| Literature DB >> 26028216 |
Wei Dang1, Wen Zhang1, Wei-Guo Du2.
Abstract
Identifying how developmental temperature affects the immune system is critical for understanding how ectothermic animals defend against pathogens and their fitness in the changing world. However, reptiles have received little attention regarding this issue. We incubated eggs at three ecologically relevant temperatures to determine how incubation temperature affects the immune function of hatchling soft-shelled turtles, Pelodiscus sinensis. When exposed to bacterial infections, hatchlings from 24 °C had lower cumulative mortalities (55%, therefore, higher immunocompetence) than those from 28 °C (85%) or 32 °C (100%). Consistent with higher immunocompetence, hatchlings from low incubation temperature had higher IgM, IgD, and CD3γ expressions than their counterparts from the other two higher incubation temperatures. Conversely, the activity of immunity-related enzymes did not match the among-temperature difference in immune function. Specifically, enzyme activity was higher at intermediate temperatures (alkaline phosphatase) or was not affected by incubation temperature (acid phosphatase, lysozyme). Our study is the first to provide unequivocal evidence (at the molecular and organismal level) about the significant effect of incubation temperature on offspring immunity in reptiles. Our results also indicate that the reduced immunity induced by high developmental temperatures might increase the vulnerability of reptiles to the outbreak of diseases under global warming scenarios.Entities:
Mesh:
Substances:
Year: 2015 PMID: 26028216 PMCID: PMC4450580 DOI: 10.1038/srep10594
Source DB: PubMed Journal: Sci Rep ISSN: 2045-2322 Impact factor: 4.379
Figure 1Effects of incubation temperature on the mortality of hatchling turtles () exposed to bacterial infection. (a) Hatchling mortality at different concentrations of bacteria, (b) temporal variation in hatchling mortality at a bacterial concentration of 5 × 106 CFU. Hatchlings from eggs incubated at low temperatures had lower mortality than those incubated at high temperatures.
Figure 2The activity of immunity-related enzymes in hatchling turtles () from eggs incubated at different temperatures. Graphs show the mean values ± 1 SE. Means with different letters above the error bars are statistically different (Tukey’s test).
Figure 3The expression of immune genes in hatchling turtles () from eggs incubated at different temperatures. Most immune genes of hatchlings from low temperatures were upregulated, compared with those from high temperatures. Graphs show mean values ± 1 SE. Means with different letters above the error bars are statistically different (Tukey’s test).
Primers used in Qrt-PCR.
| IgD | FJ605149 | F: 5′ - TGGGAACAAGGCACCAGATTT -3′ |
| R: 5′ - TTCGCAGACAAGAGTCAAGGA -3′ | ||
| IgM | FJ605150 | F: 5′ - GCTTATCCCACCGACCTTTG -3′ |
| R: 5′ - TCATCTCCTCGCTCCCACTC -3′ | ||
| CD3γ | GU168571 | F: 5′ - ATGAGGAGGGCGAGCACC - 3′ |
| R: 5′ - GCAAACGCATTACAAGGAGGA - 3′ | ||
| CD9 | FJ975143 | F: 5′ - TATCCTCTGCGTCCCGTCC - 3′ |
| R: 5′ - CAAACCGAAGCCATAGTCCAA - 3′ | ||
| β-actin | EU727174 | F: 5′ - TGTTACCCATACTGTGCCCATC - 3′ |
| R: 5′ - TAGCCATCTCCTGTTCAAAATCC -3′ |