| Literature DB >> 26078709 |
Xue-hui Zhang1, Hong-liang Yu2, Fu-jing Wang3, Yong-long Han4, Wei-liang Yang3.
Abstract
Tumor cells have higher rates of glucose uptake and aerobic glycolysis to meet energy demands for proliferation and metastasis. The characteristics of increased glucose uptake, accompanied with aerobic glycolysis, has been exploited for the diagnosis of cancers. Although much progress has been made, the mechanisms regulating tumor aerobic glycolysis and energy production are still not fully understood. Here, we demonstrate that Pim-2 is required for glycolysis and energy production in colorectal tumor cells. Our results show that Pim-2 is highly expressed in colorectal tumor cells, and may be induced by nutrient stimulation. Activation of Pim-2 in colorectal cells led to increase glucose utilization and aerobic glycolysis, as well as energy production. While knockdown of Pim-2 decreased energy production in colorectal tumor cells and increased their susceptibility to apoptosis. Moreover, the effects of Pim-2 kinase on aerobic glycolysis seem to be partly dependent on mTORC1 signaling, because inhibition of mTORC1 activity reversed the aerobic glycolysis mediated by Pim-2. Our findings suggest that Pim-2-mediated aerobic glycolysis is critical for monitoring Warburg effect in colorectal tumor cells, highlighting Pim-2 as a potential metabolic target for colorectal tumor therapy.Entities:
Keywords: Aerobic glycolysis; Apoptosis; Pim-2; Warburg effect
Mesh:
Substances:
Year: 2015 PMID: 26078709 PMCID: PMC4466513 DOI: 10.7150/ijms.10982
Source DB: PubMed Journal: Int J Med Sci ISSN: 1449-1907 Impact factor: 3.738
Primer sequences of target genes in this study.
| Name | Primer sequence (5′→3′) |
|---|---|
| Pim-2-F | ACTCCAGGTGGCCATCAAAG |
| Pim-2-R | TCCATAGCAGTGCGACTTCG |
| Actin-F | GAGACCTTCAACACCCCAGC |
| Actin-R | ATGTCACGCACGATTTCCC |