Literature DB >> 26001932

Gene expression changes in Porphyromonas gingivalis W83 after inoculation in rat oral cavity.

Jian Zhao1, Qian Li2, Chun-Ling Pan3, Jun-Chao Liu4, Hong-Yan Wang5, Li-Si Tan6, Ya-Ping Pan7.   

Abstract

BACKGROUND: The development of chronic periodontitis was due to not only periodontal pathogens, but also the interaction between periodontal pathogens and host. The aim of this study is to investigate the alterations in gene expression in Porphyromonas gingivalis (P.gingivalis) W83 after inoculation in rat oral cavity.
RESULTS: P.gingivalis W83 inoculation in rat oral cavity caused inflammatory responses in gingival tissues and destroyed host alveolar bone. Microarray analysis revealed that 42 genes were upregulated, and 22 genes were downregulated in the detected 1786 genes in the inoculated P.gingivalis W83. Real-time quantitative PCR detection confirmed the expression alterations in some selected genes. Products of these upregulated and downregulated genes are mainly related to transposon functions, cell transmembrane transportation, protein and nucleic acid metabolism, energy metabolism, cell division and bacterial pathogenicity.
CONCLUSIONS: P.gingivalis W83 has a pathogenic effect on host oral cavity. Meanwhile, inflammatory oral environment alters P.gingivalis W83 gene expression profile. These changes in gene expression may limit the proliferation and weaken the pathogenicity of P.gingivalis W83, and favor themselves to adapt local environment for survival.

Entities:  

Mesh:

Substances:

Year:  2015        PMID: 26001932      PMCID: PMC4493947          DOI: 10.1186/s12866-015-0438-0

Source DB:  PubMed          Journal:  BMC Microbiol        ISSN: 1471-2180            Impact factor:   3.605


Background

Periodontitis is a chronic inflammatory disorder mediated by host and bacteria interactions and manifested by damage to the periodontal tissues that may progress to tooth loss. The host inflammatory responses stimulated by periodontal pathogens intend to eliminate the invaded bacteria and attribute to the destruction of tooth supporting tissues and tooth loss [1]. Moreover, the local periodontal environment may change the gene expression profile of periodontal pathogens [2-4]. To a certain extent, the variation of bacterial gene expression may alter the pathogenic ability of bacteria. Porphyromonas gingivalis (P.gingivalis) is an opportunistic pathogen of the oral mucosa and a prominent member of the oral biofilms. It is well known that P.gingivalis is implicated in the onset and progression of chronic periodontitis. P.gingivalis can induce immune cells to secrete cytokines when they invade into hosts. These cytokines are present in inflamed gingiva and aggravate the destruction of oral gingival tissues and alveolar bone [5]. In the meantime, the expression of P.gingivalis genes varies under different conditions, such as iron or hemin [6,7], polyphosphate [8], rhein [9]. P.gingivalis may up-regulate or downregulate gene expression to adapt environment and survive [10]. The development of chronic periodontitis was not only due to periodontal pathogens, but also the interaction between periodontal pathogens and host. Most researches focus on periodontal pathogens acting on hosts, but ignore the action of host on P.gingivalis. Actually, the changes in P.gingivalis gene expression may affect the progression of chronic periodontitis. In the present study, the differential gene expression in P.gingivalis W83 inoculated in rat oral cavity and wild strain was analyzed.

Methods

Ethical statement

All rats were manipulated in accordance with Animal Research Reporting In Vivo Experiments (ARRIVE) guidelines. The experimental protocols were approved by the ethical committee of China Medical University.

Bacteria and animals

This study was carried out with 6-week-old SPF rats (180 − 220 g) provided by Department of Experimental Animals, China Medical University, and maintained in a temperature-controlled room (23 ± 1 °C). P.gingivalis W83 was obtained from the American Type Culture Collection (ATCC) and grown anaerobically (10 % CO2, 10 % H2, 80 % N2) in enriched brain-heart infusion (BHI) broth containing 5 % fiber-free sheep blood, 1 % vitamin K and hemin, at 37 °C.

P.gingivalis W83 inoculation

12 Rats were given azithromycin (10 mg/500 ml) ad libitum for 4 days to reduce the original oral flora. This was followed by a 7-day antibiotic-free period. 6 Rats were then orally challenged with P. gingivalis W83 (1 × 109 CFU) by gavage into the esophagus and oral cavity five times every other day [11]. The other 6 rats (control group) were only challenged with BHI broth. All 12 rats received steel wire ligature in cervical part in two sides of first molars and an 8-week high sugar feeding.

Alveolar bone loss analysis

Horizontal bone loss was assessed morphometrically by measuring the distance between the cement − enamel junction and the alveolar bone crest of the first, the second and the third molar. The alveolar bone destruction was detected by morphological and macroscopic observation, radiographic (PLANMECA, Finland) and stereomicroscope (SZX12, Olympus, Japan) fitted with a DIGIMED Viewer imaging measurement system evaluation at 6 sites per molars. Alveolar bone loss of every molar was presented in the figures as mean ± SD. Independent samples t-test was used to calculate the significance among the groups (SPSS Inc., Chicago, IL, USA). P-value < 0.05 was considered statistically significant.

Isolating culture and acquiring plaque

After P.gingivalis W83 inoculation in rat oral cavity for 8 weeks, plaques were acquired from periodontal pockets of first molar using toothpicks and put into 0.5 ml transfer tube. The plaques were dispersed by oscillator. 100 μl ten-fold serial dilutions were inoculated on BHI culture medium anaerobically at 37 °C for 5–7 days. The morphology of colonies was observed in primary cultures. P.gingivalisW83 colonies were identified by their black pigmentation, gram staining and PCR. The single clone was purified in BHI medium for subcultures in order to detect the differences in the gene of P.gingivalisW83.

Microarray hybridization

3 samples were picked up from wild strain P.gingivalis W83 and inoculated P.gingivalis W83, respectively. The total RNA was extracted and labeled with Klenow, and then hybridism with P.gingivalis W83 chip. The commercial GeneChip P.gingivalis W83 Genome Array used here was provided by CapitalBio Corporation (http://www.capitalbio.com/, Beijing, China), a service provider authorized by Roche NimbleGen (Wisconsin, USA). Array hybridization, washing, scanning and data analysis were performed at the CapitalBio Corporation, Beijing, China and carried out according to the NimbleGen’s Expression user’s guide.

Real-time quantitative PCR

To independently confirm the expression data generated by the microarray experiments, we performed real-time quantitative PCR analyses for 14 genes differentially regulated. Total RNA was extracted. Quality and concentration of the RNA were determined by measuring its absorbance at 260 and 280 nm using a microplate reader (M-200, Tecan, Switzerland). Total bacterial RNA was subsequently reverse-transcribed using the M-MLV RTase cDNA Synthesis Kit (Takara, China) following the manufacturer’s protocol. Real-time quantitative PCR analysis was conducted in an ABI Prism 7500 Sequence Detection System (Applied Biosystems, Foster City, CA, USA) in combination with the SYBR® Premix Ex TaqTM II PCR Master Mix Reagents Kit (Takara), as recommended by the manufacturer of the Wall Clear PCR Strip Tubes (Axygen, USA). The primers for the real-time quantitative PCR analysis were designed using Primer3 (http://bioinfo.ut.ee/primer3/) (Table 1). P.gingivalis W83 16 s DNA was used as the internal reference. Real-time quantitative PCR was performed three times for each sample. The data were analyzed according to relative gene expression by the 2-ΔΔCt method.
Table 1

Sequences for real-time PCR

GeneSequence(5’-3’)PCR product (bp)
PG1005F: CGGTGAGGTTTACAGAAGAA79
R: AGGGAGGTGTAAGTCACG
PG1006F: GGAATGGAGCGAAAGACC169
R: CCAACAAGCAGAACCGAC
PG1007F: TCTGTTTGTTTGTCCCATTC62
R: TATGGCTCCTCAAAGTAGAG
PG1008F: TTACAACAGCGGCTACCA103
R: TATCCACTGCCACAGCCT
PG1009F: AAGCGTGCTACCATTGCG78
R: TCAGGCTATACCCGTTCT
PG1010F: TCTGTCCCTGCGATACCT99
R: CACTCATCCTCCCTATCTTTC
PG0874F: AGGGTGTCTGAGCAAGTA73
R: TGGAGGAATCGAAGATAGAA
PG1513F: GAAACGGCTCAAGTCATA114
R: TCCCTCCTCCATTTCCAC
PG0684F: GAATACGGAGGTCAATCGC90
R: GAACGCTGAGAAGGAGGC
PG0682F: CGGTGAGTTCTATTATTGCG123
R: CAGCACCAGGCATGACCA
PG1975F: CGTGACGGGCATAAGACA134
R: AGTGAGTCGTGGGTTTAC
PG1982F: GTAATACCGAGGAAACTGAA60
R: GTGTTTCAGGGATAAGTCG
PG2008F: CTGCGGTTTCAACCAAGT115
R: ATACCGAACCTCGTCTAC
PG0001F: AGGTGGTCATGTTCCTCTCC78
R: TGACTACCCTCCTGCATTGG
Sequences for real-time PCR

Statistics

Significantly differentially expressed genes between the inoculated periodontitis and wild strains were identified using two class unpaired method in the Significant Analysis of Microarray software (SAM, version 3.02). Genes were determined to be significantly differentially expressed with a selection threshold of false discovery rate, FDR < 5 % and fold change > 2.0 in the SAM output result.

Results

Pathogenic effects of P.gingivalis W83 on rat oral cavity

After P.gingivalis W83 inoculation in rat oral cavity for 8 weeks, the gingival tissues were inflammatory and bleeding (Fig. 1A). Severe alveolar bone losses were found in rats with P.gingivalis W83 inoculation (Fig. 1B). The distance between cementoenamel junction and alveolar bone crest (CEJ: ABC) was measured at proximal, middle and distal sites of buccal and palatal per molar, respectively. In first molars, second molars, third molars, the distances were significantly increased, which were 1216.00 ± 305.98 μm, 987.28 ± 238.14 μm, 725.11 ± 202.71 μm, compared with normal rats, which were 414.89 ± 209.67 μm, 300.44 ± 127.92 μm, 357.56 ± 281.06 μm.
Fig. 1

Pathogenic effects of P.gingivalis W83 on rat oral cavity. (A) The gingival tissues were inflammatory and bleeding after P.gingivalis W83 inoculation in rat oral cavity for 8 weeks. (B) Severe alveolar bone losses were found in rats with P.gingivalis W83 inoculation. Left: control groups. Right: rats inoculated with P.gingivalis W83 intraorally for 8 weeks

Pathogenic effects of P.gingivalis W83 on rat oral cavity. (A) The gingival tissues were inflammatory and bleeding after P.gingivalis W83 inoculation in rat oral cavity for 8 weeks. (B) Severe alveolar bone losses were found in rats with P.gingivalis W83 inoculation. Left: control groups. Right: rats inoculated with P.gingivalis W83 intraorally for 8 weeks

Identification of the inoculated P.gingivalis W83 in rat with periodontitis

Suspicious gram-negative bacilli were taken from plaque culture. After pure subculture, gram staining and polymerase chain reaction (PCR) proved that the bacteria were P.gingivalis W83. PCR fragment length of the product was 857 bp, as shown in Fig. 2.
Fig. 2

Isolation and identification of inoculated P.gingivalis W83. (A) Some suspicious black colonies were found from plaque mixture. (B) Suspious black colonies were pure cultured. (C) Gram staining proved the pure culture as gram-negative brevibacterium (×400). (D) Agarose gel electrophoresis proved that PCR fragment length was 857 bp. 1 and 2: Wild type P.gingivalis W83; 3–8: three inoculated P.gingivalis W83 samples for microarray analysis (two columns for each sample)

Isolation and identification of inoculated P.gingivalis W83. (A) Some suspicious black colonies were found from plaque mixture. (B) Suspious black colonies were pure cultured. (C) Gram staining proved the pure culture as gram-negative brevibacterium (×400). (D) Agarose gel electrophoresis proved that PCR fragment length was 857 bp. 1 and 2: Wild type P.gingivalis W83; 3–8: three inoculated P.gingivalis W83 samples for microarray analysis (two columns for each sample)

Genes upregulated in the inoculated P.gingivalis W83

We determined the expression of 1786 genes by microarray analysis in P.gingivalis wild strain and P.gingivalis inoculated in oral cavity. The complete list of gene expression values has been deposited in NCBI’s Gene Expression Omnibus (http://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE67608). The detection showed that 42 genes were up-regulated in the inoculated P.gingivalis W83 compared with wild strain (Table 2) (Fig. 3). In these upregulated genes, 30 expressed hypothetical proteins. Among other 12 genes, PG0874, PG0009, PG0427, PG0942 and PG0590 function as transposons. PG0009, PG0427, PG0942 and PG0590 encode ISPg5 transposases; and PG0874 encodes an int protein as a mobilizable transposon.
Table 2

Genes upregulated in the inoculated P.gingivalis W83

Locus no.Putative identificationα Cellular roleα Fold
PG0102hypothetical protein3.7076
PG2116hypothetical protein3.6850
PG1007GntR family transcriptional regulatorRegulatory functions: DNA interactions3.6786
PG0265hypothetical protein3.3714
PG1008hypothetical protein3.3338
PG1510hypothetical protein3.0890
PG1009hypothetical protein3.0258
PG1655hypothetical protein2.8935
PG0132hypothetical protein2.7298
PG2114hypothetical protein2.6986
PG2064hypothetical protein2.5952
PG1010ABC transporter, ATP-binding proteinTransport and binding proteins: Unknown substrate2.4885
PG0542hypothetical protein2.4794
PG1005putative lipoproteinCell envelope2.4686
PG1514glycerol dehydrogenase-related proteinUnknown function: General2.4537
PG0844hypothetical protein2.4324
PG0874mobilizable transposon, int proteinMobile and extrachromosomal element functions: Transposon functions2.4307
PG0507hypothetical protein2.4290
PG1357hypothetical protein2.3151
PG1410hypothetical protein2.3094
PG0617hypothetical protein2.2814
PG0855hypothetical protein2.2153
PG0009ISPg5, transposase Orf1Mobile and extrachromosomal element functions: Transposon functions2.1609
PG0427ISPg5, transposase Orf1Mobile and extrachromosomal element functions: Transposon functions2.1431
PG0942ISPg5, transposase Orf1Mobile and extrachromosomal element functions: Transposon functions2.1424
PG0541hypothetical protein2.1291
PG1398hypothetical protein2.1216
PG1027hypothetical protein2.1204
PG0590ISPg5, transposase Orf1Mobile and extrachromosomal element functions: Transposon functions2.1151
PG1006hypothetical protein2.1122
PG0340hypothetical protein2.1119
PG0256CvpA family proteinUnknown function: General2.1090
PG0749hypothetical protein2.0834
PG1662hypothetical protein2.0788
PG2220hypothetical protein2.0771
PG1871hypothetical protein2.0589
PG21871,4-dihydroxy-2-naphthoate octaprenyltransferaseBiosynthesis of cofactors, prosthetic groups, and carriers: Menaquinone and ubiquinone2.0471
PG0410hypothetical protein2.0409
PG1233hypothetical protein2.0367
PG0325hypothetical protein2.0349
PG0409hypothetical protein2.0259
PG1513phosphoribosyltransferase, putative/phosphoglycerate mutase family proteinEnergy metabolism: Other2.0032

αLocus number, identification and functional classification according to JCVI P.gingivalis genome database

Fig. 3

Genes analyzed by microarray in the inoculated P.gingivalis W83. Fluorescence signal strength values in X axes and Y axes represent control groups and experimental groups, respectively. Each data point was behalf of a gene chip hybridization signal. Red marking data points were T/C value ≥2, representing upregulated genes, and green marking data points were T/C value ≤0.5, representing downregulated genes

Genes upregulated in the inoculated P.gingivalis W83 αLocus number, identification and functional classification according to JCVI P.gingivalis genome database Genes analyzed by microarray in the inoculated P.gingivalis W83. Fluorescence signal strength values in X axes and Y axes represent control groups and experimental groups, respectively. Each data point was behalf of a gene chip hybridization signal. Red marking data points were T/C value ≥2, representing upregulated genes, and green marking data points were T/C value ≤0.5, representing downregulated genes

Genes downregulated in the inoculated P.gingivalis W83

Compared with wild strain, 22 genes were down-regulated in the inoculated strain (Table 3) (Fig. 3). Among these genes, PG0682, PG0683, PG0684, PG0282 and PG0946 encode ABC transporters. Products of PG0682, PG0683 and PG0684 are putative permease proteins; and products of PG0282 and PG0946 are ATP-binding proteins. In addition, PG2008 and PG0283 also encode transport and binding proteins. All these proteins are involved in cell transmembrane transportation. Some downregulated genes encode proteins related to protein and nucleic acid metabolism, including PG1129, PG1993, PG0001 and PG0522. Products of other genes are related to energy metabolism (PG1042), cell division (PG0141),bacterial pathogenicity (PG1975), and so on.
Table 3

Genes downregulated in the inoculated P.gingivalis W83

Locus no.Putative identificationα Cellular roleα Fold
PG2008TonB-dependent receptor, putativeTransport and binding proteins: Cations and iron carrying compounds0.2234
PG0929hypothetical protein0.2806
PG1129ribonucleotide reductasePurines, pyrimidines, nucleosides, and nucleotides: 2'-Deoxyribonucleotide metabolism0.2862
PG0684ABC transporter, permease protein, putativeTransport and binding proteins: Unknown substrate0.3594
PG0683ABC transporter, permease protein, putativeTransport and binding proteins: Unknown substrate0.3848
PG0682ABC transporter, permease protein, putativeTransport and binding proteins: Unknown substrate0.3938
PG0522tRNA delta(2)-isopentenylpyrophosphate transferaseProtein synthesis: tRNA and rRNA base modification0.4190
PG1648RelA/SpoT family proteinCellular processes: Adaptations to atypical conditions0.4192
PG0282ABC transporter, ATP-binding proteinTransport and binding proteins: Unknown substrate0.4303
PG0946ABC transporter, ATP-binding proteinTransport and binding proteins: Unknown substrate0.4347
PG1042glycogen synthase, putativeEnergy metabolism: Biosynthesis and degradation of polysaccharides0.4485
PG0890alkaline phosphatase, putativeCentral intermediary metabolism: Other0.4552
PG1100hypothetical protein0.4813
PG1993excinuclease ABC subunit CDNA metabolism: DNA replication, recombination, and repair0.4814
PG0226transglutaminase-related proteinUnknown function: General0.4823
PG0141spoOJ proteinCellular processes: Cell division0.4865
PG0144hypothetical protein0.4888
PG1975hemagglutinin protein HagCCellular processes: Pathogenesis0.4941
PG1982CRISPR-associated Cas1 family proteinMobile and extrachromosomal element functions: Other0.4950
PG1718hypothetical protein0.4955
PG0283RND family efflux transporter MFP subunitTransport and binding proteins: Unknown substrate0.4965
PG0001chromosomal replication initiation proteinDNA metabolism: DNA replication, recombination, and repair0.4984

αLocus number, identification and functional classification according to JCVI P.gingivalis genome database

Genes downregulated in the inoculated P.gingivalis W83 αLocus number, identification and functional classification according to JCVI P.gingivalis genome database

Microarray result confirmation by real-time quantitative PCR

Among the upregulated and downregulated genes, we picked up 14 genes to detect the expression by real-time quantitative PCR. Consistent with microarray hybridization, real-time quantitative PCR detection showed similar expression trends in these genes (Table 4).
Table 4

Microarray result confirmation by real-time PCR

GeneFold increase measured by
Microarray analysisReal-time PCR
PG10052.47↑12.24 ± 2.12↑
PG10062.11↑11.57 ± 1.06↑
PG10073.68↑24.67 ± 3.67↑
PG10083.33↑28.99 ± 4.56↑
PG10093.03↑27.56 ± 2.66↑
PG10102.49↑19.88 ± 3.41↑
PG08742.43↑18.58 ± 2.08↑
PG15132.00↑15.86 ± 2.12↑
PG06840.36↓0.036 ± 0.004↓
PG06820.39↓0.047 ± 0.005↓
PG19750.49↓0.067 ± 0.011↓
PG19820.49↓0.058 ± 0.007↓
PG20080.22↓0.011 ± 0.002↓
PG00010.50↓0.068 ± 0.008↓
16sRNA-1
Microarray result confirmation by real-time PCR

Discussion

Chronic periodontitis is initiated by periodontal pathogens, including P.gingivalis. Our study showed that P.gingivalis W83 induced rat gingival tissue inflammation, and alveolar bone loss, which is the key feature of periodontitis. Therefore, our study demonstrates that P.gingivalis W83 has pathogenic effects on rat oral cavity. After inoculation in rat oral cavity for 8 weeks, P.gingivalis W83 were isolated, and analyzed by microarray. In the detected 1786 genes, 42 genes were upregulated, whereas 22 genes were downregulated, indicating that the local periodontal environment can change the gene expression profile of P.gingivalis W83. In the 42 upregulated genes, 30 expressed hypothetical proteins. Among other 12 genes, PG0874, PG0009, PG0427, PG0942 and PG0590 are in the same class in JCVI cell function classification. They all function as mobile extrachromosomal factor: transposon. Transposon is a removable genome DNA sequence, which can “jump” in genome from one location to another through the process of cutting and integration. Transposition is generally known to be triggered by cellular stress [12-14], therefore upregulation of these transposons suggests that P.gingivalis W83 inoculated in rat oral cavity may adapt local environment for its own survival, which is consistent with some other studies [15,16]. In the 22 downregulated genes, 7 genes encode transport and binding proteins. All these proteins are involved in cell transmembrane transportation. They can transport many substrates, such as metabolites, ion, sugar, amino acids, lipids, cholesterol and drugs [17]. PG2008 encodes a TonB dependent receptor protein, responsible for iron transmembrane transportation [18]. As iron ion is necessary for the breeding and spreading of P.gingivalis W83, downregulation of PG2008 suggests the subdued iron transferring and proliferation of P.gingivalis W83. There are 4 downregulated genes encoding proteins related to nucleic acid and protein metabolism. PG1129 encodes a nucleotide reductase, which is related to purine, pyrimidine, nucleotide and DNA metabolism, and plays a regulating role in cell proliferation. Products of PG1993 and PG0001 are related to the metabolism of DNA, such as copy, restructuring and repair. Therefore, downregulation of these genes means that the proliferation of inoculated P.gingivalis W83 is in certain obstacles. PG1042 encodes a putative glycogen synthase, involved in biosynthesis and degradation of polysaccharides. Downregulation of PG1042 suggests a disturbed energy metabolism. PG0141 encodes a spoOJ protein related to cell division, and PG1975 encodes hemagglutinin HagC related to pathogenicity of P.gingivalis W83. In addition, PG1982 encodes a CRISPR protein related to CAS1 family. CRISPR/CAS system can protect bacteria against the encroachment by phage, and resist other chromosome genetic material and prevent from the expression of their genes [19-21]. Downregulation of PG1982 suggests a decrease in the defense capability of P.gingivalis W83. It should be noted that gene expression observed in this study was in mRNA level. As we have known, alterations in mRNA expression are not always consistent with those in protein expression. Therefore, observations in protein level of gene expression will be more convincing. However, it is impracticable to analyze the protein expression of all 64 genes with RNA expression alteration. Moreover, some products of these genes are still hypothetical proteins. Because the inoculated P.gingivalis was cultured outside the rat oral cavity for some days before RNA extraction, the RNA samples cannot exactly reflect the changes in gene expression after inoculation, although the results can still indicate which genes are upregulated or downregulated.

Conclusions

Our study shows that P.gingivalis W83 has pathogenic effects on host, and local inflammatory oral environment alters the gene expression profile of P.gingivalis W83. Products of these upregulated and downregulated genes are mainly related to transposon functions, cell transmembrane transportation, protein and nucleic acid metabolism, energy metabolism, cell division and bacterial pathogenicity. These changes may lead to decreased proliferation and pathogenicity of P.gingivalis W83, and favor themselves to adapt local environment for survival.
  21 in total

Review 1.  Transposon-mediated adaptive and directed mutations and their potential evolutionary benefits.

Authors:  Zhongge Zhang; Milton H Saier
Journal:  J Mol Microbiol Biotechnol       Date:  2012-01-13

Review 2.  Periodontal disease.

Authors:  R C Williams
Journal:  N Engl J Med       Date:  1990-02-08       Impact factor: 91.245

3.  Proteome analysis of coinfection of epithelial cells with Filifactor alocis and Porphyromonas gingivalis shows modulation of pathogen and host regulatory pathways.

Authors:  A Wilson Aruni; Kangling Zhang; Yuetan Dou; Hansel Fletcher
Journal:  Infect Immun       Date:  2014-05-27       Impact factor: 3.441

Review 4.  Genome and stresses: reactions against aggressions, behavior of transposable elements.

Authors:  C Arnault; I Dufournel
Journal:  Genetica       Date:  1994       Impact factor: 1.082

5.  Iron- and hemin-dependent gene expression of Porphyromonas gingivalis.

Authors:  C Anaya-Bergman; A Rosato; J P Lewis
Journal:  Mol Oral Microbiol       Date:  2014-09-12       Impact factor: 3.563

Review 6.  The role of immune responses in bone loss during periodontal disease.

Authors:  P J Baker
Journal:  Microbes Infect       Date:  2000-08       Impact factor: 2.700

7.  Free and hemophore-bound heme acquisitions through the outer membrane receptor HasR have different requirements for the TonB-ExbB-ExbD complex.

Authors:  Sylvie Létoffé; Philippe Delepelaire; Cécile Wandersman
Journal:  J Bacteriol       Date:  2004-07       Impact factor: 3.490

8.  Proteome analysis of Porphyromonas gingivalis cells placed in a subcutaneous chamber of mice.

Authors:  M Yoshimura; N Ohara; Y Kondo; M Shoji; S Okano; Y Nakano; Y Abiko; K Nakayama
Journal:  Oral Microbiol Immunol       Date:  2008-10

9.  Expression of Porphyromonas gingivalis small RNA in response to hemin availability identified using microarray and RNA-seq analysis.

Authors:  Priscilla Phillips; Ann Progulske-Fox; Scott Grieshaber; Nicole Grieshaber
Journal:  FEMS Microbiol Lett       Date:  2013-11-19       Impact factor: 2.742

10.  Genetic exchange of fimbrial alleles exemplifies the adaptive virulence strategy of Porphyromonas gingivalis.

Authors:  Jennifer E Kerr; Jared R Abramian; Doan-Hieu V Dao; Todd W Rigney; Jamie Fritz; Tan Pham; Isabel Gay; Kavitha Parthasarathy; Bing-yan Wang; Wenjian Zhang; Gena D Tribble
Journal:  PLoS One       Date:  2014-03-13       Impact factor: 3.240

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.