Literature DB >> 26020698

A Comparison of In-House Real-Time LAMP Assays with a Commercial Assay for the Detection of Pathogenic Bacteria.

Deguo Wang1, Yongzhen Wang2, Fugang Xiao3, Weiyun Guo4, Yongqing Zhang5, Aiping Wang6, Yanhong Liu7.   

Abstract

Molecular detection of bacterial pathogens based on LAMP methods is a faster and simpler approach than conventional culture methods. Although different LAMP-based methods for pathogenic bacterial detection are available, a systematic comparison of these different LAMP assays has not been performed. In this paper, we compared 12 in-house real-time LAMP assays with a commercialized kit (Isothermal Master Mix) for the detection of Listeria monocytogenes, Salmonella spp, Staphylococcus aureus, Escherichia coli O157, E. coli O26, E. coli O45, E. coli O103, E. coli O111, E. coli O121, E. coli O145 and Streptococcus agalactiae. False-positive results were observed in all 12 in-house real-time LAMP assays, while all the negative controls of Isothermal Master Mix remained negative after amplification. The detection limit of Isothermal Master Mix for Listeria monocytogenes, Salmonella spp, Staphylococcus aureus, Escherichia coli O157, E. coli O26, E. coli O45, E. coli O103, E. coli O111, E. coli O121 and Streptococcus agalactiae was 1 pg, whereas the sensitivity of the commercialized kit for E. coli O145 was 100 pg. In conclusion, the 12 in-house real-time LAMP assays were impractical to use, while the commercialized kit Isothermal Master Mix was useful for the detection of most bacterial pathogens.

Entities:  

Keywords:  pathogenic bacteria; real-time loop-mediated isothermal amplification (LAMP); sensitivity; specificity

Mesh:

Substances:

Year:  2015        PMID: 26020698      PMCID: PMC6272383          DOI: 10.3390/molecules20069487

Source DB:  PubMed          Journal:  Molecules        ISSN: 1420-3049            Impact factor:   4.411


1. Introduction

Loop-mediated isothermal amplification (LAMP), developed by Notomi et al. in 2000 [1], can specifically, sensitively and rapidly amplify nucleic acids utilizing a DNA polymerase enzyme with high strand displacement activity and two pairs of primers recognizing six independent sequences of a target gene under isothermal conditions. Moreover, Nagamine et al. in 2002 has advanced the method by incorporating forward loop primers that accelerate the LAMP reaction [2]. Due to the cost effectiveness and sensitivity of LAMP, this method has been widely applied to basic medical research in and environmental testing, as well as point-of-care testing and diagnosis of infectious diseases in clinical settings [3]. In addition, LAMP has also been applied for pathogen detection, and has successfully been used to detect Listeria monocytogenes [4], Salmonella, spp [5], Staphylococcus aureus [6], Escherichia coli O157 [7,8], E. coli O26 [7], E. coli O45 [7], E. coli O103 [7], E. coli O111 [7], E. coli O121 [7], Streptococcus agalactiae [9], Actinobacillus actinomycetemcomitans [10], Mycobacterium tuberculosis [11], and Streptococcus pneumonia [12]. However, a systematic evaluation of these different LAMP assays has not been performed. The objective of the present study was to compare 12 in-house real-time LAMP assays for the detection of Listeria monocytogenes, Salmonella, Staphylococcus aureus, Escherichia coli O157, E. coli O26, E. coli O45, E. coli O103, E. coli O111, E. coli O121, E. coli O145 and Streptococcus agalactiae performed using previously described protocols [4,5,6,7,8,9] with a commercial kit (Isothermal Master Mix, OptiGene, Horsham, UK).

2. Results and Discussion

2.1. Non-Specific Amplification

After the negative controls without genomic DNA were kept at the described temperature for 50 min, false-positive results were observed among all 12 in-house real-time LAMP assays for detection of L. monocytogenes, Salmonella, Staphylococcus aureus, E. coli O157, E. coli O26, E. coli O45, E. coli O103, E. coli O111, E. coli O121 and Streptococcus agalactiae, while all negative controls of the commercial kit Isothermal Master Mix remained negative after amplification at 65 °C for 50 min, as indicated in Table 1. The cross pollution caused by DNA templates as well as amplified products of the LAMP reactions had been excluded, therefore, the non-specific amplification of 12 in-house real-time LAMP assays could be caused by primer dimers, in contrast, the commercial assay can be free of such non-specific amplification.
Table 1

Results of non-specific amplification determination from in-house real-time LAMP assay and the isothermal master mix kit.

Bacterial Strains (Gene)AssayNo. LAMP-Positive/No. of Total Experiments Carried Out
Listeria monocytogenes (hlyA)In-house Real-time LAMP Assay3/3
Isothermal Master Mix0/3
Salmonella spp (invA)In-house Real-time LAMP Assay2/3
Isothermal Master Mix0/3
Staphylococcus aureus (nuc)In-house Real-time LAMP Assay3/3
Isothermal Master Mix0/3
Escherichia coli O157 (rfbE)In-house Real-time LAMP Assay1/3
Isothermal Master Mix0/3
Escherichia coli O26 (wzy)In-house Real-time LAMP Assay3/3
Isothermal Master Mix0/3
Escherichia coli O45 (wzy)In-house Real-time LAMP Assay3/3
Isothermal Master Mix0/3
Escherichia coli O103 (wzx)In-house Real-time LAMP Assay1/3
Isothermal Master Mix0/3
Escherichia coli O111 (wzy)In-house Real-time LAMP Assay2/3
Isothermal Master Mix0/3
Escherichia coli O121 (wzy)In-house Real-time LAMP Assay2/3
Isothermal Master Mix0/3
Escherichia coli O145 (wzx)In-house Real-time LAMP Assay3/3
Isothermal Master Mix0/3
Escherichia coli O157 (wzy)In-house Real-time LAMP Assay3/3
Isothermal Master Mix0/3
Streptococcus agalactiae (sobA)In-house Real-time LAMP Assay2/3
Isothermal Master Mix0/3
Results of non-specific amplification determination from in-house real-time LAMP assay and the isothermal master mix kit.

2.2. Sensitivity of the Commercial Assay

Because of the serious non-specific amplification, determining the detection limits of the 12 in-house real-time LAMP assays was of no practical significance, and only the sensitivity of the commercial Isothermal Master Mix kit for pathogenic bacteria detection was determined. As Table 2 indicates, the detection limit of Isothermal Master Mix for Listeria monocytogenes, Salmonella spp, Staphylococcus aureus, Escherichia coli O157, E. coli O26, E. coli O45, E. coli O103, E. coli O111, E. coli O121 and Streptococcus agalactiae was 1 pg. However, all reactions with serial dilutions of E. coli O145 DNA template ranging from 0.1–100 pg were negative, and then we repeated the experiment, one of four reactions with 100 pg E. coli O145 DNA template was positive (data not shown), therefore, the LAMP assay with the commercial kit Isothermal Master may not suitable for detection of some pathogenic bacteria because of the low sensitivity.
Table 2

Sensitivity of real-time LAMP assays with the Isothermal Master Mix Kit.

Bacterial Strains (Gene) a10 pg DNA Template1 pg DNA Template0.1 pg DNA TemplateNegative Controls
Listeria monocytogenes ATCC19115 (hlyA) 4/44/40/40/4
Salmonella enterica serotype Newport (invA)4/44/40/40/4
Staphylococcus aureus ATCC 25923 (nuc)4/44/40/40/4
Escherichia coli O157:H7 933 (rfbE)4/44/40/40/4
Escherichia coli O26:H11 (wzy)4/4 3/41/40/4
Escherichia coli O45:H12 (wzy)4/42/40/40/4
Escherichia coli O103:H2 (wzx)4/44/40/40/4
Escherichia coli O111:H8 (wzy)4/44/40/40/4
Escherichia coli O121:H19 (wzy)4/42/40/40/4
Escherichia coli O145:H2 (wzx)1/80/80/80/8
Escherichia coli O157:H7 933 (wzy)4/44/40/40/4
Streptococcus agalactiae ATCC 27956 (sobA)4/44/40/40/4

a All these strains were obtained from the Food and Bioengineering College of Xuchang University, Henan, China.

Sensitivity of real-time LAMP assays with the Isothermal Master Mix Kit. a All these strains were obtained from the Food and Bioengineering College of Xuchang University, Henan, China.

3. Experimental Section

3.1. LAMP Primers

The described LAMP primers targeting specific genes of the hlyA of Listeria monocytogenes, invA of Salmonella, nuc of Staphylococcus aureus, rfbE of Escherichia coli O157, wzy of E. coli O26, wzy of E. coli O45, wzx of E. coli O103, wzy of E. coli O111, wzy of E. coli O121, wzx of E. coli O145, wzy of rfbE of E. coli O157 and sobA of Streptococcus agalactiae used in this study are shown in Table 3 [4,5,6,7,8,9].
Table 3

Primers of the 12 in-house real-time LAMP assays for bacterial pathogen detection.

Bacterial StrainsGenePrimerSequence (5'-3')References
Listeria monocytogenes hlyALBGCCAAGAAAAGGTTACAAAGATGG[4]
LFTAGGACTTGCAGGCGGAGATG
B3GCTTTTACGAGAGCACCTGG
F3TTGCGCAACAAACTGAAGC
BIPCCACGGAGATGCAGTGACAAATGTTTTGGATTTCTTCTTTTTCTCCACAAC
FIPCGTGTTTCTTTTCGATTGGCGTCTTTTTTTCATCCATGGCACCACC
Salmonella spp invALBGGGCAATTCGTTATTGGCGATAG[5]
LFGACGAAAGAGCGTGGTAATTAAC
B3AACGATAAACTGGACCACGG
F3GGCGATATTGGTGTTTATGGGG
BIPCCGGTGAAATTATCGCCACACAAAACCCACCGCCAGG
FIPGACGACTGGTACTGATCGATAGTTTTTCAACGTTTCCTGCGG
Staphylococcus aureus nuc LBCAAACCTAACAATACACATGAACA[6]
LFACGCTAAGCCACGTCCATAT
B3CGTTGTCTTCGCTCCAAAT
F3TGCAAAGAAAATTGAAGTCGA
BIPTCAAGGCTTGGCTAAAGTTGCTTATTCGCTTGTGCTTCACTT
FIPCGTTTACCATTTTTCCATCAGCATATTTGACAAAGGTCAAAGAACT
Escherichia coli O157rfbEB3GGTGCTTTTGATATTTTTCCG[7]
F3AACAGTCTTGTACAAGTCCA
BIPCTCTCTTTCCTCTGCGGTCC-GATGTTTTTCACACTTATTGGAT
FIPTAAGGAATCACCTTGCAGATAAACT-AGTACATTGGCATCGTGT
Escherichia coli O26 wzy LBTACAATACAGTAAGTATACAGCATT[8]
LFACCAGCGATAACCAATCTC
B3TCCTGATTTGAACAATGTCAAT
F3GACTATGAAGCGTATGTTGAT
BIPTTCCTTGGGACCACATTCCT-ACATGTAAAGCAGCAAACC
FIPACCGCCTAAATACTTAACACCATAA-TTAATGTCAATGAACTTTATGCC
Escherichia coli O45 wzy LBTTATTACTCCTGGCAGTATTAATCG[8]
B3TTTAGTCGCTCGCCAAGA
F3AATGTCCCCAGGGTTTGT
BIPAGCGGGCTAATATTAGTAGTCACTC-GTATGCTTCAATTTGGCTGT
FIPACTCTGGGTTTGATTTTTTCACTTC-ATAATTTCATCCAGACGAACG
Escherichia coli O103 wzx LBCCTTTATAAATGGATTCATTTCATC[8]
LFAATTGCAACAACTTTTGAAATAA
B3TCACCTTGATTTTCTGCTGA
F3ACTCAGTGGTGTAGTAACATG
BIPTTGGGACAATTGCAAAATTTTGTGG-ATCTATTAACTCCTTGTGAAACTTG
FIPATTTGCTATTCCAATTGGACCAGTA-CTTTAGACTAATTTGTGGCCTTC
Escherichia coli O111 wzy LBCTTAAATAACGGCGGACAAT[8]
B3TCATGAGGGTCATTAGGAATT
F3AAGGCGTAACTTTTTTTGAAC
BIPTCCATGGTATGGGGACATTAAATTT-TGATGGAAGTCCATATAACGT
FIPTCACCAAGCTGTGAAACCAAA-CTACAGCAAGTAATATTGAACGT
Escherichia coli O121 wzy LFTAAAGCCATCCAACCACGC[8]
B3ATAGGCTCCCAACCATCC
F3GCTCAGCTTTTATCTTGTTCAA
BIPTGTTGCTGGTTCCTTATTATGTAGT-AAAAGCAAGCCAAAACACTC
FIPACGCAAAAAGTATGGATTCATACCT-GATATAACAGAACCGACTTGG
Escherichia coli O145 wzx LFTTCTTAAGTTCGGATACACTAGCA[8]
B3GCATTGGTACAGACAGCTTTA
F3TTTGTAAGACAAGGTGTATGG
BIPAGTGTGCTTGGAGTGGCTTA-CAATCCCAGTTTGTAATATCGC
FIPCACAGTACCACCAAACCAAAAAATA-TTGGTTAGCTATAGCTGTGA
Escherichia coli O157 wzy LBTCCTTTTCTCTCCGTATTGAT[8]
LFATAATGATATATGAATAGAATGCGC
B3ATAACTGATATTTTCATTTCGTGAT
F3TCCCTTTAGGGATATATATACCTT
BIPTTCCCAGCCACTAAGTATTGCAATATTTTTGAAAAAAACCCATAGCTCGA
FIPTGCATCGGCCTTCTTTTTTGGTTTTAACGTATCATGCAATAAGATCA
Streptococcus agalactiae sobALBAGGCGCTCTTAGCTGATGT[9]
LFTGCATGGTGCTTATCATGATGT
B3ACCACCGTTATTGATGACTG
F3ATATGATGCGCTTGAGCC
BIPACATCCTGAAATTGGAGAAGACTTTTTTCCTGACGAATATCTTCTGGAAT
FIPGAGCAGCATTTGCATTAGCAACATATTTTGATGCTGAGACAATGACAC
Primers of the 12 in-house real-time LAMP assays for bacterial pathogen detection.

3.2. Determination of Non-Specific Amplification

After the LAMP primers were synthesized by Sangon Biotech Co., Ltd (Shanghai, China), the non-specific amplification of the 12 in-house real-time LAMP assays as well as the commercial Isothermal Master Mix kit were determined via the corresponding negative controls with no genomic DNA. The experiment was performed before DNA extraction, therefore, cross pollution caused by DNA template as well as amplified products of LAMP reactions can be avoided, and the cause of false-positive results can be objectively judged. The reaction mixtures and reaction conditions of the 12 in-house real-time LAMP assays were as described [4,5,6,7,8,9]. The 25 µL in house reaction system contained 1.6 µmol/L of each of the inner primers FIP and BIP, 0.2 µmol/L of each of the outer primers F3 and B3, and 0.8 µmol/L of each of the loop primers LF and LB. 1.2 mmol/L each dNTP, 6 mmol/L MgSO4, 1 × Bst DNA polymerase buffer (New England Biolabs, Beverly, MA, USA) (20 mmol/L Tris-HCl (pH = 8.8), 10 mmol/L KCl, 10 mmol/L (NH4)2SO4, 2 mmol/L MgSO4, 0.1% TritonX-100), 8 Units of Bst DNA large fragments (New England Biolabs). Depending on different experiments, 0 M, 0.6 M or 1.0 M of betaine (Sigma, St. Louis, MO, USA) were included, respectively. The LAMP assays were modified by adding 1 × EvaGreen and 1 × Rox, the experiment only on negative controls was carried out on StepOne™ System (Applied Biosystems, Foster City, CA, USA) at the described temperature (65 °C for the invA of Salmonella, rfbE of Escherichia coli O157, wzy of Escherichia coli O26, wzy of Escherichia coli O45, wzx of Escherichia coli O103, wzy of Escherichia coli O111, wzy of Escherichia coli O121, wzx of Escherichia coli O145, wzy of Escherichia coli O157; 64 °C for nuc of Staphylococcus aureus; 63 °C for sobA of Streptococcus agalactiae) for 50 min, and each experiment was repeated three times. The Real-time LAMP with Isothermal Master Mix was also carried out on StepOne™ System (Applied Biosystems), using 0.1 µM F3 and B3, 0.8 µM FIP and BIP, 0.4 µM LF, and LB, with 1 × Isothermal MasterMix containing a fluorescent intercalating dye [13]. The reactions of negative controls were held at 65 °C for 50 min with real-time fluorescence monitoring, and each experiment was repeated three times.

3.3. Bacteria Strains and DNA Extraction

Tweleve strains used for this study (Table 2) were obtained from the Food and Bioengineering College of Xuchang University. Listeria monocytogenes ATCC19115 was cultured overnight at 37 °C in Difco™ Buffered Listeria Enrichment Broth Base (Becton, Dickinson and Company, San Jose, CA, USA) while the others in Luria-Bertani (LB) broth. Genomic DNA from these bacterial cultures was extracted using DNeasy® Blood & Tissue Kit (Qiagen Inc., Valencia, CA, USA) according to the manufacturer’s instructions. The genomic DNA was used to determine the detection limits of 12 in-house real-time LAMP assays as well as the commercial kit Isothermal Master Mix.

3.4. Detection Limit Comparison

The above described reaction mixtures of 12 in-house real-time LAMP assays were combined with serial dilutions of L. monocytogenes, Salmonella, Staphylococcus aureus, E. coli O157, E. coli O26, E. coli O45, E. coli O103, E. coli O111, E. coli O121 and Streptococcus agalactiae DNA template ranging from 0.1–100 pg, respectively, the reactions were carried out on StepOne™ System (Applied Biosystems) at described temperature for 50 min, and each experiment was repeated four times, and the detection limits of 12 in-house real-time LAMP assays were determined. For comparison, the detection limits of the commercial kit Isothermal Master Mix were determined by carrying out reactions according to the manufacturers’ instructions using a set of serially diluted DNA template of L. monocytogenes, Salmonella, Staphylococcus aureus, E. coli O157, E. coli O26, E. coli O45, E. coli O103, E. coli O111, E. coli O121 and Streptococcus agalactiae DNA template ranging from 0.1–100 pg, respectively, and each reaction was repeated four times.

4. Conclusions

Twelve reported in-house LAMP assays for the detection of pathogenic bacteria [4,5,6,7,8,9] have been compared with the commercialized Isothermal Master Mix kit in this study. False-positive results have been observed among all 12 in-house real-time LAMP assays, and it can be concluded from our experiments that the non-specific amplification is caused by primer dimers. It is difficult to avoid primer dimers and non-specific amplification when multiple sets of primers are used in the in-house LAMP assays. This is especially true when the concentrations of primers, Mg2+, dNTPs and DNA polymerase in reaction mixtures are as high as those used in real-time PCR [14]. The concentrations of these four factors must be strictly controlled to avoid non-specific amplification in real-time PCR as well as LAMP reactions [15]. False-positive results have not been found in real-time LAMP assays with the commercialized Isothermal Master Mix kit. It is speculated that the Isothermal Master Mix kit may contain some enhancing agents, which can decrease the non-specific amplification. The detection limits for most tested pathogenic bacteria are 1 pg DNA template, and the sensitivity of the commercial assay for E. coli O145 is 100 pg DNA template. In summary, the 12 in-house real-time LAMP assays were impractical for detection of the corresponding pathogenic bacteria, while the commercial Isothermal Master Mix kit was useful for detection of the most pathogenic bacteria.
  4 in total

1.  The Development of Lyophilized Loop-mediated Isothermal Amplification Reagents for the Detection of Coxiella burnetii.

Authors:  Hua-Wei Chen; Wei-Mei Ching
Journal:  J Vis Exp       Date:  2016-04-18       Impact factor: 1.355

Review 2.  Cyprinid viral diseases and vaccine development.

Authors:  Hang Su; Jianguo Su
Journal:  Fish Shellfish Immunol       Date:  2018-09-07       Impact factor: 4.581

3.  Development of Fluorescence In Situ Hybridization as a Rapid, Accurate Method for Detecting Coliforms in Water Samples.

Authors:  Jong-Tar Kuo; Li-Li Chang; Chia-Yuan Yen; Teh-Hua Tsai; Yu-Chi Chang; Yu-Tang Huang; Ying-Chien Chung
Journal:  Biosensors (Basel)       Date:  2020-12-24

Review 4.  Loop-Mediated Isothermal Amplification for Salmonella Detection in Food and Feed: Current Applications and Future Directions.

Authors:  Qianru Yang; Kelly J Domesle; Beilei Ge
Journal:  Foodborne Pathog Dis       Date:  2018-06       Impact factor: 3.171

  4 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.