| Literature DB >> 26019528 |
Dechang Hu1, Ping Zhang1, Yan-Lin Sun1, Shumin Zhang1, Zhaohong Wang2, Chuanjie Chen2.
Abstract
Ten universal primer pairs of the plant chloroplast genome were used to amplify the chloroplast DNA (cpDNA) non-coding regions in eight mulberry (Morus spp.) genotypes, including M. mongolica, M. bombycis, M. alba, M. atropurpurea and M. multicaulis. Subsequently, the polymerase chain reaction (PCR) products were digested by seven restriction enzymes and the trnD-trnT fragment for sequence alignment, and the variations were expected to provide the genetic information for system classification. The results from this study showed that: (1) 10 cpDNA primer pairs could be used for successful amplification in the tested materials, with approximately 17.1 kb of the chloroplast genome analysed. The 152 marker loci were detected by 70 primer/restriction endonuclease combinations, among which the trnD-trnT non-coding region digested by AluI, HinfI, MvaI and RsaI was detected by visible fragment length variation in different genotypes of the genus Morus. (2) eight Morus L. genotypes were divided into two groups based on the digesting pattern discrepancy through cpDNA. The M. multicaulis genotypes displayed diversity on an intraspecies level. 'Nongsang No.12' was identical with the female parent 'Beiqu No.1' (M. atropurpurea) in the surveyed sequence, but different from the male parent 'Tongxiangqing' (M. multicaulis), suggesting that the cpDNA was maternal inheritance in Morus L. (3) There were two deletion fragments (451-456 bp; 840-863bp) and six base point mutations in the trnD-trnT region based on homologous sequence alignment. The sequence of trnD-trnT in the cpDNA of mulberry could provide more genetic information for phylogenetic analysis and pedigree identification.Entities:
Keywords: Morus L.; PCR-RFLP; cpDNA; genetic analysis; trnD-trnT sequence
Year: 2014 PMID: 26019528 PMCID: PMC4433829 DOI: 10.1080/13102818.2014.928980
Source DB: PubMed Journal: Biotechnol Biotechnol Equip ISSN: 1310-2818 Impact factor: 1.632
Materials used in this study.
| No. | Genotype | Species | Ploidy | Source | Accession numbers |
|---|---|---|---|---|---|
| (1) | Menggusang | 2 | Shandong, China | KF886262 | |
| (2) | Shansang | 2 | Shandong, China | KF886263 | |
| (3) | Beiqu No.1 | 2 | Guangdong, China | KF886264 | |
| (4) | Nongsang No.12 | 2 | Jiangsu, China | KF886265 | |
| (5) | Tongxiangqing | 2 | Zhejiang,China | KF886261 | |
| (6) | Husang No.32 | 2 | Jiangsu, China | KF886266 | |
| (7) | Xinyizhilai | 2 | Japan | KF886267 | |
| (8) | Fu No.1 | 2 | Jiangsu, China | KF886268 |
Sequence and amplification conditions of cpDNA universal primer pairs used in this study.
| No. | Amplified region | Forward primer (5′–3′) | Reverse primer (5′−3′) | Annealing temperature (°C) | Size (bp) | Reference |
|---|---|---|---|---|---|---|
| (1) | acgggaattgaacccgcgca | ccgactagttccgggttcga | 55 | 1650 | [19] | |
| (2) | gagagagagggattcgaacc | cataaccttgaggtcacggg | 55 | 1650 | [19] | |
| (3) | tgtcaccaaaaacagagact | ttccatacttcacaagcagc | 55 | 1700 | [10] | |
| (4) | gggttgcccgggactcgaac | caacggtagagtactcggctttta | 61.5 | 2500 | [19] | |
| (5) | ccagttcaaatctgggtgtc | gggattgtagttcaattggt | 58 | 2950 | [19] | |
| (6) | accaattgaactacaatccc | ctaccactgagttaaaaggg | 55 | 1200 | [19] | |
| (7) | tgctttcatacggcgggact | gctttagtctctgtttgtgg | 58 | 2850 | [19] | |
| (8) | ctcgtgtcaccagttcaaat | ccgagaaggtctacggttcg | 58 | 2200 | [20] | |
| (9) | cgagggttcgaatccctctc | agagcatcgcatttgtaatg | 55 | 1500 | [19] | |
| (10) | ggtcgtgaccaagaaaccac | ggttcgaatccctctctctc | 55 | 1600 | [19] |
Figure 1 Restriction patterns of amplified and digested products of primer–enzyme combination trnD-trnT/HinfI (A) and trnD-trnT /RsaI (B) of chloroplast DNA from eight Morus L. genotypes resolved in a 2% agarose gel. Numbers were listed in Table 1. M indicates DL2000 DNA Ladder Marker.
Figure 2 Phylogenetic tree of eight mulberry genotypes and related species M. indian based on the mutation sites in cpDNA trnD-trnT regions, using neighbour-joining method (MAGE).