Hao-Chun Chang; Kai Chang; Jie Chao; Tracey Chapman; Nicolas Charlet-Berguerand; Samrat Chatterjee; Shail K Chaube; Anu Chaudhary; Santosh Chauhan; Edward Chaum; Frédéric Checler; Michael E Cheetham; Chang-Shi Chen; Guang-Chao Chen; Jian-Fu Chen; Liam L Chen; Leilei Chen; Lin Chen; Mingliang Chen; Mu-Kuan Chen; Ning Chen; Quan Chen; Ruey-Hwa Chen; Shi Chen; Wei Chen; Weiqiang Chen; Xin-Ming Chen; Xiong-Wen Chen; Xu Chen; Yan Chen; Ye-Guang Chen; Yingyu Chen; Yongqiang Chen; Yu-Jen Chen; Yue-Qin Chen; Zhefan Stephen Chen; Zhi Chen; Zhi-Hua Chen; Zhijian J Chen; Zhixiang Chen; Hanhua Cheng; Jun Cheng; Shi-Yuan Cheng; Wei Cheng; Xiaodong Cheng; Xiu-Tang Cheng; Yiyun Cheng; Zhiyong Cheng; Zhong Chen; Heesun Cheong; Jit Kong Cheong; Boris V Chernyak; Sara Cherry; Chi Fai Randy Cheung; Chun Hei Antonio Cheung; King-Ho Cheung; Eric Chevet; Richard J Chi; Alan Kwok Shing Chiang; Ferdinando Chiaradonna; Roberto Chiarelli; Mario Chiariello; Nathalia Chica; Susanna Chiocca; Mario Chiong; Shih-Hwa Chiou; Abhilash I Chiramel; Valerio Chiurchiù; Dong-Hyung Cho; Seong-Kyu Choe; Augustine M K Choi; Mary E Choi; Kamalika Roy Choudhury; Norman S Chow; Charleen T Chu; Jason P Chua; John Jia En Chua; Hyewon Chung; Kin Pan Chung; Seockhoon Chung; So-Hyang Chung; Yuen-Li Chung; Valentina Cianfanelli; Iwona A Ciechomska; Mariana Cifuentes; Laura Cinque; Sebahattin Cirak; Mara Cirone; Michael J Clague; Robert Clarke; Emilio Clementi; Eliana M Coccia; Patrice Codogno; Ehud Cohen; Mickael M Cohen; Tania Colasanti; Fiorella Colasuonno; Robert A Colbert; Anna Colell; Miodrag Čolić; Nuria S Coll; Mark O Collins; María I Colombo; Daniel A Colón-Ramos; Lydie Combaret; Sergio Comincini; Márcia R Cominetti; Antonella Consiglio; Andrea Conte; Fabrizio Conti; Viorica Raluca Contu; Mark R Cookson; Kevin M Coombs; Isabelle Coppens; Maria Tiziana Corasaniti; Dale P Corkery; Nils Cordes; Katia Cortese; Maria do Carmo Costa; Sarah Costantino; Paola Costelli; Ana Coto-Montes; Peter J Crack; Jose L Crespo; Alfredo Criollo; Valeria Crippa; Riccardo Cristofani; Tamas Csizmadia; Antonio Cuadrado; Bing Cui; Jun Cui; Yixian Cui; Yong Cui; Emmanuel Culetto; Andrea C Cumino; Andrey V Cybulsky; Mark J Czaja; Stanislaw J Czuczwar; Stefania D'Adamo; Marcello D'Amelio; Daniela D'Arcangelo; Andrew C D'Lugos; Gabriella D'Orazi; James A da Silva; Hormos Salimi Dafsari; Ruben K Dagda; Yasin Dagdas; Maria Daglia; Xiaoxia Dai; Yun Dai; Yuyuan Dai; Jessica Dal Col; Paul Dalhaimer; Luisa Dalla Valle; Tobias Dallenga; Guillaume Dalmasso; Markus Damme; Ilaria Dando; Nico P Dantuma; April L Darling; Hiranmoy Das; Srinivasan Dasarathy; Santosh K Dasari; Srikanta Dash; Oliver Daumke; Adrian N Dauphinee; Jeffrey S Davies; Valeria A Dávila; Roger J Davis; Tanja Davis; Sharadha Dayalan Naidu; Francesca De Amicis; Karolien De Bosscher; Francesca De Felice; Lucia De Franceschi; Chiara De Leonibus; Mayara G de Mattos Barbosa; Guido R Y De Meyer; Angelo De Milito; Cosimo De Nunzio; Clara De Palma; Mauro De Santi; Claudio De Virgilio; Daniela De Zio; Jayanta Debnath; Brian J DeBosch; Jean-Paul Decuypere; Mark A Deehan; Gianluca Deflorian; James DeGregori; Benjamin Dehay; Gabriel Del Rio; Joe R Delaney; Lea M D Delbridge; Elizabeth Delorme-Axford; M Victoria Delpino; Francesca Demarchi; Vilma Dembitz; Nicholas D Demers; Hongbin Deng; Zhiqiang Deng; Joern Dengjel; Paul Dent; Donna Denton; Melvin L DePamphilis; Channing J Der; Vojo Deretic; Albert Descoteaux; Laura Devis; Sushil Devkota; Olivier Devuyst; Grant Dewson; Mahendiran Dharmasivam; Rohan Dhiman; Diego di Bernardo; Manlio Di Cristina; Fabio Di Domenico; Pietro Di Fazio; Alessio Di Fonzo; Giovanni Di Guardo; Gianni M Di Guglielmo; Luca Di Leo; Chiara Di Malta; Alessia Di Nardo; Martina Di Rienzo; Federica Di Sano; George Diallinas; Jiajie Diao; Guillermo Diaz-Araya; Inés Díaz-Laviada; Jared M Dickinson; Marc Diederich; Mélanie Dieudé; Ivan Dikic; Shiping Ding; Wen-Xing Ding; Luciana Dini; Jelena Dinić; Miroslav Dinic; Albena T Dinkova-Kostova; Marc S Dionne; Jörg H W Distler; Abhinav Diwan; Ian M C Dixon; Mojgan Djavaheri-Mergny; Ina Dobrinski; Oxana Dobrovinskaya; Radek Dobrowolski; Renwick C J Dobson; Jelena Đokić; Serap Dokmeci Emre; Massimo Donadelli; Bo Dong; Xiaonan Dong; Zhiwu Dong; Gerald W Dorn Ii; Volker Dotsch; Huan Dou; Juan Dou; Moataz Dowaidar; Sami Dridi; Liat Drucker; Ailian Du; Caigan Du; Guangwei Du; Hai-Ning Du; Li-Lin Du; André du Toit; Shao-Bin Duan; Xiaoqiong Duan; Sónia P Duarte; Anna Dubrovska; Elaine A Dunlop; Nicolas Dupont; Raúl V Durán; Bilikere S Dwarakanath; Sergey A Dyshlovoy; Darius Ebrahimi-Fakhari; Leopold Eckhart; Charles L Edelstein; Thomas Efferth; Eftekhar Eftekharpour; Ludwig Eichinger; Nabil Eid; Tobias Eisenberg; N Tony Eissa; Sanaa Eissa; Miriam Ejarque; Abdeljabar El Andaloussi; Nazira El-Hage; Shahenda El-Naggar; Anna Maria Eleuteri; Eman S El-Shafey; Mohamed Elgendy; Aristides G Eliopoulos; María M Elizalde; Philip M Elks; Hans-Peter Elsasser; Eslam S Elsherbiny; Brooke M Emerling; N C Tolga Emre; Christina H Eng; Nikolai Engedal; Anna-Mart Engelbrecht; Agnete S T Engelsen; Jorrit M Enserink; Ricardo Escalante; Audrey Esclatine; Mafalda Escobar-Henriques; Eeva-Liisa Eskelinen; Lucile Espert; Makandjou-Ola Eusebio; Gemma Fabrias; Cinzia Fabrizi; Antonio Facchiano; Francesco Facchiano; Bengt Fadeel; Claudio Fader; Alex C Faesen; W Douglas Fairlie; Alberto Falcó; Bjorn H Falkenburger; Daping Fan; Jie Fan; Yanbo Fan; Evandro F Fang; Yanshan Fang; Yognqi Fang; Manolis Fanto; Tamar Farfel-Becker; Mathias Faure; Gholamreza Fazeli; Anthony O Fedele; Arthur M Feldman; Du Feng; Jiachun Feng; Lifeng Feng; Yibin Feng; Yuchen Feng; Wei Feng; Thais Fenz Araujo; Thomas A Ferguson; Álvaro F Fernández; Jose C Fernandez-Checa; Sonia Fernández-Veledo; Alisdair R Fernie; Anthony W Ferrante; Alessandra Ferraresi; Merari F Ferrari; Julio C B Ferreira; Susan Ferro-Novick; Antonio Figueras; Riccardo Filadi; Nicoletta Filigheddu; Eduardo Filippi-Chiela; Giuseppe Filomeni; Gian Maria Fimia; Vittorio Fineschi; Francesca Finetti; Steven Finkbeiner; Edward A Fisher; Paul B Fisher; Flavio Flamigni; Steven J Fliesler; Trude H Flo; Ida Florance; Oliver Florey; Tullio Florio; Erika Fodor; Carlo Follo; Edward A Fon; Antonella Forlino; Francesco Fornai; Paola Fortini; Anna Fracassi; Alessandro Fraldi; Brunella Franco; Rodrigo Franco; Flavia Franconi; Lisa B Frankel; Scott L Friedman; Leopold F Fröhlich; Gema Frühbeck; Jose M Fuentes; Yukio Fujiki; Naonobu Fujita; Yuuki Fujiwara; Mitsunori Fukuda; Simone Fulda; Luc Furic; Norihiko Furuya; Carmela Fusco; Michaela U Gack; Lidia Gaffke; Sehamuddin Galadari; Alessia Galasso; Maria F Galindo; Sachith Gallolu Kankanamalage; Lorenzo Galluzzi; Vincent Galy; Noor Gammoh; Boyi Gan; Ian G Ganley; Feng Gao; Hui Gao; Minghui Gao; Ping Gao; Shou-Jiang Gao; Wentao Gao; Xiaobo Gao; Ana Garcera; Maria Noé Garcia; Verónica E Garcia; Francisco García-Del Portillo; Vega Garcia-Escudero; Aracely Garcia-Garcia; Marina Garcia-Macia; Diana García-Moreno; Carmen Garcia-Ruiz; Patricia García-Sanz; Abhishek D Garg; Ricardo Gargini; Tina Garofalo; Robert F Garry; Nils C Gassen; Damian Gatica; Liang Ge; Wanzhong Ge; Ruth Geiss-Friedlander; Cecilia Gelfi; Pascal Genschik; Ian E Gentle; Valeria Gerbino; Christoph Gerhardt; Kyla Germain; Marc Germain; David A Gewirtz; Elham Ghasemipour Afshar; Saeid Ghavami; Alessandra Ghigo; Manosij Ghosh; Georgios Giamas; Claudia Giampietri; Alexandra Giatromanolaki; Gary E Gibson; Spencer B Gibson; Vanessa Ginet; Edward Giniger; Carlotta Giorgi; Henrique Girao; Stephen E Girardin; Mridhula Giridharan; Sandy Giuliano; Cecilia Giulivi; Sylvie Giuriato; Julien Giustiniani; Alexander Gluschko; Veit Goder; Alexander Goginashvili; Jakub Golab; David C Goldstone; Anna Golebiewska; Luciana R Gomes; Rodrigo Gomez; Rubén Gómez-Sánchez; Maria Catalina Gomez-Puerto; Raquel Gomez-Sintes; Qingqiu Gong; Felix M Goni; Javier González-Gallego; Tomas Gonzalez-Hernandez; Rosa A Gonzalez-Polo; Jose A Gonzalez-Reyes; Patricia González-Rodríguez; Ing Swie Goping; Marina S Gorbatyuk; Nikolai V Gorbunov; Kıvanç Görgülü; Roxana M Gorojod; Sharon M Gorski; Sandro Goruppi; Cecilia Gotor; Roberta A Gottlieb; Illana Gozes; Devrim Gozuacik; Martin Graef; Markus H Gräler; Veronica Granatiero; Daniel Grasso; Joshua P Gray; Douglas R Green; Alexander Greenhough; Stephen L Gregory; Edward F Griffin; Mark W Grinstaff; Frederic Gros; Charles Grose; Angelina S Gross; Florian Gruber; Paolo Grumati; Tilman Grune; Xueyan Gu; Jun-Lin Guan; Carlos M Guardia; Kishore Guda; Flora Guerra; Consuelo Guerri; Prasun Guha; Carlos Guillén; Shashi Gujar; Anna Gukovskaya; Ilya Gukovsky; Jan Gunst; Andreas Günther; Anyonya R Guntur; Chuanyong Guo; Chun Guo; Hongqing Guo; Lian-Wang Guo; Ming Guo; Pawan Gupta; Shashi Kumar Gupta; Swapnil Gupta; Veer Bala Gupta; Vivek Gupta; Asa B Gustafsson; David D Gutterman; Ranjitha H B; Annakaisa Haapasalo; James E Haber; Aleksandra Hać; Shinji Hadano; Anders J Hafrén; Mansour Haidar; Belinda S Hall; Gunnel Halldén; Anne Hamacher-Brady; Andrea Hamann; Maho Hamasaki; Weidong Han; Malene Hansen; Phyllis I Hanson; Zijian Hao; Masaru Harada; Ljubica Harhaji-Trajkovic; Nirmala Hariharan; Nigil Haroon; James Harris; Takafumi Hasegawa; Noor Hasima Nagoor; Jeffrey A Haspel; Volker Haucke; Wayne D Hawkins; Bruce A Hay; Cole M Haynes; Soren B Hayrabedyan; Thomas S Hays; Congcong He; Qin He; Rong-Rong He; You-Wen He; Yu-Ying He; Yasser Heakal; Alexander M Heberle; J Fielding Hejtmancik; Gudmundur Vignir Helgason; Vanessa Henkel; Marc Herb; Alexander Hergovich; Anna Herman-Antosiewicz; Agustín Hernández; Carlos Hernandez; Sergio Hernandez-Diaz; Virginia Hernandez-Gea; Amaury Herpin; Judit Herreros; Javier H Hervás; Daniel Hesselson; Claudio Hetz; Volker T Heussler; Yujiro Higuchi; Sabine Hilfiker; Joseph A Hill; William S Hlavacek; Emmanuel A Ho; Idy H T Ho; Philip Wing-Lok Ho; Shu-Leong Ho; Wan Yun Ho; G Aaron Hobbs; Mark Hochstrasser; Peter H M Hoet; Daniel Hofius; Paul Hofman; Annika Höhn; Carina I Holmberg; Jose R Hombrebueno; Chang-Won Hong Yi-Ren Hong; Lora V Hooper; Thorsten Hoppe; Rastislav Horos; Yujin Hoshida; I-Lun Hsin; Hsin-Yun Hsu; Bing Hu; Dong Hu; Li-Fang Hu; Ming Chang Hu; Ronggui Hu; Wei Hu; Yu-Chen Hu; Zhuo-Wei Hu; Fang Hua; Jinlian Hua; Yingqi Hua; Chongmin Huan; Canhua Huang; Chuanshu Huang; Chuanxin Huang; Chunling Huang; Haishan Huang; Kun Huang; Michael L H Huang; Rui Huang; Shan Huang; Tianzhi Huang; Xing Huang; Yuxiang Jack Huang; Tobias B Huber; Virginie Hubert; Christian A Hubner; Stephanie M Hughes; William E Hughes; Magali Humbert; Gerhard Hummer; James H Hurley; Sabah Hussain; Salik Hussain; Patrick J Hussey; Martina Hutabarat; Hui-Yun Hwang; Seungmin Hwang; Antonio Ieni; Fumiyo Ikeda; Yusuke Imagawa; Yuzuru Imai; Carol Imbriano; Masaya Imoto; Denise M Inman; Ken Inoki; Juan Iovanna; Renato V Iozzo; Giuseppe Ippolito; Javier E Irazoqui; Pablo Iribarren; Mohd Ishaq; Makoto Ishikawa; Nestor Ishimwe; Ciro Isidoro; Nahed Ismail; Shohreh Issazadeh-Navikas; Eisuke Itakura; Daisuke Ito; Davor Ivankovic; Saška Ivanova; Anand Krishnan V Iyer; José M Izquierdo; Masanori Izumi; Marja Jäättelä; Majid Sakhi Jabir; William T Jackson; Nadia Jacobo-Herrera; Anne-Claire Jacomin; Elise Jacquin; Pooja Jadiya; Hartmut Jaeschke; Chinnaswamy Jagannath; Arjen J Jakobi; Johan Jakobsson; Bassam Janji; Pidder Jansen-Dürr; Patric J Jansson; Jonathan Jantsch; Sławomir Januszewski; Alagie Jassey; Steve Jean; Hélène Jeltsch-David; Pavla Jendelova; Andreas Jenny; Thomas E Jensen; Niels Jessen; Jenna L Jewell; Jing Ji; Lijun Jia; Rui Jia; Liwen Jiang; Qing Jiang; Richeng Jiang; Teng Jiang; Xuejun Jiang; Yu Jiang; Maria Jimenez-Sanchez; Eun-Jung Jin; Fengyan Jin; Hongchuan Jin; Li Jin; Luqi Jin; Meiyan Jin; Si Jin; Eun-Kyeong Jo; Carine Joffre; Terje Johansen; Gail V W Johnson; Simon A Johnston; Eija Jokitalo; Mohit Kumar Jolly; Leo A B Joosten; Joaquin Jordan; Bertrand Joseph; Dianwen Ju; Jeong-Sun Ju; Jingfang Ju; Esmeralda Juárez; Delphine Judith; Gábor Juhász; Youngsoo Jun; Chang Hwa Jung; Sung-Chul Jung; Yong Keun Jung; Heinz Jungbluth; Johannes Jungverdorben; Steffen Just; Kai Kaarniranta; Allen Kaasik; Tomohiro Kabuta; Daniel Kaganovich; Alon Kahana; Renate Kain; Shinjo Kajimura; Maria Kalamvoki; Manjula Kalia; Danuta S Kalinowski; Nina Kaludercic; Ioanna Kalvari; Joanna Kaminska; Vitaliy O Kaminskyy; Hiromitsu Kanamori; Keizo Kanasaki; Chanhee Kang; Rui Kang; Sang Sun Kang; Senthilvelrajan Kaniyappan; Tomotake Kanki; Thirumala-Devi Kanneganti; Anumantha G Kanthasamy; Arthi Kanthasamy; Marc Kantorow; Orsolya Kapuy; Michalis V Karamouzis; Md Razaul Karim; Parimal Karmakar; Rajesh G Katare; Masaru Kato; Stefan H E Kaufmann; Anu Kauppinen; Gur P Kaushal; Susmita Kaushik; Kiyoshi Kawasaki; Kemal Kazan; Po-Yuan Ke; Damien J Keating; Ursula Keber; John H Kehrl; Kate E Keller; Christian W Keller; Jongsook Kim Kemper; Candia M Kenific; Oliver Kepp; Stephanie Kermorgant; Andreas Kern; Robin Ketteler; Tom G Keulers; Boris Khalfin; Hany Khalil; Bilon Khambu; Shahid Y Khan; Vinoth Kumar Megraj Khandelwal; Rekha Khandia; Widuri Kho; Noopur V Khobrekar; Sataree Khuansuwan; Mukhran Khundadze; Samuel A Killackey; Dasol Kim; Deok Ryong Kim; Do-Hyung Kim; Dong-Eun Kim; Eun Young Kim; Eun-Kyoung Kim; Hak-Rim Kim; Hee-Sik Kim; Jeong Hun Kim; Jin Kyung Kim; Jin-Hoi Kim; Joungmok Kim; Ju Hwan Kim; Keun Il Kim; Peter K Kim; Seong-Jun Kim; Scot R Kimball; Adi Kimchi; Alec C Kimmelman; Tomonori Kimura; Matthew A King; Kerri J Kinghorn; Conan G Kinsey; Vladimir Kirkin; Lorrie A Kirshenbaum; Sergey L Kiselev; Shuji Kishi; Katsuhiko Kitamoto; Yasushi Kitaoka; Kaio Kitazato; Richard N Kitsis; Josef T Kittler; Ole Kjaerulff; Peter S Klein; Thomas Klopstock; Jochen Klucken; Helene Knævelsrud; Roland L Knorr; Ben C B Ko; Fred Ko; Jiunn-Liang Ko; Hotaka Kobayashi; Satoru Kobayashi; Ina Koch; Jan C Koch; Ulrich Koenig; Donat Kögel; Young Ho Koh; Masato Koike; Sepp D Kohlwein; Nur M Kocaturk; Masaaki Komatsu; Jeannette König; Toru Kono; Benjamin T Kopp; Tamas Korcsmaros; Gözde Korkmaz; Viktor I Korolchuk; Mónica Suárez Korsnes; Ali Koskela; Janaiah Kota; Yaichiro Kotake; Monica L Kotler; Yanjun Kou; Michael I Koukourakis; Evangelos Koustas; Attila L Kovacs; Tibor Kovács; Daisuke Koya; Tomohiro Kozako; Claudine Kraft; Dimitri Krainc; Helmut Krämer; Anna D Krasnodembskaya; Carole Kretz-Remy; Guido Kroemer; Nicholas T Ktistakis; Kazuyuki Kuchitsu; Sabine Kuenen; Lars Kuerschner; Thomas Kukar; Ajay Kumar; Ashok Kumar; Deepak Kumar; Dhiraj Kumar; Sharad Kumar; Shinji Kume; Caroline Kumsta; Chanakya N Kundu; Mondira Kundu; Ajaikumar B Kunnumakkara; Lukasz Kurgan; Tatiana G Kutateladze; Ozlem Kutlu; SeongAe Kwak; Ho Jeong Kwon; Taeg Kyu Kwon; Yong Tae Kwon; Irene Kyrmizi; Albert La Spada; Patrick Labonté; Sylvain Ladoire; Ilaria Laface; Frank Lafont; Diane C Lagace; Vikramjit Lahiri; Zhibing Lai; Angela S Laird; Aparna Lakkaraju; Trond Lamark; Sheng-Hui Lan; Ane Landajuela; Darius J R Lane; Jon D Lane; Charles H Lang; Carsten Lange; Ülo Langel; Rupert Langer; Pierre Lapaquette; Jocelyn Laporte; Nicholas F LaRusso; Isabel Lastres-Becker; Wilson Chun Yu Lau; Gordon W Laurie; Sergio Lavandero; Betty Yuen Kwan Law; Helen Ka-Wai Law; Rob Layfield; Weidong Le; Herve Le Stunff; Alexandre Y Leary; Jean-Jacques Lebrun; Lionel Y W Leck; Jean-Philippe Leduc-Gaudet; Changwook Lee; Chung-Pei Lee; Da-Hye Lee; Edward B Lee; Erinna F Lee; Gyun Min Lee; He-Jin Lee; Heung Kyu Lee; Jae Man Lee; Jason S Lee; Jin-A Lee; Joo-Yong Lee; Jun Hee Lee; Michael Lee; Min Goo Lee; Min Jae Lee; Myung-Shik Lee; Sang Yoon Lee; Seung-Jae Lee; Stella Y Lee; Sung Bae Lee; Won Hee Lee; Ying-Ray Lee; Yong-Ho Lee; Youngil Lee; Christophe Lefebvre; Renaud Legouis; Yu L Lei; Yuchen Lei; Sergey Leikin; Gerd Leitinger; Leticia Lemus; Shuilong Leng; Olivia Lenoir; Guido Lenz; Heinz Josef Lenz; Paola Lenzi; Yolanda León; Andréia M Leopoldino; Christoph Leschczyk; Stina Leskelä; Elisabeth Letellier; Chi-Ting Leung; Po Sing Leung; Jeremy S Leventhal; Beth Levine; Patrick A Lewis; Klaus Ley; Bin Li; Da-Qiang Li; Jianming Li; Jing Li; Jiong Li; Ke Li; Liwu Li; Mei Li; Min Li; Min Li; Ming Li; Mingchuan Li; Pin-Lan Li; Ming-Qing Li; Qing Li; Sheng Li; Tiangang Li; Wei Li; Wenming Li; Xue Li; Yi-Ping Li; Yuan Li; Zhiqiang Li; Zhiyong Li; Zhiyuan Li; Jiqin Lian; Chengyu Liang; Qiangrong Liang; Weicheng Liang; Yongheng Liang; YongTian Liang; Guanghong Liao; Lujian Liao; Mingzhi Liao; Yung-Feng Liao; Mariangela Librizzi; Pearl P Y Lie; Mary A Lilly; Hyunjung J Lim; Thania R R Lima; Federica Limana; Chao Lin; Chih-Wen Lin; Dar-Shong Lin; Fu-Cheng Lin; Jiandie D Lin; Kurt M Lin; Kwang-Huei Lin; Liang-Tzung Lin; Pei-Hui Lin; Qiong Lin; Shaofeng Lin; Su-Ju Lin; Wenyu Lin; Xueying Lin; Yao-Xin Lin; Yee-Shin Lin; Rafael Linden; Paula Lindner; Shuo-Chien Ling; Paul Lingor; Amelia K Linnemann; Yih-Cherng Liou; Marta M Lipinski; Saška Lipovšek; Vitor A Lira; Natalia Lisiak; Paloma B Liton; Chao Liu; Ching-Hsuan Liu; Chun-Feng Liu; Cui Hua Liu; Fang Liu; Hao Liu; Hsiao-Sheng Liu; Hua-Feng Liu; Huifang Liu; Jia Liu; Jing Liu; Julia Liu; Leyuan Liu; Longhua Liu; Meilian Liu; Qin Liu; Wei Liu; Wende Liu; Xiao-Hong Liu; Xiaodong Liu; Xingguo Liu; Xu Liu; Xuedong Liu; Yanfen Liu; Yang Liu; Yang Liu; Yueyang Liu; Yule Liu; J Andrew Livingston; Gerard Lizard; Jose M Lizcano; Senka Ljubojevic-Holzer; Matilde E LLeonart; David Llobet-Navàs; Alicia Llorente; Chih Hung Lo; Damián Lobato-Márquez; Qi Long; Yun Chau Long; Ben Loos; Julia A Loos; Manuela G López; Guillermo López-Doménech; José Antonio López-Guerrero; Ana T López-Jiménez; Óscar López-Pérez; Israel López-Valero; Magdalena J Lorenowicz; Mar Lorente; Peter Lorincz; Laura Lossi; Sophie Lotersztajn; Penny E Lovat; Jonathan F Lovell; Alenka Lovy; Péter Lőw; Guang Lu; Haocheng Lu; Jia-Hong Lu; Jin-Jian Lu; Mengji Lu; Shuyan Lu; Alessandro Luciani; John M Lucocq; Paula Ludovico; Micah A Luftig; Morten Luhr; Diego Luis-Ravelo; Julian J Lum; Liany Luna-Dulcey; Anders H Lund; Viktor K Lund; Jan D Lünemann; Patrick Lüningschrör; Honglin Luo; Rongcan Luo; Shouqing Luo; Zhi Luo; Claudio Luparello; Bernhard Lüscher; Luan Luu; Alex Lyakhovich; Konstantin G Lyamzaev; Alf Håkon Lystad; Lyubomyr Lytvynchuk; Alvin C Ma; Changle Ma; Mengxiao Ma; Ning-Fang Ma; Quan-Hong Ma; Xinliang Ma; Yueyun Ma; Zhenyi Ma; Ormond A MacDougald; Fernando Macian; Gustavo C MacIntosh; Jeffrey P MacKeigan; Kay F Macleod; Sandra Maday; Frank Madeo; Muniswamy Madesh; Tobias Madl; Julio Madrigal-Matute; Akiko Maeda; Yasuhiro Maejima; Marta Magarinos; Poornima Mahavadi; Emiliano Maiani; Kenneth Maiese; Panchanan Maiti; Maria Chiara Maiuri; Barbara Majello; Michael B Major; Elena Makareeva; Fayaz Malik; Karthik Mallilankaraman; Walter Malorni; Alina Maloyan; Najiba Mammadova; Gene Chi Wai Man; Federico Manai; Joseph D Mancias; Eva-Maria Mandelkow; Michael A Mandell; Angelo A Manfredi; Masoud H Manjili; Ravi Manjithaya; Patricio Manque; Bella B Manshian; Raquel Manzano; Claudia Manzoni; Kai Mao; Cinzia Marchese; Sandrine Marchetti; Anna Maria Marconi; Fabrizio Marcucci; Stefania Mardente; Olga A Mareninova; Marta Margeta; Muriel Mari; Sara Marinelli; Oliviero Marinelli; Guillermo Mariño; Sofia Mariotto; Richard S Marshall; Mark R Marten; Sascha Martens; Alexandre P J Martin; Katie R Martin; Sara Martin; Shaun Martin; Adrián Martín-Segura; Miguel A Martín-Acebes; Inmaculada Martin-Burriel; Marcos Martin-Rincon; Paloma Martin-Sanz; José A Martina; Wim Martinet; Aitor Martinez; Ana Martinez; Jennifer Martinez; Moises Martinez Velazquez; Nuria Martinez-Lopez; Marta Martinez-Vicente; Daniel O Martins; Joilson O Martins; Waleska K Martins; Tania Martins-Marques; Emanuele Marzetti; Shashank Masaldan; Celine Masclaux-Daubresse; Douglas G Mashek; Valentina Massa; Lourdes Massieu; Glenn R Masson; Laura Masuelli; Anatoliy I Masyuk; Tetyana V Masyuk; Paola Matarrese; Ander Matheu; Satoaki Matoba; Sachiko Matsuzaki; Pamela Mattar; Alessandro Matte; Domenico Mattoscio; José L Mauriz; Mario Mauthe; Caroline Mauvezin; Emanual Maverakis; Paola Maycotte; Johanna Mayer; Gianluigi Mazzoccoli; Cristina Mazzoni; Joseph R Mazzulli; Nami McCarty; Christine McDonald; Mitchell R McGill; Sharon L McKenna; BethAnn McLaughlin; Fionn McLoughlin; Mark A McNiven; Thomas G McWilliams; Fatima Mechta-Grigoriou; Tania Catarina Medeiros; Diego L Medina; Lynn A Megeney; Klara Megyeri; Maryam Mehrpour; Jawahar L Mehta; Alfred J Meijer; Annemarie H Meijer; Jakob Mejlvang; Alicia Meléndez; Annette Melk; Gonen Memisoglu; Alexandrina F Mendes; Delong Meng; Fei Meng; Tian Meng; Rubem Menna-Barreto; Manoj B Menon; Carol Mercer; Anne E Mercier; Jean-Louis Mergny; Adalberto Merighi; Seth D Merkley; Giuseppe Merla; Volker Meske; Ana Cecilia Mestre; Shree Padma Metur; Christian Meyer; Hemmo Meyer; Wenyi Mi; Jeanne Mialet-Perez; Junying Miao; Lucia Micale; Yasuo Miki; Enrico Milan; Małgorzata Milczarek; Dana L Miller; Samuel I Miller; Silke Miller; Steven W Millward; Ira Milosevic; Elena A Minina; Hamed Mirzaei; Hamid Reza Mirzaei; Mehdi Mirzaei; Amit Mishra; Nandita Mishra; Paras Kumar Mishra; Maja Misirkic Marjanovic; Roberta Misasi; Amit Misra; Gabriella Misso; Claire Mitchell; Geraldine Mitou; Tetsuji Miura; Shigeki Miyamoto; Makoto Miyazaki; Mitsunori Miyazaki; Taiga Miyazaki; Keisuke Miyazawa; Noboru Mizushima; Trine H Mogensen; Baharia Mograbi; Reza Mohammadinejad; Yasir Mohamud; Abhishek Mohanty; Sipra Mohapatra; Torsten Möhlmann; Asif Mohmmed; Anna Moles; Kelle H Moley; Maurizio Molinari; Vincenzo Mollace; Andreas Buch Møller; Bertrand Mollereau; Faustino Mollinedo; Costanza Montagna; Mervyn J Monteiro; Andrea Montella; L Ruth Montes; Barbara Montico; Vinod K Mony; Giacomo Monzio Compagnoni; Michael N Moore; Mohammad A Moosavi; Ana L Mora; Marina Mora; David Morales-Alamo; Rosario Moratalla; Paula I Moreira; Elena Morelli; Sandra Moreno; Daniel Moreno-Blas; Viviana Moresi; Benjamin Morga; Alwena H Morgan; Fabrice Morin; Hideaki Morishita; Orson L Moritz; Mariko Moriyama; Yuji Moriyasu; Manuela Morleo; Eugenia Morselli; Jose F Moruno-Manchon; Jorge Moscat; Serge Mostowy; Elisa Motori; Andrea Felinto Moura; Naima Moustaid-Moussa; Maria Mrakovcic; Gabriel Muciño-Hernández; Anupam Mukherjee; Subhadip Mukhopadhyay; Jean M Mulcahy Levy; Victoriano Mulero; Sylviane Muller; Christian Münch; Ashok Munjal; Pura Munoz-Canoves; Teresa Muñoz-Galdeano; Christian Münz; Tomokazu Murakawa; Claudia Muratori; Brona M Murphy; J Patrick Murphy; Aditya Murthy; Timo T Myöhänen; Indira U Mysorekar; Jennifer Mytych; Seyed Mohammad Nabavi; Massimo Nabissi; Péter Nagy; Jihoon Nah; Aimable Nahimana; Ichiro Nakagawa; Ken Nakamura; Hitoshi Nakatogawa; Shyam S Nandi; Meera Nanjundan; Monica Nanni; Gennaro Napolitano; Roberta Nardacci; Masashi Narita; Melissa Nassif; Ilana Nathan; Manabu Natsumeda; Ryno J Naude; Christin Naumann; Olaia Naveiras; Fatemeh Navid; Steffan T Nawrocki; Taras Y Nazarko; Francesca Nazio; Florentina Negoita; Thomas Neill; Amanda L Neisch; Luca M Neri; Mihai G Netea; Patrick Neubert; Thomas P Neufeld; Dietbert Neumann; Albert Neutzner; Phillip T Newton; Paul A Ney; Ioannis P Nezis; Charlene C W Ng; Tzi Bun Ng; Hang T T Nguyen; Long T Nguyen; Hong-Min Ni; Clíona Ní Cheallaigh; Zhenhong Ni; M Celeste Nicolao; Francesco Nicoli; Manuel Nieto-Diaz; Per Nilsson; Shunbin Ning; Rituraj Niranjan; Hiroshi Nishimune; Mireia Niso-Santano; Ralph A Nixon; Annalisa Nobili; Clevio Nobrega; Takeshi Noda; Uxía Nogueira-Recalde; Trevor M Nolan; Ivan Nombela; Ivana Novak; Beatriz Novoa; Takashi Nozawa; Nobuyuki Nukina; Carmen Nussbaum-Krammer; Jesper Nylandsted; Tracey R O'Donovan; Seónadh M O'Leary; Eyleen J O'Rourke; Mary P O'Sullivan; Timothy E O'Sullivan; Salvatore Oddo; Ina Oehme; Michinaga Ogawa; Eric Ogier-Denis; Margret H Ogmundsdottir; Besim Ogretmen; Goo Taeg Oh; Seon-Hee Oh; Young J Oh; Takashi Ohama; Yohei Ohashi; Masaki Ohmuraya; Vasileios Oikonomou; Rani Ojha; Koji Okamoto; Hitoshi Okazawa; Masahide Oku; Sara Oliván; Jorge M A Oliveira; Michael Ollmann; James A Olzmann; Shakib Omari; M Bishr Omary; Gizem Önal; Martin Ondrej; Sang-Bing Ong; Sang-Ging Ong; Anna Onnis; Juan A Orellana; Sara Orellana-Muñoz; Maria Del Mar Ortega-Villaizan; Xilma R Ortiz-Gonzalez; Elena Ortona; Heinz D Osiewacz; Abdel-Hamid K Osman; Rosario Osta; Marisa S Otegui; Kinya Otsu; Christiane Ott; Luisa Ottobrini; Jing-Hsiung James Ou; Tiago F Outeiro; Inger Oynebraten; Melek Ozturk; Gilles Pagès; Susanta Pahari; Marta Pajares; Utpal B Pajvani; Rituraj Pal; Simona Paladino; Nicolas Pallet; Michela Palmieri; Giuseppe Palmisano; Camilla Palumbo; Francesco Pampaloni; Lifeng Pan; Qingjun Pan; Wenliang Pan; Xin Pan; Ganna Panasyuk; Rahul Pandey; Udai B Pandey; Vrajesh Pandya; Francesco Paneni; Shirley Y Pang; Elisa Panzarini; Daniela L Papademetrio; Elena Papaleo; Daniel Papinski; Diana Papp; Eun Chan Park; Hwan Tae Park; Ji-Man Park; Jong-In Park; Joon Tae Park; Junsoo Park; Sang Chul Park; Sang-Youel Park; Abraham H Parola; Jan B Parys; Adrien Pasquier; Benoit Pasquier; João F Passos; Nunzia Pastore; Hemal H Patel; Daniel Patschan; Sophie Pattingre; Gustavo Pedraza-Alva; Jose Pedraza-Chaverri; Zully Pedrozo; Gang Pei; Jianming Pei; Hadas Peled-Zehavi; Joaquín M Pellegrini; Joffrey Pelletier; Miguel A Peñalva; Di Peng; Ying Peng; Fabio Penna; Maria Pennuto; Francesca Pentimalli; Cláudia Mf Pereira; Gustavo J S Pereira; Lilian C Pereira; Luis Pereira de Almeida; Nirma D Perera; Ángel Pérez-Lara; Ana B Perez-Oliva; María Esther Pérez-Pérez; Palsamy Periyasamy; Andras Perl; Cristiana Perrotta; Ida Perrotta; Richard G Pestell; Morten Petersen; Irina Petrache; Goran Petrovski; Thorsten Pfirrmann; Astrid S Pfister; Jennifer A Philips; Huifeng Pi; Anna Picca; Alicia M Pickrell; Sandy Picot; Giovanna M Pierantoni; Marina Pierdominici; Philippe Pierre; Valérie Pierrefite-Carle; Karolina Pierzynowska; Federico Pietrocola; Miroslawa Pietruczuk; Claudio Pignata; Felipe X Pimentel-Muiños; Mario Pinar; Roberta O Pinheiro; Ronit Pinkas-Kramarski; Paolo Pinton; Karolina Pircs; Sujan Piya; Paola Pizzo; Theo S Plantinga; Harald W Platta; Ainhoa Plaza-Zabala; Markus Plomann; Egor Y Plotnikov; Helene Plun-Favreau; Ryszard Pluta; Roger Pocock; Stefanie Pöggeler; Christian Pohl; Marc Poirot; Angelo Poletti; Marisa Ponpuak; Hana Popelka; Blagovesta Popova; Helena Porta; Soledad Porte Alcon; Eliana Portilla-Fernandez; Martin Post; Malia B Potts; Joanna Poulton; Ted Powers; Veena Prahlad; Tomasz K Prajsnar; Domenico Praticò; Rosaria Prencipe; Muriel Priault; Tassula Proikas-Cezanne; Vasilis J Promponas; Christopher G Proud; Rosa Puertollano; Luigi Puglielli; Thomas Pulinilkunnil; Deepika Puri; Rajat Puri; Julien Puyal; Xiaopeng Qi; Yongmei Qi; Wenbin Qian; Lei Qiang; Yu Qiu; Joe Quadrilatero; Jorge Quarleri; Nina Raben; Hannah Rabinowich; Debora Ragona; Michael J Ragusa; Nader Rahimi; Marveh Rahmati; Valeria Raia; Nuno Raimundo; Namakkal-Soorappan Rajasekaran; Sriganesh Ramachandra Rao; Abdelhaq Rami; Ignacio Ramírez-Pardo; David B Ramsden; Felix Randow; Pundi N Rangarajan; Danilo Ranieri; Hai Rao; Lang Rao; Rekha Rao; Sumit Rathore; J Arjuna Ratnayaka; Edward A Ratovitski; Palaniyandi Ravanan; Gloria Ravegnini; Swapan K Ray; Babak Razani; Vito Rebecca; Fulvio Reggiori; Anne Régnier-Vigouroux; Andreas S Reichert; David Reigada; Jan H Reiling; Theo Rein; Siegfried Reipert; Rokeya Sultana Rekha; Hongmei Ren; Jun Ren; Weichao Ren; Tristan Renault; Giorgia Renga; Karen Reue; Kim Rewitz; Bruna Ribeiro de Andrade Ramos; S Amer Riazuddin; Teresa M Ribeiro-Rodrigues; Jean-Ehrland Ricci; Romeo Ricci; Victoria Riccio; Des R Richardson; Yasuko Rikihisa; Makarand V Risbud; Ruth M Risueño; Konstantinos Ritis; Salvatore Rizza; Rosario Rizzuto; Helen C Roberts; Luke D Roberts; Katherine J Robinson; Maria Carmela Roccheri; Stephane Rocchi; George G Rodney; Tiago Rodrigues; Vagner Ramon Rodrigues Silva; Amaia Rodriguez; Ruth Rodriguez-Barrueco; Nieves Rodriguez-Henche; Humberto Rodriguez-Rocha; Jeroen Roelofs; Robert S Rogers; Vladimir V Rogov; Ana I Rojo; Krzysztof Rolka; Vanina Romanello; Luigina Romani; Alessandra Romano; Patricia S Romano; David Romeo-Guitart; Luis C Romero; Montserrat Romero; Joseph C Roney; Christopher Rongo; Sante Roperto; Mathias T Rosenfeldt; Philip Rosenstiel; Anne G Rosenwald; Kevin A Roth; Lynn Roth; Steven Roth; Kasper M A Rouschop; Benoit D Roussel; Sophie Roux; Patrizia Rovere-Querini; Ajit Roy; Aurore Rozieres; Diego Ruano; David C Rubinsztein; Maria P Rubtsova; Klaus Ruckdeschel; Christoph Ruckenstuhl; Emil Rudolf; Rüdiger Rudolf; Alessandra Ruggieri; Avnika Ashok Ruparelia; Paola Rusmini; Ryan R Russell; Gian Luigi Russo; Maria Russo; Rossella Russo; Oxana O Ryabaya; Kevin M Ryan; Kwon-Yul Ryu; Maria Sabater-Arcis; Ulka Sachdev; Michael Sacher; Carsten Sachse; Abhishek Sadhu; Junichi Sadoshima; Nathaniel Safren; Paul Saftig; Antonia P Sagona; Gaurav Sahay; Amirhossein Sahebkar; Mustafa Sahin; Ozgur Sahin; Sumit Sahni; Nayuta Saito; Shigeru Saito; Tsunenori Saito; Ryohei Sakai; Yasuyoshi Sakai; Jun-Ichi Sakamaki; Kalle Saksela; Gloria Salazar; Anna Salazar-Degracia; Ghasem H Salekdeh; Ashok K Saluja; Belém Sampaio-Marques; Maria Cecilia Sanchez; Jose A Sanchez-Alcazar; Victoria Sanchez-Vera; Vanessa Sancho-Shimizu; J Thomas Sanderson; Marco Sandri; Stefano Santaguida; Laura Santambrogio; Magda M Santana; Giorgio Santoni; Alberto Sanz; Pascual Sanz; Shweta Saran; Marco Sardiello; Timothy J Sargeant; Apurva Sarin; Chinmoy Sarkar; Sovan Sarkar; Maria-Rosa Sarrias; Surajit Sarkar; Dipanka Tanu Sarmah; Jaakko Sarparanta; Aishwarya Sathyanarayan; Ranganayaki Sathyanarayanan; K Matthew Scaglione; Francesca Scatozza; Liliana Schaefer; Zachary T Schafer; Ulrich E Schaible; Anthony H V Schapira; Michael Scharl; Hermann M Schatzl; Catherine H Schein; Wiep Scheper; David Scheuring; Maria Vittoria Schiaffino; Monica Schiappacassi; Rainer Schindl; Uwe Schlattner; Oliver Schmidt; Roland Schmitt; Stephen D Schmidt; Ingo Schmitz; Eran Schmukler; Anja Schneider; Bianca E Schneider; Romana Schober; Alejandra C Schoijet; Micah B Schott; Michael Schramm; Bernd Schröder; Kai Schuh; Christoph Schüller; Ryan J Schulze; Lea Schürmanns; Jens C Schwamborn; Melanie Schwarten; Filippo Scialo; Sebastiano Sciarretta; Melanie J Scott; Kathleen W Scotto; A Ivana Scovassi; Andrea Scrima; Aurora Scrivo; David Sebastian; Salwa Sebti; Simon Sedej; Laura Segatori; Nava Segev; Per O Seglen; Iban Seiliez; Ekihiro Seki; Scott B Selleck; Frank W Sellke; Joshua T Selsby; Michael Sendtner; Serif Senturk; Elena Seranova; Consolato Sergi; Ruth Serra-Moreno; Hiromi Sesaki; Carmine Settembre; Subba Rao Gangi Setty; Gianluca Sgarbi; Ou Sha; John J Shacka; Javeed A Shah; Dantong Shang; Changshun Shao; Feng Shao; Soroush Sharbati; Lisa M Sharkey; Dipali Sharma; Gaurav Sharma; Kulbhushan Sharma; Pawan Sharma; Surendra Sharma; Han-Ming Shen; Hongtao Shen; Jiangang Shen; Ming Shen; Weili Shen; Zheni Shen; Rui Sheng; Zhi Sheng; Zu-Hang Sheng; Jianjian Shi; Xiaobing Shi; Ying-Hong Shi; Kahori Shiba-Fukushima; Jeng-Jer Shieh; Yohta Shimada; Shigeomi Shimizu; Makoto Shimozawa; Takahiro Shintani; Christopher J Shoemaker; Shahla Shojaei; Ikuo Shoji; Bhupendra V Shravage; Viji Shridhar; Chih-Wen Shu; Hong-Bing Shu; Ke Shui; Arvind K Shukla; Timothy E Shutt; Valentina Sica; Aleem Siddiqui; Amanda Sierra; Virginia Sierra-Torre; Santiago Signorelli; Payel Sil; Bruno J de Andrade Silva; Johnatas D Silva; Eduardo Silva-Pavez; Sandrine Silvente-Poirot; Rachel E Simmonds; Anna Katharina Simon; Hans-Uwe Simon; Matias Simons; Anurag Singh; Lalit P Singh; Rajat Singh; Shivendra V Singh; Shrawan K Singh; Sudha B Singh; Sunaina Singh; Surinder Pal Singh; Debasish Sinha; Rohit Anthony Sinha; Sangita Sinha; Agnieszka Sirko; Kapil Sirohi; Efthimios L Sivridis; Panagiotis Skendros; Aleksandra Skirycz; Iva Slaninová; Soraya S Smaili; Andrei Smertenko; Matthew D Smith; Stefaan J Soenen; Eun Jung Sohn; Sophia P M Sok; Giancarlo Solaini; Thierry Soldati; Scott A Soleimanpour; Rosa M Soler; Alexei Solovchenko; Jason A Somarelli; Avinash Sonawane; Fuyong Song; Hyun Kyu Song; Ju-Xian Song; Kunhua Song; Zhiyin Song; Leandro R Soria; Maurizio Sorice; Alexander A Soukas; Sandra-Fausia Soukup; Diana Sousa; Nadia Sousa; Paul A Spagnuolo; Stephen A Spector; M M Srinivas Bharath; Daret St Clair; Venturina Stagni; Leopoldo Staiano; Clint A Stalnecker; Metodi V Stankov; Peter B Stathopulos; Katja Stefan; Sven Marcel Stefan; Leonidas Stefanis; Joan S Steffan; Alexander Steinkasserer; Harald Stenmark; Jared Sterneckert; Craig Stevens; Veronika Stoka; Stephan Storch; Björn Stork; Flavie Strappazzon; Anne Marie Strohecker; Dwayne G Stupack; Huanxing Su; Ling-Yan Su; Longxiang Su; Ana M Suarez-Fontes; Carlos S Subauste; Selvakumar Subbian; Paula V Subirada; Ganapasam Sudhandiran; Carolyn M Sue; Xinbing Sui; Corey Summers; Guangchao Sun; Jun Sun; Kang Sun; Meng-Xiang Sun; Qiming Sun; Yi Sun; Zhongjie Sun; Karen K S Sunahara; Eva Sundberg; Katalin Susztak; Peter Sutovsky; Hidekazu Suzuki; Gary Sweeney; J David Symons; Stephen Cho Wing Sze; Nathaniel J Szewczyk; Anna Tabęcka-Łonczynska; Claudio Tabolacci; Frank Tacke; Heinrich Taegtmeyer; Marco Tafani; Mitsuo Tagaya; Haoran Tai; Stephen W G Tait; Yoshinori Takahashi; Szabolcs Takats; Priti Talwar; Chit Tam; Shing Yau Tam; Davide Tampellini; Atsushi Tamura; Chong Teik Tan; Eng-King Tan; Ya-Qin Tan; Masaki Tanaka; Motomasa Tanaka; Daolin Tang; Jingfeng Tang; Tie-Shan Tang; Isei Tanida; Zhipeng Tao; Mohammed Taouis; Lars Tatenhorst; Nektarios Tavernarakis; Allen Taylor; Gregory A Taylor; Joan M Taylor; Elena Tchetina; Andrew R Tee; Irmgard Tegeder; David Teis; Natercia Teixeira; Fatima Teixeira-Clerc; Kumsal A Tekirdag; Tewin Tencomnao; Sandra Tenreiro; Alexei V Tepikin; Pilar S Testillano; Gianluca Tettamanti; Pierre-Louis Tharaux; Kathrin Thedieck; Arvind A Thekkinghat; Stefano Thellung; Josephine W Thinwa; V P Thirumalaikumar; Sufi Mary Thomas; Paul G Thomes; Andrew Thorburn; Lipi Thukral; Thomas Thum; Michael Thumm; Ling Tian; Ales Tichy; Andreas Till; Vincent Timmerman; Vladimir I Titorenko; Sokol V Todi; Krassimira Todorova; Janne M Toivonen; Luana Tomaipitinca; Dhanendra Tomar; Cristina Tomas-Zapico; Sergej Tomić; Benjamin Chun-Kit Tong; Chao Tong; Xin Tong; Sharon A Tooze; Maria L Torgersen; Satoru Torii; Liliana Torres-López; Alicia Torriglia; Christina G Towers; Roberto Towns; Shinya Toyokuni; Vladimir Trajkovic; Donatella Tramontano; Quynh-Giao Tran; Leonardo H Travassos; Charles B Trelford; Shirley Tremel; Ioannis P Trougakos; Betty P Tsao; Mario P Tschan; Hung-Fat Tse; Tak Fu Tse; Hitoshi Tsugawa; Andrey S Tsvetkov; David A Tumbarello; Yasin Tumtas; María J Tuñón; Sandra Turcotte; Boris Turk; Vito Turk; Bradley J Turner; Richard I Tuxworth; Jessica K Tyler; Elena V Tyutereva; Yasuo Uchiyama; Aslihan Ugun-Klusek; Holm H Uhlig; Marzena Ułamek-Kozioł; Ilya V Ulasov; Midori Umekawa; Christian Ungermann; Rei Unno; Sylvie Urbe; Elisabet Uribe-Carretero; Suayib Üstün; Vladimir N Uversky; Thomas Vaccari; Maria I Vaccaro; Björn F Vahsen; Helin Vakifahmetoglu-Norberg; Rut Valdor; Maria J Valente; Ayelén Valko; Richard B Vallee; Angela M Valverde; Greet Van den Berghe; Stijn van der Veen; Luc Van Kaer; Jorg van Loosdregt; Sjoerd J L van Wijk; Wim Vandenberghe; Ilse Vanhorebeek; Marcos A Vannier-Santos; Nicola Vannini; M Cristina Vanrell; Chiara Vantaggiato; Gabriele Varano; Isabel Varela-Nieto; Máté Varga; M Helena Vasconcelos; Somya Vats; Demetrios G Vavvas; Ignacio Vega-Naredo; Silvia Vega-Rubin-de-Celis; Guillermo Velasco; Ariadna P Velázquez; Tibor Vellai; Edo Vellenga; Francesca Velotti; Mireille Verdier; Panayotis Verginis; Isabelle Vergne; Paul Verkade; Manish Verma; Patrik Verstreken; Tim Vervliet; Jörg Vervoorts; Alexandre T Vessoni; Victor M Victor; Michel Vidal; Chiara Vidoni; Otilia V Vieira; Richard D Vierstra; Sonia Viganó; Helena Vihinen; Vinoy Vijayan; Miquel Vila; Marçal Vilar; José M Villalba; Antonio Villalobo; Beatriz Villarejo-Zori; Francesc Villarroya; Joan Villarroya; Olivier Vincent; Cecile Vindis; Christophe Viret; Maria Teresa Viscomi; Dora Visnjic; Ilio Vitale; David J Vocadlo; Olga V Voitsekhovskaja; Cinzia Volonté; Mattia Volta; Marta Vomero; Clarissa Von Haefen; Marc A Vooijs; Wolfgang Voos; Ljubica Vucicevic; Richard Wade-Martins; Satoshi Waguri; Kenrick A Waite; Shuji Wakatsuki; David W Walker; Mark J Walker; Simon A Walker; Jochen Walter; Francisco G Wandosell; Bo Wang; Chao-Yung Wang; Chen Wang; Chenran Wang; Chenwei Wang; Cun-Yu Wang; Dong Wang; Fangyang Wang; Feng Wang; Fengming Wang; Guansong Wang; Han Wang; Hao Wang; Hexiang Wang; Hong-Gang Wang; Jianrong Wang; Jigang Wang; Jiou Wang; Jundong Wang; Kui Wang; Lianrong Wang; Liming Wang; Maggie Haitian Wang; Meiqing Wang; Nanbu Wang; Pengwei Wang; Peipei Wang; Ping Wang; Ping Wang; Qing Jun Wang; Qing Wang; Qing Kenneth Wang; Qiong A Wang; Wen-Tao Wang; Wuyang Wang; Xinnan Wang; Xuejun Wang; Yan Wang; Yanchang Wang; Yanzhuang Wang; Yen-Yun Wang; Yihua Wang; Yipeng Wang; Yu Wang; Yuqi Wang; Zhe Wang; Zhenyu Wang; Zhouguang Wang; Gary Warnes; Verena Warnsmann; Hirotaka Watada; Eizo Watanabe; Maxinne Watchon; Anna Wawrzyńska; Timothy E Weaver; Grzegorz Wegrzyn; Ann M Wehman; Huafeng Wei; Lei Wei; Taotao Wei; Yongjie Wei; Oliver H Weiergräber; Conrad C Weihl; Günther Weindl; Ralf Weiskirchen; Alan Wells; Runxia H Wen; Xin Wen; Antonia Werner; Beatrice Weykopf; Sally P Wheatley; J Lindsay Whitton; Alexander J Whitworth; Katarzyna Wiktorska; Manon E Wildenberg; Tom Wileman; Simon Wilkinson; Dieter Willbold; Brett Williams; Robin S B Williams; Roger L Williams; Peter R Williamson; Richard A Wilson; Beate Winner; Nathaniel J Winsor; Steven S Witkin; Harald Wodrich; Ute Woehlbier; Thomas Wollert; Esther Wong; Jack Ho Wong; Richard W Wong; Vincent Kam Wai Wong; W Wei-Lynn Wong; An-Guo Wu; Chengbiao Wu; Jian Wu; Junfang Wu; Kenneth K Wu; Min Wu; Shan-Ying Wu; Shengzhou Wu; Shu-Yan Wu; Shufang Wu; William K K Wu; Xiaohong Wu; Xiaoqing Wu; Yao-Wen Wu; Yihua Wu; Ramnik J Xavier; Hongguang Xia; Lixin Xia; Zhengyuan Xia; Ge Xiang; Jin Xiang; Mingliang Xiang; Wei Xiang; Bin Xiao; Guozhi Xiao; Hengyi Xiao; Hong-Tao Xiao; Jian Xiao; Lan Xiao; Shi Xiao; Yin Xiao; Baoming Xie; Chuan-Ming Xie; Min Xie; Yuxiang Xie; Zhiping Xie; Zhonglin Xie; Maria Xilouri; Congfeng Xu; En Xu; Haoxing Xu; Jing Xu; JinRong Xu; Liang Xu; Wen Wen Xu; Xiulong Xu; Yu Xue; Sokhna M S Yakhine-Diop; Masamitsu Yamaguchi; Osamu Yamaguchi; Ai Yamamoto; Shunhei Yamashina; Shengmin Yan; Shian-Jang Yan; Zhen Yan; Yasuo Yanagi; Chuanbin Yang; Dun-Sheng Yang; Huan Yang; Huang-Tian Yang; Hui Yang; Jin-Ming Yang; Jing Yang; Jingyu Yang; Ling Yang; Liu Yang; Ming Yang; Pei-Ming Yang; Qian Yang; Seungwon Yang; Shu Yang; Shun-Fa Yang; Wannian Yang; Wei Yuan Yang; Xiaoyong Yang; Xuesong Yang; Yi Yang; Ying Yang; Honghong Yao; Shenggen Yao; Xiaoqiang Yao; Yong-Gang Yao; Yong-Ming Yao; Takahiro Yasui; Meysam Yazdankhah; Paul M Yen; Cong Yi; Xiao-Ming Yin; Yanhai Yin; Zhangyuan Yin; Ziyi Yin; Meidan Ying; Zheng Ying; Calvin K Yip; Stephanie Pei Tung Yiu; Young H Yoo; Kiyotsugu Yoshida; Saori R Yoshii; Tamotsu Yoshimori; Bahman Yousefi; Boxuan Yu; Haiyang Yu; Jun Yu; Jun Yu; Li Yu; Ming-Lung Yu; Seong-Woon Yu; Victor C Yu; W Haung Yu; Zhengping Yu; Zhou Yu; Junying Yuan; Ling-Qing Yuan; Shilin Yuan; Shyng-Shiou F Yuan; Yanggang Yuan; Zengqiang Yuan; Jianbo Yue; Zhenyu Yue; Jeanho Yun; Raymond L Yung; David N Zacks; Gabriele Zaffagnini; Vanessa O Zambelli; Isabella Zanella; Qun S Zang; Sara Zanivan; Silvia Zappavigna; Pilar Zaragoza; Konstantinos S Zarbalis; Amir Zarebkohan; Amira Zarrouk; Scott O Zeitlin; Jialiu Zeng; Ju-Deng Zeng; Eva Žerovnik; Lixuan Zhan; Bin Zhang; Donna D Zhang; Hanlin Zhang; Hong Zhang; Hong Zhang; Honghe Zhang; Huafeng Zhang; Huaye Zhang; Hui Zhang; Hui-Ling Zhang; Jianbin Zhang; Jianhua Zhang; Jing-Pu Zhang; Kalin Y B Zhang; Leshuai W Zhang; Lin Zhang; Lisheng Zhang; Lu Zhang; Luoying Zhang; Menghuan Zhang; Peng Zhang; Sheng Zhang; Wei Zhang; Xiangnan Zhang; Xiao-Wei Zhang; Xiaolei Zhang; Xiaoyan Zhang; Xin Zhang; Xinxin Zhang; Xu Dong Zhang; Yang Zhang; Yanjin Zhang; Yi Zhang; Ying-Dong Zhang; Yingmei Zhang; Yuan-Yuan Zhang; Yuchen Zhang; Zhe Zhang; Zhengguang Zhang; Zhibing Zhang; Zhihai Zhang; Zhiyong Zhang; Zili Zhang; Haobin Zhao; Lei Zhao; Shuang Zhao; Tongbiao Zhao; Xiao-Fan Zhao; Ying Zhao; Yongchao Zhao; Yongliang Zhao; Yuting Zhao; Guoping Zheng; Kai Zheng; Ling Zheng; Shizhong Zheng; Xi-Long Zheng; Yi Zheng; Zu-Guo Zheng; Boris Zhivotovsky; Qing Zhong; Ao Zhou; Ben Zhou; Cefan Zhou; Gang Zhou; Hao Zhou; Hong Zhou; Hongbo Zhou; Jie Zhou; Jing Zhou; Jing Zhou; Jiyong Zhou; Kailiang Zhou; Rongjia Zhou; Xu-Jie Zhou; Yanshuang Zhou; Yinghong Zhou; Yubin Zhou; Zheng-Yu Zhou; Zhou Zhou; Binglin Zhu; Changlian Zhu; Guo-Qing Zhu; Haining Zhu; Hongxin Zhu; Hua Zhu; Wei-Guo Zhu; Yanping Zhu; Yushan Zhu; Haixia Zhuang; Xiaohong Zhuang; Katarzyna Zientara-Rytter; Christine M Zimmermann; Elena Ziviani; Teresa Zoladek; Wei-Xing Zong; Dmitry B Zorov; Antonio Zorzano; Weiping Zou; Zhen Zou; Zhengzhi Zou; Steven Zuryn; Werner Zwerschke; Beate Brand-Saberi; X Charlie Dong; Chandra Shekar Kenchappa; Zuguo Li; Yong Lin; Shigeru Oshima; Yueguang Rong; Judith C Sluimer; Christina L Stallings; Chun-Kit Tong Journal: Autophagy Date: 2021-02-08 Impact factor: 13.391
Authors: Yasmin Pedra-Rezende; Isabela S Macedo; Victor Midlej; Rafael M Mariante; Rubem F S Menna-Barreto Journal: Front Microbiol Date: 2022-03-29 Impact factor: 5.640
Authors: Daniel J Klionsky; Kotb Abdelmohsen; Akihisa Abe; Md Joynal Abedin; Hagai Abeliovich; Abraham Acevedo Arozena; Hiroaki Adachi; Christopher M Adams; Peter D Adams; Khosrow Adeli; Peter J Adhihetty; Sharon G Adler; Galila Agam; Rajesh Agarwal; Manish K Aghi; Maria Agnello; Patrizia Agostinis; Patricia V Aguilar; Julio Aguirre-Ghiso; Edoardo M Airoldi; Slimane Ait-Si-Ali; Takahiko Akematsu; Emmanuel T Akporiaye; Mohamed Al-Rubeai; Guillermo M Albaiceta; Chris Albanese; Diego Albani; Matthew L Albert; Jesus Aldudo; Hana Algül; Mehrdad Alirezaei; Iraide Alloza; Alexandru Almasan; Maylin Almonte-Beceril; Emad S Alnemri; Covadonga Alonso; Nihal Altan-Bonnet; Dario C Altieri; Silvia Alvarez; Lydia Alvarez-Erviti; Sandro Alves; Giuseppina Amadoro; Atsuo Amano; Consuelo Amantini; Santiago Ambrosio; Ivano Amelio; Amal O Amer; Mohamed Amessou; Angelika Amon; Zhenyi An; Frank A Anania; Stig U Andersen; Usha P Andley; Catherine K Andreadi; Nathalie Andrieu-Abadie; Alberto Anel; David K Ann; Shailendra Anoopkumar-Dukie; Manuela Antonioli; Hiroshi Aoki; Nadezda Apostolova; Saveria Aquila; Katia Aquilano; Koichi Araki; Eli Arama; Agustin Aranda; Jun Araya; Alexandre Arcaro; Esperanza Arias; Hirokazu Arimoto; Aileen R Ariosa; Jane L Armstrong; Thierry Arnould; Ivica Arsov; Katsuhiko Asanuma; Valerie Askanas; Eric Asselin; Ryuichiro Atarashi; Sally S Atherton; Julie D Atkin; Laura D Attardi; Patrick Auberger; Georg Auburger; Laure Aurelian; Riccardo Autelli; Laura Avagliano; Maria Laura Avantaggiati; Limor Avrahami; Suresh Awale; Neelam Azad; Tiziana Bachetti; Jonathan M Backer; Dong-Hun Bae; Jae-Sung Bae; Ok-Nam Bae; Soo Han Bae; Eric H Baehrecke; Seung-Hoon Baek; Stephen Baghdiguian; Agnieszka Bagniewska-Zadworna; Hua Bai; Jie Bai; Xue-Yuan Bai; Yannick Bailly; Kithiganahalli Narayanaswamy Balaji; Walter Balduini; Andrea Ballabio; Rena Balzan; Rajkumar Banerjee; Gábor Bánhegyi; Haijun Bao; Benoit Barbeau; Maria D Barrachina; Esther Barreiro; Bonnie Bartel; Alberto Bartolomé; Diane C Bassham; Maria Teresa Bassi; Robert C Bast; Alakananda Basu; Maria Teresa Batista; Henri Batoko; Maurizio Battino; Kyle Bauckman; Bradley L Baumgarner; K Ulrich Bayer; Rupert Beale; Jean-François Beaulieu; George R Beck; Christoph Becker; J David Beckham; Pierre-André Bédard; Patrick J Bednarski; Thomas J Begley; Christian Behl; Christian Behrends; Georg Mn Behrens; Kevin E Behrns; Eloy Bejarano; Amine Belaid; Francesca Belleudi; Giovanni Bénard; Guy Berchem; Daniele Bergamaschi; Matteo Bergami; Ben Berkhout; Laura Berliocchi; Amélie Bernard; Monique Bernard; Francesca Bernassola; Anne Bertolotti; Amanda S Bess; Sébastien Besteiro; Saverio Bettuzzi; Savita Bhalla; Shalmoli Bhattacharyya; Sujit K Bhutia; Caroline Biagosch; Michele Wolfe Bianchi; Martine Biard-Piechaczyk; Viktor Billes; Claudia Bincoletto; Baris Bingol; Sara W Bird; Marc Bitoun; Ivana Bjedov; Craig Blackstone; Lionel Blanc; Guillermo A Blanco; Heidi Kiil Blomhoff; Emilio Boada-Romero; Stefan Böckler; Marianne Boes; Kathleen Boesze-Battaglia; Lawrence H Boise; Alessandra Bolino; Andrea Boman; Paolo Bonaldo; Matteo Bordi; Jürgen Bosch; Luis M Botana; Joelle Botti; German Bou; Marina Bouché; Marion Bouchecareilh; Marie-Josée Boucher; Michael E Boulton; Sebastien G Bouret; Patricia Boya; Michaël Boyer-Guittaut; Peter V Bozhkov; Nathan Brady; Vania Mm Braga; Claudio Brancolini; Gerhard H Braus; José M Bravo-San Pedro; Lisa A Brennan; Emery H Bresnick; Patrick Brest; Dave Bridges; Marie-Agnès Bringer; Marisa Brini; Glauber C Brito; Bertha Brodin; Paul S Brookes; Eric J Brown; Karen Brown; Hal E Broxmeyer; Alain Bruhat; Patricia Chakur Brum; John H Brumell; Nicola Brunetti-Pierri; Robert J Bryson-Richardson; Shilpa Buch; Alastair M Buchan; Hikmet Budak; Dmitry V Bulavin; Scott J Bultman; Geert Bultynck; Vladimir Bumbasirevic; Yan Burelle; Robert E Burke; Margit Burmeister; Peter Bütikofer; Laura Caberlotto; Ken Cadwell; Monika Cahova; Dongsheng Cai; Jingjing Cai; Qian Cai; Sara Calatayud; Nadine Camougrand; Michelangelo Campanella; Grant R Campbell; Matthew Campbell; Silvia Campello; Robin Candau; Isabella Caniggia; Lavinia Cantoni; Lizhi Cao; Allan B Caplan; Michele Caraglia; Claudio Cardinali; Sandra Morais Cardoso; Jennifer S Carew; Laura A Carleton; Cathleen R Carlin; Silvia Carloni; Sven R Carlsson; Didac Carmona-Gutierrez; Leticia Am Carneiro; Oliana Carnevali; Serena Carra; Alice Carrier; Bernadette Carroll; Caty Casas; Josefina Casas; Giuliana Cassinelli; Perrine Castets; Susana Castro-Obregon; Gabriella Cavallini; Isabella Ceccherini; Francesco Cecconi; Arthur I Cederbaum; Valentín Ceña; Simone Cenci; Claudia Cerella; Davide Cervia; Silvia Cetrullo; Hassan Chaachouay; Han-Jung Chae; Andrei S Chagin; Chee-Yin Chai; Gopal Chakrabarti; Georgios Chamilos; Edmond Yw Chan; Matthew Tv Chan; Dhyan Chandra; Pallavi Chandra; Chih-Peng Chang; Raymond Chuen-Chung Chang; Ta Yuan Chang; John C Chatham; Saurabh Chatterjee; Santosh Chauhan; Yongsheng Che; Michael E Cheetham; Rajkumar Cheluvappa; Chun-Jung Chen; Gang Chen; Guang-Chao Chen; Guoqiang Chen; Hongzhuan Chen; Jeff W Chen; Jian-Kang Chen; Min Chen; Mingzhou Chen; Peiwen Chen; Qi Chen; Quan Chen; Shang-Der Chen; Si Chen; Steve S-L Chen; Wei Chen; Wei-Jung Chen; Wen Qiang Chen; Wenli Chen; Xiangmei Chen; Yau-Hung Chen; Ye-Guang Chen; Yin Chen; Yingyu Chen; Yongshun Chen; Yu-Jen Chen; Yue-Qin Chen; Yujie Chen; Zhen Chen; Zhong Chen; Alan Cheng; Christopher Hk Cheng; Hua Cheng; Heesun Cheong; Sara Cherry; Jason Chesney; Chun Hei Antonio Cheung; Eric Chevet; Hsiang Cheng Chi; Sung-Gil Chi; Fulvio Chiacchiera; Hui-Ling Chiang; Roberto Chiarelli; Mario Chiariello; Marcello Chieppa; Lih-Shen Chin; Mario Chiong; Gigi Nc Chiu; Dong-Hyung Cho; Ssang-Goo Cho; William C Cho; Yong-Yeon Cho; Young-Seok Cho; Augustine Mk Choi; Eui-Ju Choi; Eun-Kyoung Choi; Jayoung Choi; Mary E Choi; Seung-Il Choi; Tsui-Fen Chou; Salem Chouaib; Divaker Choubey; Vinay Choubey; Kuan-Chih Chow; Kamal Chowdhury; Charleen T Chu; Tsung-Hsien Chuang; Taehoon Chun; Hyewon Chung; Taijoon Chung; Yuen-Li Chung; Yong-Joon Chwae; Valentina Cianfanelli; Roberto Ciarcia; Iwona A Ciechomska; Maria Rosa Ciriolo; Mara Cirone; Sofie Claerhout; Michael J Clague; Joan Clària; Peter Gh Clarke; Robert Clarke; Emilio Clementi; Cédric Cleyrat; Miriam Cnop; Eliana M Coccia; Tiziana Cocco; Patrice Codogno; Jörn Coers; Ezra Ew Cohen; David Colecchia; Luisa Coletto; Núria S Coll; Emma Colucci-Guyon; Sergio Comincini; Maria Condello; Katherine L Cook; Graham H Coombs; Cynthia D Cooper; J Mark Cooper; Isabelle Coppens; Maria Tiziana Corasaniti; Marco Corazzari; Ramon Corbalan; Elisabeth Corcelle-Termeau; Mario D Cordero; Cristina Corral-Ramos; Olga Corti; Andrea Cossarizza; Paola Costelli; Safia Costes; Susan L Cotman; Ana Coto-Montes; Sandra Cottet; Eduardo Couve; Lori R Covey; L Ashley Cowart; Jeffery S Cox; Fraser P Coxon; Carolyn B Coyne; Mark S Cragg; Rolf J Craven; Tiziana Crepaldi; Jose L Crespo; Alfredo Criollo; Valeria Crippa; Maria Teresa Cruz; Ana Maria Cuervo; Jose M Cuezva; Taixing Cui; Pedro R Cutillas; Mark J Czaja; Maria F Czyzyk-Krzeska; Ruben K Dagda; Uta Dahmen; Chunsun Dai; Wenjie Dai; Yun Dai; Kevin N Dalby; Luisa Dalla Valle; Guillaume Dalmasso; Marcello D'Amelio; Markus Damme; Arlette Darfeuille-Michaud; Catherine Dargemont; Victor M Darley-Usmar; Srinivasan Dasarathy; Biplab Dasgupta; Srikanta Dash; Crispin R Dass; Hazel Marie Davey; Lester M Davids; David Dávila; Roger J Davis; Ted M Dawson; Valina L Dawson; Paula Daza; Jackie de Belleroche; Paul de Figueiredo; Regina Celia Bressan Queiroz de Figueiredo; José de la Fuente; Luisa De Martino; Antonella De Matteis; Guido Ry De Meyer; Angelo De Milito; Mauro De Santi; Wanderley de Souza; Vincenzo De Tata; Daniela De Zio; Jayanta Debnath; Reinhard Dechant; Jean-Paul Decuypere; Shane Deegan; Benjamin Dehay; Barbara Del Bello; Dominic P Del Re; Régis Delage-Mourroux; Lea Md Delbridge; Louise Deldicque; Elizabeth Delorme-Axford; Yizhen Deng; Joern Dengjel; Melanie Denizot; Paul Dent; Channing J Der; Vojo Deretic; Benoît Derrien; Eric Deutsch; Timothy P Devarenne; Rodney J Devenish; Sabrina Di Bartolomeo; Nicola Di Daniele; Fabio Di Domenico; Alessia Di Nardo; Simone Di Paola; Antonio Di Pietro; Livia Di Renzo; Aaron DiAntonio; Guillermo Díaz-Araya; Ines Díaz-Laviada; Maria T Diaz-Meco; Javier Diaz-Nido; Chad A Dickey; Robert C Dickson; Marc Diederich; Paul Digard; Ivan Dikic; Savithrama P Dinesh-Kumar; Chan Ding; Wen-Xing Ding; Zufeng Ding; Luciana Dini; Jörg Hw Distler; Abhinav Diwan; Mojgan Djavaheri-Mergny; Kostyantyn Dmytruk; Renwick Cj Dobson; Volker Doetsch; Karol Dokladny; Svetlana Dokudovskaya; Massimo Donadelli; X Charlie Dong; Xiaonan Dong; Zheng Dong; Terrence M Donohue; Kelly S Doran; Gabriella D'Orazi; Gerald W Dorn; Victor Dosenko; Sami Dridi; Liat Drucker; Jie Du; Li-Lin Du; Lihuan Du; André du Toit; Priyamvada Dua; Lei Duan; Pu Duann; Vikash Kumar Dubey; Michael R Duchen; Michel A Duchosal; Helene Duez; Isabelle Dugail; Verónica I Dumit; Mara C Duncan; Elaine A Dunlop; William A Dunn; Nicolas Dupont; Luc Dupuis; Raúl V Durán; Thomas M Durcan; Stéphane Duvezin-Caubet; Umamaheswar Duvvuri; Vinay Eapen; Darius Ebrahimi-Fakhari; Arnaud Echard; Leopold Eckhart; Charles L Edelstein; Aimee L Edinger; Ludwig Eichinger; Tobias Eisenberg; Avital Eisenberg-Lerner; N Tony Eissa; Wafik S El-Deiry; Victoria El-Khoury; Zvulun Elazar; Hagit Eldar-Finkelman; Chris Jh Elliott; Enzo Emanuele; Urban Emmenegger; Nikolai Engedal; Anna-Mart Engelbrecht; Simone Engelender; Jorrit M Enserink; Ralf Erdmann; Jekaterina Erenpreisa; Rajaraman Eri; Jason L Eriksen; Andreja Erman; Ricardo Escalante; Eeva-Liisa Eskelinen; Lucile Espert; Lorena Esteban-Martínez; Thomas J Evans; Mario Fabri; Gemma Fabrias; Cinzia Fabrizi; Antonio Facchiano; Nils J Færgeman; Alberto Faggioni; W Douglas Fairlie; Chunhai Fan; Daping Fan; Jie Fan; Shengyun Fang; Manolis Fanto; Alessandro Fanzani; Thomas Farkas; Mathias Faure; Francois B Favier; Howard Fearnhead; Massimo Federici; Erkang Fei; Tania C Felizardo; Hua Feng; Yibin Feng; Yuchen Feng; Thomas A Ferguson; Álvaro F Fernández; Maite G Fernandez-Barrena; Jose C Fernandez-Checa; Arsenio Fernández-López; Martin E Fernandez-Zapico; Olivier Feron; Elisabetta Ferraro; Carmen Veríssima Ferreira-Halder; Laszlo Fesus; Ralph Feuer; Fabienne C Fiesel; Eduardo C Filippi-Chiela; Giuseppe Filomeni; Gian Maria Fimia; John H Fingert; Steven Finkbeiner; Toren Finkel; Filomena Fiorito; Paul B Fisher; Marc Flajolet; Flavio Flamigni; Oliver Florey; Salvatore Florio; R Andres Floto; Marco Folini; Carlo Follo; Edward A Fon; Francesco Fornai; Franco Fortunato; Alessandro Fraldi; Rodrigo Franco; Arnaud Francois; Aurélie François; Lisa B Frankel; Iain Dc Fraser; Norbert Frey; Damien G Freyssenet; Christian Frezza; Scott L Friedman; Daniel E Frigo; Dongxu Fu; José M Fuentes; Juan Fueyo; Yoshio Fujitani; Yuuki Fujiwara; Mikihiro Fujiya; Mitsunori Fukuda; Simone Fulda; Carmela Fusco; Bozena Gabryel; Matthias Gaestel; Philippe Gailly; Malgorzata Gajewska; Sehamuddin Galadari; Gad Galili; Inmaculada Galindo; Maria F Galindo; Giovanna Galliciotti; Lorenzo Galluzzi; Luca Galluzzi; Vincent Galy; Noor Gammoh; Sam Gandy; Anand K Ganesan; Swamynathan Ganesan; Ian G Ganley; Monique Gannagé; Fen-Biao Gao; Feng Gao; Jian-Xin Gao; Lorena García Nannig; Eleonora García Véscovi; Marina Garcia-Macía; Carmen Garcia-Ruiz; Abhishek D Garg; Pramod Kumar Garg; Ricardo Gargini; Nils Christian Gassen; Damián Gatica; Evelina Gatti; Julie Gavard; Evripidis Gavathiotis; Liang Ge; Pengfei Ge; Shengfang Ge; Po-Wu Gean; Vania Gelmetti; Armando A Genazzani; Jiefei Geng; Pascal Genschik; Lisa Gerner; Jason E Gestwicki; David A Gewirtz; Saeid Ghavami; Eric Ghigo; Debabrata Ghosh; Anna Maria Giammarioli; Francesca Giampieri; Claudia Giampietri; Alexandra Giatromanolaki; Derrick J Gibbings; Lara Gibellini; Spencer B Gibson; Vanessa Ginet; Antonio Giordano; Flaviano Giorgini; Elisa Giovannetti; Stephen E Girardin; Suzana Gispert; Sandy Giuliano; Candece L Gladson; Alvaro Glavic; Martin Gleave; Nelly Godefroy; Robert M Gogal; Kuppan Gokulan; Gustavo H Goldman; Delia Goletti; Michael S Goligorsky; Aldrin V Gomes; Ligia C Gomes; Hernando Gomez; Candelaria Gomez-Manzano; Rubén Gómez-Sánchez; Dawit Ap Gonçalves; Ebru Goncu; Qingqiu Gong; Céline Gongora; Carlos B Gonzalez; Pedro Gonzalez-Alegre; Pilar Gonzalez-Cabo; Rosa Ana González-Polo; Ing Swie Goping; Carlos Gorbea; Nikolai V Gorbunov; Daphne R Goring; Adrienne M Gorman; Sharon M Gorski; Sandro Goruppi; Shino Goto-Yamada; Cecilia Gotor; Roberta A Gottlieb; Illana Gozes; Devrim Gozuacik; Yacine Graba; Martin Graef; Giovanna E Granato; Gary Dean Grant; Steven Grant; Giovanni Luca Gravina; Douglas R Green; Alexander Greenhough; Michael T Greenwood; Benedetto Grimaldi; Frédéric Gros; Charles Grose; Jean-Francois Groulx; Florian Gruber; Paolo Grumati; Tilman Grune; Jun-Lin Guan; Kun-Liang Guan; Barbara Guerra; Carlos Guillen; Kailash Gulshan; Jan Gunst; Chuanyong Guo; Lei Guo; Ming Guo; Wenjie Guo; Xu-Guang Guo; Andrea A Gust; Åsa B Gustafsson; Elaine Gutierrez; Maximiliano G Gutierrez; Ho-Shin Gwak; Albert Haas; James E Haber; Shinji Hadano; Monica Hagedorn; David R Hahn; Andrew J Halayko; Anne Hamacher-Brady; Kozo Hamada; Ahmed Hamai; Andrea Hamann; Maho Hamasaki; Isabelle Hamer; Qutayba Hamid; Ester M Hammond; Feng Han; Weidong Han; James T Handa; John A Hanover; Malene Hansen; Masaru Harada; Ljubica Harhaji-Trajkovic; J Wade Harper; Abdel Halim Harrath; Adrian L Harris; James Harris; Udo Hasler; Peter Hasselblatt; Kazuhisa Hasui; Robert G Hawley; Teresa S Hawley; Congcong He; Cynthia Y He; Fengtian He; Gu He; Rong-Rong He; Xian-Hui He; You-Wen He; Yu-Ying He; Joan K Heath; Marie-Josée Hébert; Robert A Heinzen; Gudmundur Vignir Helgason; Michael Hensel; Elizabeth P Henske; Chengtao Her; Paul K Herman; Agustín Hernández; Carlos Hernandez; Sonia Hernández-Tiedra; Claudio Hetz; P Robin Hiesinger; Katsumi Higaki; Sabine Hilfiker; Bradford G Hill; Joseph A Hill; William D Hill; Keisuke Hino; Daniel Hofius; Paul Hofman; Günter U Höglinger; Jörg Höhfeld; Marina K Holz; Yonggeun Hong; David A Hood; Jeroen Jm Hoozemans; Thorsten Hoppe; Chin Hsu; Chin-Yuan Hsu; Li-Chung Hsu; Dong Hu; Guochang Hu; Hong-Ming Hu; Hongbo Hu; Ming Chang Hu; Yu-Chen Hu; Zhuo-Wei Hu; Fang Hua; Ya Hua; Canhua Huang; Huey-Lan Huang; Kuo-How Huang; Kuo-Yang Huang; Shile Huang; Shiqian Huang; Wei-Pang Huang; Yi-Ran Huang; Yong Huang; Yunfei Huang; Tobias B Huber; Patricia Huebbe; Won-Ki Huh; Juha J Hulmi; Gang Min Hur; James H Hurley; Zvenyslava Husak; Sabah Na Hussain; Salik Hussain; Jung Jin Hwang; Seungmin Hwang; Thomas Is Hwang; Atsuhiro Ichihara; Yuzuru Imai; Carol Imbriano; Megumi Inomata; Takeshi Into; Valentina Iovane; Juan L Iovanna; Renato V Iozzo; Nancy Y Ip; Javier E Irazoqui; Pablo Iribarren; Yoshitaka Isaka; Aleksandra J Isakovic; Harry Ischiropoulos; Jeffrey S Isenberg; Mohammad Ishaq; Hiroyuki Ishida; Isao Ishii; Jane E Ishmael; Ciro Isidoro; Ken-Ichi Isobe; Erika Isono; Shohreh Issazadeh-Navikas; Koji Itahana; Eisuke Itakura; Andrei I Ivanov; Anand Krishnan V Iyer; José M Izquierdo; Yotaro Izumi; Valentina Izzo; Marja Jäättelä; Nadia Jaber; Daniel John Jackson; William T Jackson; Tony George Jacob; Thomas S Jacques; Chinnaswamy Jagannath; Ashish Jain; Nihar Ranjan Jana; Byoung Kuk Jang; Alkesh Jani; Bassam Janji; Paulo Roberto Jannig; Patric J Jansson; Steve Jean; Marina Jendrach; Ju-Hong Jeon; Niels Jessen; Eui-Bae Jeung; Kailiang Jia; Lijun Jia; Hong Jiang; Hongchi Jiang; Liwen Jiang; Teng Jiang; Xiaoyan Jiang; Xuejun Jiang; Xuejun Jiang; Ying Jiang; Yongjun Jiang; Alberto Jiménez; Cheng Jin; Hongchuan Jin; Lei Jin; Meiyan Jin; Shengkan Jin; Umesh Kumar Jinwal; Eun-Kyeong Jo; Terje Johansen; Daniel E Johnson; Gail Vw Johnson; James D Johnson; Eric Jonasch; Chris Jones; Leo Ab Joosten; Joaquin Jordan; Anna-Maria Joseph; Bertrand Joseph; Annie M Joubert; Dianwen Ju; Jingfang Ju; Hsueh-Fen Juan; Katrin Juenemann; Gábor Juhász; Hye Seung Jung; Jae U Jung; Yong-Keun Jung; Heinz Jungbluth; Matthew J Justice; Barry Jutten; Nadeem O Kaakoush; Kai Kaarniranta; Allen Kaasik; Tomohiro Kabuta; Bertrand Kaeffer; Katarina Kågedal; Alon Kahana; Shingo Kajimura; Or Kakhlon; Manjula Kalia; Dhan V Kalvakolanu; Yoshiaki Kamada; Konstantinos Kambas; Vitaliy O Kaminskyy; Harm H Kampinga; Mustapha Kandouz; Chanhee Kang; Rui Kang; Tae-Cheon Kang; Tomotake Kanki; Thirumala-Devi Kanneganti; Haruo Kanno; Anumantha G Kanthasamy; Marc Kantorow; Maria Kaparakis-Liaskos; Orsolya Kapuy; Vassiliki Karantza; Md Razaul Karim; Parimal Karmakar; Arthur Kaser; Susmita Kaushik; Thomas Kawula; A Murat Kaynar; Po-Yuan Ke; Zun-Ji Ke; John H Kehrl; Kate E Keller; Jongsook Kim Kemper; Anne K Kenworthy; Oliver Kepp; Andreas Kern; Santosh Kesari; David Kessel; Robin Ketteler; Isis do Carmo Kettelhut; Bilon Khambu; Muzamil Majid Khan; Vinoth Km Khandelwal; Sangeeta Khare; Juliann G Kiang; Amy A Kiger; Akio Kihara; Arianna L Kim; Cheol Hyeon Kim; Deok Ryong Kim; Do-Hyung Kim; Eung Kweon Kim; Hye Young Kim; Hyung-Ryong Kim; Jae-Sung Kim; Jeong Hun Kim; Jin Cheon Kim; Jin Hyoung Kim; Kwang Woon Kim; Michael D Kim; Moon-Moo Kim; Peter K Kim; Seong Who Kim; Soo-Youl Kim; Yong-Sun Kim; Yonghyun Kim; Adi Kimchi; Alec C Kimmelman; Tomonori Kimura; Jason S King; Karla Kirkegaard; Vladimir Kirkin; Lorrie A Kirshenbaum; Shuji Kishi; Yasuo Kitajima; Katsuhiko Kitamoto; Yasushi Kitaoka; Kaio Kitazato; Rudolf A Kley; Walter T Klimecki; Michael Klinkenberg; Jochen Klucken; Helene Knævelsrud; Erwin Knecht; Laura Knuppertz; Jiunn-Liang Ko; Satoru Kobayashi; Jan C Koch; Christelle Koechlin-Ramonatxo; Ulrich Koenig; Young Ho Koh; Katja Köhler; Sepp D Kohlwein; Masato Koike; Masaaki Komatsu; Eiki Kominami; Dexin Kong; Hee Jeong Kong; Eumorphia G Konstantakou; Benjamin T Kopp; Tamas Korcsmaros; Laura Korhonen; Viktor I Korolchuk; Nadya V Koshkina; Yanjun Kou; Michael I Koukourakis; Constantinos Koumenis; Attila L Kovács; Tibor Kovács; Werner J Kovacs; Daisuke Koya; Claudine Kraft; Dimitri Krainc; Helmut Kramer; Tamara Kravic-Stevovic; Wilhelm Krek; Carole Kretz-Remy; Roswitha Krick; Malathi Krishnamurthy; Janos Kriston-Vizi; Guido Kroemer; Michael C Kruer; Rejko Kruger; Nicholas T Ktistakis; Kazuyuki Kuchitsu; Christian Kuhn; Addanki Pratap Kumar; Anuj Kumar; Ashok Kumar; Deepak Kumar; Dhiraj Kumar; Rakesh Kumar; Sharad Kumar; Mondira Kundu; Hsing-Jien Kung; Atsushi Kuno; Sheng-Han Kuo; Jeff Kuret; Tino Kurz; Terry Kwok; Taeg Kyu Kwon; Yong Tae Kwon; Irene Kyrmizi; Albert R La Spada; Frank Lafont; Tim Lahm; Aparna Lakkaraju; Truong Lam; Trond Lamark; Steve Lancel; Terry H Landowski; Darius J R Lane; Jon D Lane; Cinzia Lanzi; Pierre Lapaquette; Louis R Lapierre; Jocelyn Laporte; Johanna Laukkarinen; Gordon W Laurie; Sergio Lavandero; Lena Lavie; Matthew J LaVoie; Betty Yuen Kwan Law; Helen Ka-Wai Law; Kelsey B Law; Robert Layfield; Pedro A Lazo; Laurent Le Cam; Karine G Le Roch; Hervé Le Stunff; Vijittra Leardkamolkarn; Marc Lecuit; Byung-Hoon Lee; Che-Hsin Lee; Erinna F Lee; Gyun Min Lee; He-Jin Lee; Hsinyu Lee; Jae Keun Lee; Jongdae Lee; Ju-Hyun Lee; Jun Hee Lee; Michael Lee; Myung-Shik Lee; Patty J Lee; Sam W Lee; Seung-Jae Lee; Shiow-Ju Lee; Stella Y Lee; Sug Hyung Lee; Sung Sik Lee; Sung-Joon Lee; Sunhee Lee; Ying-Ray Lee; Yong J Lee; Young H Lee; Christiaan Leeuwenburgh; Sylvain Lefort; Renaud Legouis; Jinzhi Lei; Qun-Ying Lei; David A Leib; Gil Leibowitz; Istvan Lekli; Stéphane D Lemaire; John J Lemasters; Marius K Lemberg; Antoinette Lemoine; Shuilong Leng; Guido Lenz; Paola Lenzi; Lilach O Lerman; Daniele Lettieri Barbato; Julia I-Ju Leu; Hing Y Leung; Beth Levine; Patrick A Lewis; Frank Lezoualc'h; Chi Li; Faqiang Li; Feng-Jun Li; Jun Li; Ke Li; Lian Li; Min Li; Min Li; Qiang Li; Rui Li; Sheng Li; Wei Li; Wei Li; Xiaotao Li; Yumin Li; Jiqin Lian; Chengyu Liang; Qiangrong Liang; Yulin Liao; Joana Liberal; Pawel P Liberski; Pearl Lie; Andrew P Lieberman; Hyunjung Jade Lim; Kah-Leong Lim; Kyu Lim; Raquel T Lima; Chang-Shen Lin; Chiou-Feng Lin; Fang Lin; Fangming Lin; Fu-Cheng Lin; Kui Lin; Kwang-Huei Lin; Pei-Hui Lin; Tianwei Lin; Wan-Wan Lin; Yee-Shin Lin; Yong Lin; Rafael Linden; Dan Lindholm; Lisa M Lindqvist; Paul Lingor; Andreas Linkermann; Lance A Liotta; Marta M Lipinski; Vitor A Lira; Michael P Lisanti; Paloma B Liton; Bo Liu; Chong Liu; Chun-Feng Liu; Fei Liu; Hung-Jen Liu; Jianxun Liu; Jing-Jing Liu; Jing-Lan Liu; Ke Liu; Leyuan Liu; Liang Liu; Quentin Liu; Rong-Yu Liu; Shiming Liu; Shuwen Liu; Wei Liu; Xian-De Liu; Xiangguo Liu; Xiao-Hong Liu; Xinfeng Liu; Xu Liu; Xueqin Liu; Yang Liu; Yule Liu; Zexian Liu; Zhe Liu; Juan P Liuzzi; Gérard Lizard; Mila Ljujic; Irfan J Lodhi; Susan E Logue; Bal L Lokeshwar; Yun Chau Long; Sagar Lonial; Benjamin Loos; Carlos López-Otín; Cristina López-Vicario; Mar Lorente; Philip L Lorenzi; Péter Lõrincz; Marek Los; Michael T Lotze; Penny E Lovat; Binfeng Lu; Bo Lu; Jiahong Lu; Qing Lu; She-Min Lu; Shuyan Lu; Yingying Lu; Frédéric Luciano; Shirley Luckhart; John Milton Lucocq; Paula Ludovico; Aurelia Lugea; Nicholas W Lukacs; Julian J Lum; Anders H Lund; Honglin Luo; Jia Luo; Shouqing Luo; Claudio Luparello; Timothy Lyons; Jianjie Ma; Yi Ma; Yong Ma; Zhenyi Ma; Juliano Machado; Glaucia M Machado-Santelli; Fernando Macian; Gustavo C MacIntosh; Jeffrey P MacKeigan; Kay F Macleod; John D MacMicking; Lee Ann MacMillan-Crow; Frank Madeo; Muniswamy Madesh; Julio Madrigal-Matute; Akiko Maeda; Tatsuya Maeda; Gustavo Maegawa; Emilia Maellaro; Hannelore Maes; Marta Magariños; Kenneth Maiese; Tapas K Maiti; Luigi Maiuri; Maria Chiara Maiuri; Carl G Maki; Roland Malli; Walter Malorni; Alina Maloyan; Fathia Mami-Chouaib; Na Man; Joseph D Mancias; Eva-Maria Mandelkow; Michael A Mandell; Angelo A Manfredi; Serge N Manié; Claudia Manzoni; Kai Mao; Zixu Mao; Zong-Wan Mao; Philippe Marambaud; Anna Maria Marconi; Zvonimir Marelja; Gabriella Marfe; Marta Margeta; Eva Margittai; Muriel Mari; Francesca V Mariani; Concepcio Marin; Sara Marinelli; Guillermo Mariño; Ivanka Markovic; Rebecca Marquez; Alberto M Martelli; Sascha Martens; Katie R Martin; Seamus J Martin; Shaun Martin; Miguel A Martin-Acebes; Paloma Martín-Sanz; Camille Martinand-Mari; Wim Martinet; Jennifer Martinez; Nuria Martinez-Lopez; Ubaldo Martinez-Outschoorn; Moisés Martínez-Velázquez; Marta Martinez-Vicente; Waleska Kerllen Martins; Hirosato Mashima; James A Mastrianni; Giuseppe Matarese; Paola Matarrese; Roberto Mateo; Satoaki Matoba; Naomichi Matsumoto; Takehiko Matsushita; Akira Matsuura; Takeshi Matsuzawa; Mark P Mattson; Soledad Matus; Norma Maugeri; Caroline Mauvezin; Andreas Mayer; Dusica Maysinger; Guillermo D Mazzolini; Mary Kate McBrayer; Kimberly McCall; Craig McCormick; Gerald M McInerney; Skye C McIver; Sharon McKenna; John J McMahon; Iain A McNeish; Fatima Mechta-Grigoriou; Jan Paul Medema; Diego L Medina; Klara Megyeri; Maryam Mehrpour; Jawahar L Mehta; Yide Mei; Ute-Christiane Meier; Alfred J Meijer; Alicia Meléndez; Gerry Melino; Sonia Melino; Edesio Jose Tenorio de Melo; Maria A Mena; Marc D Meneghini; Javier A Menendez; Regina Menezes; Liesu Meng; Ling-Hua Meng; Songshu Meng; Rossella Menghini; A Sue Menko; Rubem Fs Menna-Barreto; Manoj B Menon; Marco A Meraz-Ríos; Giuseppe Merla; Luciano Merlini; Angelica M Merlot; Andreas Meryk; Stefania Meschini; Joel N Meyer; Man-Tian Mi; Chao-Yu Miao; Lucia Micale; Simon Michaeli; Carine Michiels; Anna Rita Migliaccio; Anastasia Susie Mihailidou; Dalibor Mijaljica; Katsuhiko Mikoshiba; Enrico Milan; Leonor Miller-Fleming; Gordon B Mills; Ian G Mills; Georgia Minakaki; Berge A Minassian; Xiu-Fen Ming; Farida Minibayeva; Elena A Minina; Justine D Mintern; Saverio Minucci; Antonio Miranda-Vizuete; Claire H Mitchell; Shigeki Miyamoto; Keisuke Miyazawa; Noboru Mizushima; Katarzyna Mnich; Baharia Mograbi; Simin Mohseni; Luis Ferreira Moita; Marco Molinari; Maurizio Molinari; Andreas Buch Møller; Bertrand Mollereau; Faustino Mollinedo; Marco Mongillo; Martha M Monick; Serena Montagnaro; Craig Montell; Darren J Moore; Michael N Moore; Rodrigo Mora-Rodriguez; Paula I Moreira; Etienne Morel; Maria Beatrice Morelli; Sandra Moreno; Michael J Morgan; Arnaud Moris; Yuji Moriyasu; Janna L Morrison; Lynda A Morrison; Eugenia Morselli; Jorge Moscat; Pope L Moseley; Serge Mostowy; Elisa Motori; Denis Mottet; Jeremy C Mottram; Charbel E-H Moussa; Vassiliki E Mpakou; Hasan Mukhtar; Jean M Mulcahy Levy; Sylviane Muller; Raquel Muñoz-Moreno; Cristina Muñoz-Pinedo; Christian Münz; Maureen E Murphy; James T Murray; Aditya Murthy; Indira U Mysorekar; Ivan R Nabi; Massimo Nabissi; Gustavo A Nader; Yukitoshi Nagahara; Yoshitaka Nagai; Kazuhiro Nagata; Anika Nagelkerke; Péter Nagy; Samisubbu R Naidu; Sreejayan Nair; Hiroyasu Nakano; Hitoshi Nakatogawa; Meera Nanjundan; Gennaro Napolitano; Naweed I Naqvi; Roberta Nardacci; Derek P Narendra; Masashi Narita; Anna Chiara Nascimbeni; Ramesh Natarajan; Luiz C Navegantes; Steffan T Nawrocki; Taras Y Nazarko; Volodymyr Y Nazarko; Thomas Neill; Luca M Neri; Mihai G Netea; Romana T Netea-Maier; Bruno M Neves; Paul A Ney; Ioannis P Nezis; Hang Tt Nguyen; Huu Phuc Nguyen; Anne-Sophie Nicot; Hilde Nilsen; Per Nilsson; Mikio Nishimura; Ichizo Nishino; Mireia Niso-Santano; Hua Niu; Ralph A Nixon; Vincent Co Njar; Takeshi Noda; Angelika A Noegel; Elsie Magdalena Nolte; Erik Norberg; Koenraad K Norga; Sakineh Kazemi Noureini; Shoji Notomi; Lucia Notterpek; Karin Nowikovsky; Nobuyuki Nukina; Thorsten Nürnberger; Valerie B O'Donnell; Tracey O'Donovan; Peter J O'Dwyer; Ina Oehme; Clara L Oeste; Michinaga Ogawa; Besim Ogretmen; Yuji Ogura; Young J Oh; Masaki Ohmuraya; Takayuki Ohshima; Rani Ojha; Koji Okamoto; Toshiro Okazaki; F Javier Oliver; Karin Ollinger; Stefan Olsson; Daniel P Orban; Paulina Ordonez; Idil Orhon; Laszlo Orosz; Eyleen J O'Rourke; Helena Orozco; Angel L Ortega; Elena Ortona; Laura D Osellame; Junko Oshima; Shigeru Oshima; Heinz D Osiewacz; Takanobu Otomo; Kinya Otsu; Jing-Hsiung James Ou; Tiago F Outeiro; Dong-Yun Ouyang; Hongjiao Ouyang; Michael Overholtzer; Michelle A Ozbun; P Hande Ozdinler; Bulent Ozpolat; Consiglia Pacelli; Paolo Paganetti; Guylène Page; Gilles Pages; Ugo Pagnini; Beata Pajak; Stephen C Pak; Karolina Pakos-Zebrucka; Nazzy Pakpour; Zdena Palková; Francesca Palladino; Kathrin Pallauf; Nicolas Pallet; Marta Palmieri; Søren R Paludan; Camilla Palumbo; Silvia Palumbo; Olatz Pampliega; Hongming Pan; Wei Pan; Theocharis Panaretakis; Aseem Pandey; Areti Pantazopoulou; Zuzana Papackova; Daniela L Papademetrio; Issidora Papassideri; Alessio Papini; Nirmala Parajuli; Julian Pardo; Vrajesh V Parekh; Giancarlo Parenti; Jong-In Park; Junsoo Park; Ohkmae K Park; Roy Parker; Rosanna Parlato; Jan B Parys; Katherine R Parzych; Jean-Max Pasquet; Benoit Pasquier; Kishore Bs Pasumarthi; Daniel Patschan; Cam Patterson; Sophie Pattingre; Scott Pattison; Arnim Pause; Hermann Pavenstädt; Flaminia Pavone; Zully Pedrozo; Fernando J Peña; Miguel A Peñalva; Mario Pende; Jianxin Peng; Fabio Penna; Josef M Penninger; Anna Pensalfini; Salvatore Pepe; Gustavo Js Pereira; Paulo C Pereira; Verónica Pérez-de la Cruz; María Esther Pérez-Pérez; Diego Pérez-Rodríguez; Dolores Pérez-Sala; Celine Perier; Andras Perl; David H Perlmutter; Ida Perrotta; Shazib Pervaiz; Maija Pesonen; Jeffrey E Pessin; Godefridus J Peters; Morten Petersen; Irina Petrache; Basil J Petrof; Goran Petrovski; James M Phang; Mauro Piacentini; Marina Pierdominici; Philippe Pierre; Valérie Pierrefite-Carle; Federico Pietrocola; Felipe X Pimentel-Muiños; Mario Pinar; Benjamin Pineda; Ronit Pinkas-Kramarski; Marcello Pinti; Paolo Pinton; Bilal Piperdi; James M Piret; Leonidas C Platanias; Harald W Platta; Edward D Plowey; Stefanie Pöggeler; Marc Poirot; Peter Polčic; Angelo Poletti; Audrey H Poon; Hana Popelka; Blagovesta Popova; Izabela Poprawa; Shibu M Poulose; Joanna Poulton; Scott K Powers; Ted Powers; Mercedes Pozuelo-Rubio; Krisna Prak; Reinhild Prange; Mark Prescott; Muriel Priault; Sharon Prince; Richard L Proia; Tassula Proikas-Cezanne; Holger Prokisch; Vasilis J Promponas; Karin Przyklenk; Rosa Puertollano; Subbiah Pugazhenthi; Luigi Puglielli; Aurora Pujol; Julien Puyal; Dohun Pyeon; Xin Qi; Wen-Bin Qian; Zheng-Hong Qin; Yu Qiu; Ziwei Qu; Joe Quadrilatero; Frederick Quinn; Nina Raben; Hannah Rabinowich; Flavia Radogna; Michael J Ragusa; Mohamed Rahmani; Komal Raina; Sasanka Ramanadham; Rajagopal Ramesh; Abdelhaq Rami; Sarron Randall-Demllo; Felix Randow; Hai Rao; V Ashutosh Rao; Blake B Rasmussen; Tobias M Rasse; Edward A Ratovitski; Pierre-Emmanuel Rautou; Swapan K Ray; Babak Razani; Bruce H Reed; Fulvio Reggiori; Markus Rehm; Andreas S Reichert; Theo Rein; David J Reiner; Eric Reits; Jun Ren; Xingcong Ren; Maurizio Renna; Jane Eb Reusch; Jose L Revuelta; Leticia Reyes; Alireza R Rezaie; Robert I Richards; Des R Richardson; Clémence Richetta; Michael A Riehle; Bertrand H Rihn; Yasuko Rikihisa; Brigit E Riley; Gerald Rimbach; Maria Rita Rippo; Konstantinos Ritis; Federica Rizzi; Elizete Rizzo; Peter J Roach; Jeffrey Robbins; Michel Roberge; Gabriela Roca; Maria Carmela Roccheri; Sonia Rocha; Cecilia Mp Rodrigues; Clara I Rodríguez; Santiago Rodriguez de Cordoba; Natalia Rodriguez-Muela; Jeroen Roelofs; Vladimir V Rogov; Troy T Rohn; Bärbel Rohrer; Davide Romanelli; Luigina Romani; Patricia Silvia Romano; M Isabel G Roncero; Jose Luis Rosa; Alicia Rosello; Kirill V Rosen; Philip Rosenstiel; Magdalena Rost-Roszkowska; Kevin A Roth; Gael Roué; Mustapha Rouis; Kasper M Rouschop; Daniel T Ruan; Diego Ruano; David C Rubinsztein; Edmund B Rucker; Assaf Rudich; Emil Rudolf; Ruediger Rudolf; Markus A Ruegg; Carmen Ruiz-Roldan; Avnika Ashok Ruparelia; Paola Rusmini; David W Russ; Gian Luigi Russo; Giuseppe Russo; Rossella Russo; Tor Erik Rusten; Victoria Ryabovol; Kevin M Ryan; Stefan W Ryter; David M Sabatini; Michael Sacher; Carsten Sachse; Michael N Sack; Junichi Sadoshima; Paul Saftig; Ronit Sagi-Eisenberg; Sumit Sahni; Pothana Saikumar; Tsunenori Saito; Tatsuya Saitoh; Koichi Sakakura; Machiko Sakoh-Nakatogawa; Yasuhito Sakuraba; María Salazar-Roa; Paolo Salomoni; Ashok K Saluja; Paul M Salvaterra; Rosa Salvioli; Afshin Samali; Anthony Mj Sanchez; José A Sánchez-Alcázar; Ricardo Sanchez-Prieto; Marco Sandri; Miguel A Sanjuan; Stefano Santaguida; Laura Santambrogio; Giorgio Santoni; Claudia Nunes Dos Santos; Shweta Saran; Marco Sardiello; Graeme Sargent; Pallabi Sarkar; Sovan Sarkar; Maria Rosa Sarrias; Minnie M Sarwal; Chihiro Sasakawa; Motoko Sasaki; Miklos Sass; Ken Sato; Miyuki Sato; Joseph Satriano; Niramol Savaraj; Svetlana Saveljeva; Liliana Schaefer; Ulrich E Schaible; Michael Scharl; Hermann M Schatzl; Randy Schekman; Wiep Scheper; Alfonso Schiavi; Hyman M Schipper; Hana Schmeisser; Jens Schmidt; Ingo Schmitz; Bianca E Schneider; E Marion Schneider; Jaime L Schneider; Eric A Schon; Miriam J Schönenberger; Axel H Schönthal; Daniel F Schorderet; Bernd Schröder; Sebastian Schuck; Ryan J Schulze; Melanie Schwarten; Thomas L Schwarz; Sebastiano Sciarretta; Kathleen Scotto; A Ivana Scovassi; Robert A Screaton; Mark Screen; Hugo Seca; Simon Sedej; Laura Segatori; Nava Segev; Per O Seglen; Jose M Seguí-Simarro; Juan Segura-Aguilar; Ekihiro Seki; Christian Sell; Iban Seiliez; Clay F Semenkovich; Gregg L Semenza; Utpal Sen; Andreas L Serra; Ana Serrano-Puebla; Hiromi Sesaki; Takao Setoguchi; Carmine Settembre; John J Shacka; Ayesha N Shajahan-Haq; Irving M Shapiro; Shweta Sharma; Hua She; C-K James Shen; Chiung-Chyi Shen; Han-Ming Shen; Sanbing Shen; Weili Shen; Rui Sheng; Xianyong Sheng; Zu-Hang Sheng; Trevor G Shepherd; Junyan Shi; Qiang Shi; Qinghua Shi; Yuguang Shi; Shusaku Shibutani; Kenichi Shibuya; Yoshihiro Shidoji; Jeng-Jer Shieh; Chwen-Ming Shih; Yohta Shimada; Shigeomi Shimizu; Dong Wook Shin; Mari L Shinohara; Michiko Shintani; Takahiro Shintani; Tetsuo Shioi; Ken Shirabe; Ronit Shiri-Sverdlov; Orian Shirihai; Gordon C Shore; Chih-Wen Shu; Deepak Shukla; Andriy A Sibirny; Valentina Sica; Christina J Sigurdson; Einar M Sigurdsson; Puran Singh Sijwali; Beata Sikorska; Wilian A Silveira; Sandrine Silvente-Poirot; Gary A Silverman; Jan Simak; Thomas Simmet; Anna Katharina Simon; Hans-Uwe Simon; Cristiano Simone; Matias Simons; Anne Simonsen; Rajat Singh; Shivendra V Singh; Shrawan K Singh; Debasish Sinha; Sangita Sinha; Frank A Sinicrope; Agnieszka Sirko; Kapil Sirohi; Balindiwe Jn Sishi; Annie Sittler; Parco M Siu; Efthimios Sivridis; Anna Skwarska; Ruth Slack; Iva Slaninová; Nikolai Slavov; Soraya S Smaili; Keiran Sm Smalley; Duncan R Smith; Stefaan J Soenen; Scott A Soleimanpour; Anita Solhaug; Kumaravel Somasundaram; Jin H Son; Avinash Sonawane; Chunjuan Song; Fuyong Song; Hyun Kyu Song; Ju-Xian Song; Wei Song; Kai Y Soo; Anil K Sood; Tuck Wah Soong; Virawudh Soontornniyomkij; Maurizio Sorice; Federica Sotgia; David R Soto-Pantoja; Areechun Sotthibundhu; Maria João Sousa; Herman P Spaink; Paul N Span; Anne Spang; Janet D Sparks; Peter G Speck; Stephen A Spector; Claudia D Spies; Wolfdieter Springer; Daret St Clair; Alessandra Stacchiotti; Bart Staels; Michael T Stang; Daniel T Starczynowski; Petro Starokadomskyy; Clemens Steegborn; John W Steele; Leonidas Stefanis; Joan Steffan; Christine M Stellrecht; Harald Stenmark; Tomasz M Stepkowski; Stęphan T Stern; Craig Stevens; Brent R Stockwell; Veronika Stoka; Zuzana Storchova; Björn Stork; Vassilis Stratoulias; Dimitrios J Stravopodis; Pavel Strnad; Anne Marie Strohecker; Anna-Lena Ström; Per Stromhaug; Jiri Stulik; Yu-Xiong Su; Zhaoliang Su; Carlos S Subauste; Srinivasa Subramaniam; Carolyn M Sue; Sang Won Suh; Xinbing Sui; Supawadee Sukseree; David Sulzer; Fang-Lin Sun; Jiaren Sun; Jun Sun; Shi-Yong Sun; Yang Sun; Yi Sun; Yingjie Sun; Vinod Sundaramoorthy; Joseph Sung; Hidekazu Suzuki; Kuninori Suzuki; Naoki Suzuki; Tadashi Suzuki; Yuichiro J Suzuki; Michele S Swanson; Charles Swanton; Karl Swärd; Ghanshyam Swarup; Sean T Sweeney; Paul W Sylvester; Zsuzsanna Szatmari; Eva Szegezdi; Peter W Szlosarek; Heinrich Taegtmeyer; Marco Tafani; Emmanuel Taillebourg; Stephen Wg Tait; Krisztina Takacs-Vellai; Yoshinori Takahashi; Szabolcs Takáts; Genzou Takemura; Nagio Takigawa; Nicholas J Talbot; Elena Tamagno; Jerome Tamburini; Cai-Ping Tan; Lan Tan; Mei Lan Tan; Ming Tan; Yee-Joo Tan; Keiji Tanaka; Masaki Tanaka; Daolin Tang; Dingzhong Tang; Guomei Tang; Isei Tanida; Kunikazu Tanji; Bakhos A Tannous; Jose A Tapia; Inmaculada Tasset-Cuevas; Marc Tatar; Iman Tavassoly; Nektarios Tavernarakis; Allen Taylor; Graham S Taylor; Gregory A Taylor; J Paul Taylor; Mark J Taylor; Elena V Tchetina; Andrew R Tee; Fatima Teixeira-Clerc; Sucheta Telang; Tewin Tencomnao; Ba-Bie Teng; Ru-Jeng Teng; Faraj Terro; Gianluca Tettamanti; Arianne L Theiss; Anne E Theron; Kelly Jean Thomas; Marcos P Thomé; Paul G Thomes; Andrew Thorburn; Jeremy Thorner; Thomas Thum; Michael Thumm; Teresa Lm Thurston; Ling Tian; Andreas Till; Jenny Pan-Yun Ting; Vladimir I Titorenko; Lilach Toker; Stefano Toldo; Sharon A Tooze; Ivan Topisirovic; Maria Lyngaas Torgersen; Liliana Torosantucci; Alicia Torriglia; Maria Rosaria Torrisi; Cathy Tournier; Roberto Towns; Vladimir Trajkovic; Leonardo H Travassos; Gemma Triola; Durga Nand Tripathi; Daniela Trisciuoglio; Rodrigo Troncoso; Ioannis P Trougakos; Anita C Truttmann; Kuen-Jer Tsai; Mario P Tschan; Yi-Hsin Tseng; Takayuki Tsukuba; Allan Tsung; Andrey S Tsvetkov; Shuiping Tu; Hsing-Yu Tuan; Marco Tucci; David A Tumbarello; Boris Turk; Vito Turk; Robin Fb Turner; Anders A Tveita; Suresh C Tyagi; Makoto Ubukata; Yasuo Uchiyama; Andrej Udelnow; Takashi Ueno; Midori Umekawa; Rika Umemiya-Shirafuji; Benjamin R Underwood; Christian Ungermann; Rodrigo P Ureshino; Ryo Ushioda; Vladimir N Uversky; Néstor L Uzcátegui; Thomas Vaccari; Maria I Vaccaro; Libuše Váchová; Helin Vakifahmetoglu-Norberg; Rut Valdor; Enza Maria Valente; Francois Vallette; Angela M Valverde; Greet Van den Berghe; Ludo Van Den Bosch; Gijs R van den Brink; F Gisou van der Goot; Ida J van der Klei; Luc Jw van der Laan; Wouter G van Doorn; Marjolein van Egmond; Kenneth L van Golen; Luc Van Kaer; Menno van Lookeren Campagne; Peter Vandenabeele; Wim Vandenberghe; Ilse Vanhorebeek; Isabel Varela-Nieto; M Helena Vasconcelos; Radovan Vasko; Demetrios G Vavvas; Ignacio Vega-Naredo; Guillermo Velasco; Athanassios D Velentzas; Panagiotis D Velentzas; Tibor Vellai; Edo Vellenga; Mikkel Holm Vendelbo; Kartik Venkatachalam; Natascia Ventura; Salvador Ventura; Patrícia St Veras; Mireille Verdier; Beata G Vertessy; Andrea Viale; Michel Vidal; Helena L A Vieira; Richard D Vierstra; Nadarajah Vigneswaran; Neeraj Vij; Miquel Vila; Margarita Villar; Victor H Villar; Joan Villarroya; Cécile Vindis; Giampietro Viola; Maria Teresa Viscomi; Giovanni Vitale; Dan T Vogl; Olga V Voitsekhovskaja; Clarissa von Haefen; Karin von Schwarzenberg; Daniel E Voth; Valérie Vouret-Craviari; Kristina Vuori; Jatin M Vyas; Christian Waeber; Cheryl Lyn Walker; Mark J Walker; Jochen Walter; Lei Wan; Xiangbo Wan; Bo Wang; Caihong Wang; Chao-Yung Wang; Chengshu Wang; Chenran Wang; Chuangui Wang; Dong Wang; Fen Wang; Fuxin Wang; Guanghui Wang; Hai-Jie Wang; Haichao Wang; Hong-Gang Wang; Hongmin Wang; Horng-Dar Wang; Jing Wang; Junjun Wang; Mei Wang; Mei-Qing Wang; Pei-Yu Wang; Peng Wang; Richard C Wang; Shuo Wang; Ting-Fang Wang; Xian Wang; Xiao-Jia Wang; Xiao-Wei Wang; Xin Wang; Xuejun Wang; Yan Wang; Yanming Wang; Ying Wang; Ying-Jan Wang; Yipeng Wang; Yu Wang; Yu Tian Wang; Yuqing Wang; Zhi-Nong Wang; Pablo Wappner; Carl Ward; Diane McVey Ward; Gary Warnes; Hirotaka Watada; Yoshihisa Watanabe; Kei Watase; Timothy E Weaver; Colin D Weekes; Jiwu Wei; Thomas Weide; Conrad C Weihl; Günther Weindl; Simone Nardin Weis; Longping Wen; Xin Wen; Yunfei Wen; Benedikt Westermann; Cornelia M Weyand; Anthony R White; Eileen White; J Lindsay Whitton; Alexander J Whitworth; Joëlle Wiels; Franziska Wild; Manon E Wildenberg; Tom Wileman; Deepti Srinivas Wilkinson; Simon Wilkinson; Dieter Willbold; Chris Williams; Katherine Williams; Peter R Williamson; Konstanze F Winklhofer; Steven S Witkin; Stephanie E Wohlgemuth; Thomas Wollert; Ernst J Wolvetang; Esther Wong; G William Wong; Richard W Wong; Vincent Kam Wai Wong; Elizabeth A Woodcock; Karen L Wright; Chunlai Wu; Defeng Wu; Gen Sheng Wu; Jian Wu; Junfang Wu; Mian Wu; Min Wu; Shengzhou Wu; William Kk Wu; Yaohua Wu; Zhenlong Wu; Cristina Pr Xavier; Ramnik J Xavier; Gui-Xian Xia; Tian Xia; Weiliang Xia; Yong Xia; Hengyi Xiao; Jian Xiao; Shi Xiao; Wuhan Xiao; Chuan-Ming Xie; Zhiping Xie; Zhonglin Xie; Maria Xilouri; Yuyan Xiong; Chuanshan Xu; Congfeng Xu; Feng Xu; Haoxing Xu; Hongwei Xu; Jian Xu; Jianzhen Xu; Jinxian Xu; Liang Xu; Xiaolei Xu; Yangqing Xu; Ye Xu; Zhi-Xiang Xu; Ziheng Xu; Yu Xue; Takahiro Yamada; Ai Yamamoto; Koji Yamanaka; Shunhei Yamashina; Shigeko Yamashiro; Bing Yan; Bo Yan; Xianghua Yan; Zhen Yan; Yasuo Yanagi; Dun-Sheng Yang; Jin-Ming Yang; Liu Yang; Minghua Yang; Pei-Ming Yang; Peixin Yang; Qian Yang; Wannian Yang; Wei Yuan Yang; Xuesong Yang; Yi Yang; Ying Yang; Zhifen Yang; Zhihong Yang; Meng-Chao Yao; Pamela J Yao; Xiaofeng Yao; Zhenyu Yao; Zhiyuan Yao; Linda S Yasui; Mingxiang Ye; Barry Yedvobnick; Behzad Yeganeh; Elizabeth S Yeh; Patricia L Yeyati; Fan Yi; Long Yi; Xiao-Ming Yin; Calvin K Yip; Yeong-Min Yoo; Young Hyun Yoo; Seung-Yong Yoon; Ken-Ichi Yoshida; Tamotsu Yoshimori; Ken H Young; Huixin Yu; Jane J Yu; Jin-Tai Yu; Jun Yu; Li Yu; W Haung Yu; Xiao-Fang Yu; Zhengping Yu; Junying Yuan; Zhi-Min Yuan; Beatrice Yjt Yue; Jianbo Yue; Zhenyu Yue; David N Zacks; Eldad Zacksenhaus; Nadia Zaffaroni; Tania Zaglia; Zahra Zakeri; Vincent Zecchini; Jinsheng Zeng; Min Zeng; Qi Zeng; Antonis S Zervos; Donna D Zhang; Fan Zhang; Guo Zhang; Guo-Chang Zhang; Hao Zhang; Hong Zhang; Hong Zhang; Hongbing Zhang; Jian Zhang; Jian Zhang; Jiangwei Zhang; Jianhua Zhang; Jing-Pu Zhang; Li Zhang; Lin Zhang; Lin Zhang; Long Zhang; Ming-Yong Zhang; Xiangnan Zhang; Xu Dong Zhang; Yan Zhang; Yang Zhang; Yanjin Zhang; Yingmei Zhang; Yunjiao Zhang; Mei Zhao; Wei-Li Zhao; Xiaonan Zhao; Yan G Zhao; Ying Zhao; Yongchao Zhao; Yu-Xia Zhao; Zhendong Zhao; Zhizhuang J Zhao; Dexian Zheng; Xi-Long Zheng; Xiaoxiang Zheng; Boris Zhivotovsky; Qing Zhong; Guang-Zhou Zhou; Guofei Zhou; Huiping Zhou; Shu-Feng Zhou; Xu-Jie Zhou; Hongxin Zhu; Hua Zhu; Wei-Guo Zhu; Wenhua Zhu; Xiao-Feng Zhu; Yuhua Zhu; Shi-Mei Zhuang; Xiaohong Zhuang; Elio Ziparo; Christos E Zois; Teresa Zoladek; Wei-Xing Zong; Antonio Zorzano; Susu M Zughaier Journal: Autophagy Date: 2016 Impact factor: 16.016