| Literature DB >> 25999629 |
Mahmood Shishegar1, Mohammad Motamedi-Far2, Seyed Basir Hashemi1, Abbas Bigham-Sadegh1, Amir Emami2.
Abstract
Otitis media with effusion (OME) is one of the most common causes of hearing loss (HL) in children. It has been reported that several factors such as eustachian tube dysfunction, insufficiencies in the aeration of the mastoid cells, allergies, immunity, and infections play an important role in the etiology of the disease. Little is known about the role of Helicobacter pylori (H. pylori) in extragastric diseases. Because of the near location of the nose, sinuses, tonsils, and adenoids to the eustachian tube and middle ear, we believe it is possible to have H. pylori in the middle ear. The present study was designed to investigate the presence of H. pylori by polymerase chain reaction (PCR) in the middle ear effusion of patients with OME. The study was performed on 21 patients, 19 patients were affected bilaterally, and 2 patients were affected unilaterally, from which 40 specimens were collected. OME was diagnosed through findings by otoscopic examination and tympanogram. The middle ear fluid samples were collected under sterile conditions. A total of 40 samples was stored at -80°C until analyzed by PCR assay. From 40 specimens, 2 specimens were serosal and 38 specimens were mucoid. PCR results of the study in assays for Helicobacter pylori were not positive in all collected specimens. Overall, probably there was no H. pylori organism in free-floating form and thus could not be detected by PCR.Entities:
Keywords: Helicobacter pylori; Polymerase chain reaction; Serous otiti
Year: 2015 PMID: 25999629 PMCID: PMC4430891
Source DB: PubMed Journal: Iran J Med Sci ISSN: 0253-0716
Primer sequence target genes, product size, and PCR protocol
|
|
|
|
|
|---|---|---|---|
| Urease C-F | TGGGACTGATGGCGTGAGGG | 95ºC/1min-57ºC/1min-72ºC/1min | 820 bp |
| Urease C-R | AAGGGCGTTTTTAGATTTTT | 95ºC/1min-57ºC/1min-72ºC/1min | 820 bp |
Characteristics of patients with OME evaluated for H. pylori in middle ear effusion
|
|
|
|
|
|
|
|
|---|---|---|---|---|---|---|
| 1 | 4 | F | Bilateral | Mucoid | B type | - |
| 2 | 5 | M | Unilateral | Mucoid | B type | - |
| 3 | 6 | F | Bilateral | Serous | B type | - |
| 4 | 6 | M | Bilateral | Mucoid | B type | - |
| 5 | 12 | M | Bilateral | Mucoid | B type | - |
| 6 | 8 | F | Bilateral | Mucoid | B type | - |
| 7 | 3 | M | Bilateral | Mucoid | B type | - |
| 8 | 5 | F | Bilateral | Mucoid |
R=B type | - |
| 9 | 4 | F | Bilateral | Mucoid | B type | - |
| 10 | 4 | F | Bilateral | Mucoid | B type | - |
| 11 | 6 | M | Bilateral | Serous |
R=B type | - |
| 12 | 5 | M | Bilateral | Mucoid | B type | - |
| 13 | 4 | F | Bilateral | Mucoid | C type | - |
| 14 | 6 | F | Bilateral | Mucoid | C type | - |
| 15 | 6 | M | Bilateral | Mucoid | C type | - |
| 16 | 5 | M | Bilateral | Mucoid |
R=B type | - |
| 17 | 7 | F | Bilateral | Mucoid | B type | - |
| 18 | 3 | M | Bilateral | Mucoid | B type | - |
| 19 | 9 | M | Bilateral | Mucoid | C type | - |
| 20 | 7 | M | Bilateral | Mucoid |
R=B type | - |
| 21 | 2 | M | Unilateral | Mucoid | B type | - |
M: Male, F: Female, R: Right, L: Left
Figure 1Results of PCR for detection of H. pylori in middle ear effusion of patients with OME. C+: Positive control; C-: Negative control; 1R, 1L, 2R, 3R, 4R, 5L and 6L are patient’s specimens that were all negative