Literature DB >> 25993301

Polymorphisms of the Ovine BMPR-IB, BMP-15 and FSHR and Their Associations with Litter Size in Two Chinese Indigenous Sheep Breeds.

Weimin Wang1, Shijia Liu2, Fadi Li3, Xiangyu Pan4, Chong Li5, Xiaoxue Zhang6, Youji Ma7,8, Yongfu La9, Rui Xi10, Tingfu Li8,11.   

Abstract

The Small Tailed Han sheep and Hu sheep are two prolific local sheep in China. In this study, the polymorphisms of BMPR-IB (Bone morphogenetic protein receptor IB), BMP-15 (Bone morphogenetic protein 15) and FSHR (follicle stimulating hormone receptor) were investigated to check whether they are associated with litter size in Small Tailed Han sheep and Hu sheep. Consequently, three polymorphisms, FecB mutation in BMPR-IB (c.746A>G), FecG mutation in BMP-15 (c.718C>T) and the mutation (g. 47C>T) in FSHR were found in the above two sheep breeds with a total number of 1630 individuals. The single marker association analysis showed that the three mutations were significantly associated with litter size. The ewes with genotype FecBB/FecBB and FecBB/FecB+ had 0.78 and 0.58 more lambs (p < 0.01) than those with genotype FecB+/FecB+, respectively. The heterozygous Han and Hu ewes with FecXG/FecX+ genotype showed 0.30 (p = 0.05) more lambs than those with the FecX+/FecX+ genotype. For FSHR gene, the ewes with genotype CC had 0.52 (p < 0.01) and 0.75 (p < 0.01) more lambs than those with genotypes TC and TT, respectively. Combined effect analyses indicated an extremely significant interaction (p < 0.01) between the random combinations of BMPR-IB, BMP-15 and FSHR genes on litter size. In addition, the Han and Hu ewes with BB/G+/CC genotype harbor the highest litter size among ewes analyzed in current study. In conclusion, BMPR-IB, BMP-15 and FSHR polymorphisms could be used as genetic markers in multi-gene pyramiding for improving litter size in sheep husbandry.

Entities:  

Keywords:  BMP-15 gene; BMPR-IB gene; FSHR gene; Hu sheep; Small Tailed Han sheep; litter size

Mesh:

Substances:

Year:  2015        PMID: 25993301      PMCID: PMC4463706          DOI: 10.3390/ijms160511385

Source DB:  PubMed          Journal:  Int J Mol Sci        ISSN: 1422-0067            Impact factor:   5.923


1. Introduction

The FecB (Fec = Fecundity, B = Booroola) mutation plays a vital role in increasing ovulation rate and prolificacy in ewes. This mutation (c.746A>G) was in BMPR-IB (Bone morphogenetic protein receptor IB) gene that located on chromosome 6,which was first found to be significantly associated with litter size in Booroola Merino ewes [1,2,3]. BMP-15 (Bone morphogenetic protein 15) gene belongs to the TGFβ (Transforming growth factor-β) family, which acts as a key regulator of granulosa cell (GC) processes in ovarian follicular development [4,5]. The sheep BMP-15 gene is located on the X chromosome [4]. The c.718C>T mutation (named FecX; Galway mutation) in BMP-15 gene was first identified in Cambridge and Belclare sheep, which increased ovulation rate and infertility [6]. FSHR (Follicle stimulating hormone receptor) gene was first identified in rat Sertoli cells and may have an influence on the FSH (follicle stimulating hormone) signal transduction [7]. Additionally, FSH has been reported to play an important role in the development of antral follicles [8,9]. A variety of mutations were found in the 5' flanking region of ovine FSHR gene, which were significantly associated with litter size in Australian sheep, Hu sheep and Small Tailed Han sheep [10,11,12]. The Small Tailed Han sheep and Hu sheep were originally raised in Shandong Province and Jiangsu Province, China [13]. They quickly gained the attention of Chinese sheep breeders and were largely used in the modern hybridization system as female parents because of their reputation for high fertility. To date, there are no reports about the combined effect of BMPR-IB, BMP-15 and FSHR genes on litter size of Small Tailed Han sheep and Hu sheep. Therefore, the objectives of this study were to investigate the relationships of single nucleotide polymorphisms (SNPs) in BMPR-IB, BMP-15 and FSHR, and their combined effect with litter size, which may serve as valuable markers for female fertility selection at the early stage in Small Tailed Han sheep and Hu sheep.

2. Results

2.1. Genotyping and Allele Frequency Analysis

A 140 bp PCR product containing the c.746A>G polymorphism in the coding region of BMPR-IB gene was digested using the Ava II restriction enzyme. The digestion generated three fragments, and the 140 bp, 110 bp + 30 bp and 140 bp + 110 bp +30 bp bands represented ++, BB and B+ genotypes, respectively (Figure 1).
Figure 1

PCR-RFLP results of different genotypes of the PCR products digested by enzyme Ava IIc.746A>G of ovine BMPR-IB polymorphisms. The genotypes are marked on the top of the lanes. M: DNA Marker (DL2000).

PCR-RFLP results of different genotypes of the PCR products digested by enzyme Ava IIc.746A>G of ovine BMPR-IB polymorphisms. The genotypes are marked on the top of the lanes. M: DNA Marker (DL2000). Additionally, the 141 bp PCR product of the c.718C>T polymorphism of the BMP-15 gene was digested with Hinf I, generating two fragments: the 141 bp + 111 bp + 30 bp and 111 bp + 30 bp bands represented G+ and ++ genotypes, respectively (Figure 2). In ewes studied, none of them carried homozygous genotype (GG).
Figure 2

PCR-RFLP results of different genotypes of the PCR products digested by enzyme Hinf I c.718C>T of ovine BMP-15polymorphisms. The genotypes are marked on the top of the lanes. M: DNA Marker (DL2000).

PCR-RFLP results of different genotypes of the PCR products digested by enzyme Hinf I c.718C>T of ovine BMP-15polymorphisms. The genotypes are marked on the top of the lanes. M: DNA Marker (DL2000). The 244 bp PCR product of the g.47C>T of the FSHR gene was digested by BsiE I and the result is shown in Figure 3. The fragment length of the TT genotype was 244 bp, while CC and CT genotypes were 154 bp + 90 bp and 244 bp + 154 bp + 90 bp, respectively.
Figure 3

PCR-RFLP results of different genotypes of the PCR products digested by enzyme BsiE I g.47C>T of ovine FSHR polymorphisms. The genotypes are marked on the top of the lanes. M: DNA Marker (DL2000).

PCR-RFLP results of different genotypes of the PCR products digested by enzyme BsiE I g.47C>T of ovine FSHR polymorphisms. The genotypes are marked on the top of the lanes. M: DNA Marker (DL2000). The allele and genotype frequency were analyzed in the experimental populations (Table 1). All these three mutations were detected in both Small Tailed Han sheep and Hu sheep. The c.746A>G polymorphism of the BMPR-IB gene showed a higher frequency of allele G (B) than allele A (+), and the GG (BB) genotype was predominant in total population. The CC (++) genotype of the c.718C>T polymorphism of the BMP-15 gene was higher in all population. Whereas, TT genotype of the g.47C>T polymorphism of FSHR gene was higher than the CC and TC genotypes in the population.
Table 1

Allele and genotype frequencies of the ovine BMPR-IB, BMP-15 and FSHR genes in experimental populations.

GeneTotal PopulationSmall Tail Han SheepHu Sheep
Genotype FrequencyAllele FrequencyGenotype FrequencyAllele FrequencyGenotype FrequencyAllele Frequency
BMPR-IBBBB+++B+BBB+++B+BBB+++B+
0.090.890.020.530.470.100.880.020.540.460.080.900.020.530.47
BMP-15GGG+++G+GGG+++G+GGG+++G+
00.290.710.150.8500.40.60.200.8000.170.830.080.92
FSHRCCTCTTCTCCTCTTCTCCTCTTCT
0.020.610.370.330.670.020.420.560.240.760.020.830.150.440.56

B means FecB mutation; G means FecX mutation; + means wild-type; C means FSHR g.47C>T mutation; T means wild-type.

2.2. Single Marker-Trait Association

The least squares means and SE (standard error) for litter size of individuals with different genotypes in Small Tailed Han sheep and Hu sheep are shown in Table 2. The association analysis revealed that the three polymorphisms found in this study were significant, or tend to be associated with (BMPR-IB, p < 0.01; BMP-15, p = 0.05; and FSHR, p < 0.01) litter size in Hu and Han sheep.
Table 2

Association results between the genotypes of the ovine BMPR-IB, BMP-15 and FSHR genes and litter size.

GeneGenotype 1Total PopulationSmall Tail Han SheepHu Sheep
No. of EwesLitter SizeNo. of EwesLitter SizeNo. of EwesLitter Size
BMPR-IBBB1421.95 ± 0.070 A852.06 ± 0.078 A571.89 ± 0.092 A
B+14501.75 ± 0.020 B7651.78 ± 0.026 B6851.74 ± 0.026 B
++381.17 ± 0.115 C191.21 ± 0.166 C191.15 ± 0.150 C
BMP-15G+4791.96 ± 0.035 a3511.91 ± 0.0391282.18 ± 0.063 a
++11511.66 ± 0.019 b5181.71 ± 0.0326331.66 ± 0.028 b
FSHRCC392.31 ± 0.124 Aa212.33 ± 0.157 Aa182.29 ± 0.158 A
TC10001.79 ± 0.023 Bb3681.88 ± 0.038 Ab6321.75 ± 0.028 B
TT5911.56 ± 0.050 Bc4801.70 ± 0.033 Bc1111.49 ± 0.068 B

The numbers in the table are the LSMEAN ± standard error of phenotypic value. The different superscript letters in the same column for each gene in lowercase represent significant level at p < 0.05, which letters in uppercase represent significant level at p < 0.01, and the same letter represents no significant difference (p > 0.05). 1 B means FecB mutation; G means FecX mutation; + means wild-type; C means FSHR g.47C>T mutation; T means wild-type.

Association analysis results indicated that the ewes with genotypes BB and B+ had 0.78 (p < 0.01) and 0.58 (p < 0.01) gave birth to more lambs than those with genotype ++ in the experimental population, respectively, while the ewes with genotype G+ had 0.30 (p = 0.05) had more lambs than the ++ genotype ones. The ewes carrying genotype CC had 0.52 (p < 0.01) and 0.75 (p < 0.01) had more lambs when compared with the ewes carrying genotypes TC and TT, respectively. More specifically, the ewes with genotypes BB and B+ had 0.85 (p < 0.01) and 0.57 (p < 0.01) more lambs than those with genotype ++ in Small Tailed Han sheep, respectively. The c.718C>T polymorphism of the BMP-15 gene was not significantly associated with litter size in Small Tailed Han sheep (p > 0.05). The ewes carrying genotype CC and TCof the FSHR gene had 0.63 (p < 0.01) and 0.18 (p < 0.01) more lambs than the ewes carrying genotype TT, respectively. In Hu sheep, the ewes with genotypes BB and B+ had 0.74 and 0.59 had more lambs than those with genotype ++, respectively. While the ewes carrying genotype G+ had 0.52 (p < 0.05) more lambs than the ++ genotype ones. The ewes carrying genotype CC had 0.80 (p < 0.01) and 0.54 (p < 0.01) had more lambs when compared to the ewes carrying genotypes TT and TC, respectively. Allele and genotype frequencies of the ovine BMPR-IB, BMP-15 and FSHR genes in experimental populations. B means FecB mutation; G means FecX mutation; + means wild-type; C means FSHR g.47C>T mutation; T means wild-type. Association results between the genotypes of the ovine BMPR-IB, BMP-15 and FSHR genes and litter size. The numbers in the table are the LSMEAN ± standard error of phenotypic value. The different superscript letters in the same column for each gene in lowercase represent significant level at p < 0.05, which letters in uppercase represent significant level at p < 0.01, and the same letter represents no significant difference (p > 0.05). 1 B means FecB mutation; G means FecX mutation; + means wild-type; C means FSHR g.47C>T mutation; T means wild-type. Combined effect analysis of two genes (BMPR-IB/BMP-15, BMPR-IB/FSHR and BMP-15/FSHR) on litter size. The numbers in the table are the LSMEAN ± standard error of phenotypic value. The different superscript letters in the same column for each gene in lowercase represent significant level at p < 0.05, which letters in uppercase represent significant level at p < 0.01, and the same letter represents no significant difference (p > 0.05).1 B means FecB mutation; G means FecX mutation; + means wild-type; C means FSHR g.47C>T mutation; T means wild-type. Combined effect analysis of BMPR-IB, BMP-15 and FSHR genes on litter size. The different superscript letters in the same column for each gene in lowercase represent significant level at p < 0.05, which letters in uppercase represent significant level at p < 0.01, and the same letter represents no significant difference (p > 0.05). B means FecB mutation; G means FecX mutation; + means wild-type; C means FSHR g.47C>T mutation; T means wild-type.

2.3. Combined Effect Analysis of BMPR-IB, BMP-15 and FSHR Genes on Litter Size

Highly significant interactions were observed if we randomly combined two of three genes studied and all the three genes. The combined effect of two genes (BMPR-IB/BMP-15, BMPR-IB/FSHR and BMP-15/FSHR) on litter size is presented in Table 3. For BMPR-IB/BMP-15, the ewes with BB/G+ genotype had the largest litter size and with the ++/++ genotype having the lowest litter size among all the six genotypes. The effect of the BMPR-IB gene mutation was greater than that of the BMP-15 gene mutation on litter size in this population. For BMPR-IB/FSHR, the ewes with BB/CC genotype had greater litter size than those with other genotypes. The effect of the BMPR-IB gene mutation was greater than that of the FSHR gene mutation on litter size. For BMP-15/FSHR, the ewes with G+/CC genotype had greater litter size than those with other genotypes. The effect of the FSHR gene mutation was greater than that of the BMP-15 gene mutation on litter size. Therefore, the ewes carrying mutations in both the BMPR-IB and FSHR genes had greater litter size than the other two genes combinations, and the effect of the BMPR-IB mutation was the greatest among these three genes.
Table 3

Combined effect analysis of two genes (BMPR-IB/BMP-15, BMPR-IB/FSHR and BMP-15/FSHR) on litter size.

GeneGenotypeTotal PopulationSmall Tail Han SheepHu Sheep
No. of EwesLitter SizeNo. of EwesLitter SizeNo. of EwesLitter Size
BMPR-IB/BMP-15++/++291.17 ± 0.071 Dd131.15 ± 0.104 Bc161.19 ± 0.101 Bbc
++/G+91.22 ± 0.147 Dcd61.33 ± 0.211 Bbc31.00 ± 0.000 Bc
B+/++10291.66 ± 0.020 BCbc4501.71 ± 0.033 ABbc5791.63 ± 0.025 ABabc
BB/++931.82 ± 0.073 ABb551.84 ± 0.089 ABab381.79 ± 0.126 ABab
B+/G+4121.93 ± 0.036 ABab3151.87 ± 0.041 ABab1062.13 ± 0.068 Aa
BB/G+492.35 ± 0.129 Aa302.47 ± 0.157 Aa192.16 ± 0.220 Aa
BMPR-IB/FSHR++/TC231.17 ± 0.081 Dd81.13 ± 0.125 Bd151.20 ± 0.107
++/TT151.20 ± 0.107 Dcd111.27 ± 0.141 Bcd41.00 ± 0.000
B+/TT5181.67 ± 0.030 BCbcd4311.69 ± 0.033 Bbcd871.57 ± 0.069
B+/TC8961.76 ± 0.022 BCbcd3151.86 ± 0.042 ABbcd5811.70 ± 0.026
BB/TT581.91 ± 0.099 BCbc381.89 ± 0.112 ABbcd201.95 ± 0.198
BB/TC812.02 ± 0.093 BCb452.16 ± 0.123 ABabc361.86 ± 0.139
B+/CC362.31 ± 0.125 ABab192.26 ± 0.168 ABab172.35 ± 0.191
BB/CC33.000 ± 0.577 Aa23.00 ± 1.000 Aa13.00
BMP-15/FSHR++/TT4251.63 ± 0.032 Cc3401.66 ± 0.036 Bc851.51 ± 0.072 Cd
++/TC7071.67 ± 0.024 Cc1691.78 ± 0.058 ABbc5381.63 ± 0.025 BCcd
G+/TT1661.81 ± 0.055 BCc1401.78 ± 0.60 ABbc262.00 ± 0.136 ABCbcd
G+/TC2932.01 ± 0.045 BCbc1991.97 ± 0.055 ABabc942.10 ± 0.080 ABCabc
++/CC192.21 ± 0.181 ABab92.22 ± 0.222 ABab102.20 ± 0.291 ABab
G+/CC202.50 ± 0.170 Aa122.42 ± 0.260 Aa82.63 ± 0.183 Aa

The numbers in the table are the LSMEAN ± standard error of phenotypic value. The different superscript letters in the same column for each gene in lowercase represent significant level at p < 0.05, which letters in uppercase represent significant level at p < 0.01, and the same letter represents no significant difference (p > 0.05).1 B means FecB mutation; G means FecX mutation; + means wild-type; C means FSHR g.47C>T mutation; T means wild-type.

The combined effect analysis of three genes (BMPR-IB/BMP-15/FSHR) on litter size is presented in Table 4. The BB/G+/CC genotype had significantly greater contribution on litter size than any other genotypes.
Table 4

Combined effect analysis of BMPR-IB, BMP-15 and FSHR genes on litter size.

GeneGenotypeTotal PopulationSmall Tail SheepHu Sheep
No. of EwesLitter SizeNo. of EwesLitter SizeNo. of EwesLitter Size
BMPR-IB/BMP-15/FSHR++/G+/TC51.00 ± 0.000 Ee21.00 ± 0.00031.00 ± 0.000
++/++/TT111.09 ± 0.091 DEde71.14 ± 0.14341.00 ± 0.000
++/++/TC181.22 ± 0.101 CDEcde61.17 ± 0.167121.25 ± 0.131
++/G+/TT41.50 ± 0.289 BCDEbcde41.50 ± 0.2890-
B+/++/TT3781.64 ± 0.034 BCDEbcde3071.67 ± 0.038711.51 ± 0.075
B+/++/TC6331.66 ± 0.025 BCDEbcde1351.78 ± 0.0664981.63 ± 0.026
BB/++/TT361.75 ± 0.122 BDCEbcde261.77 ± 0.128101.70 ± 0.300
B+/G+/TT1401.76 ± 0.059 BCDEbcde1241.75 ± 0.063161.88 ± 0.155
BB/++/TC561.86 ± 0.093 BCDEbcde281.89 ± 0.130281.82 ± 0.137
B+/G+/TC2631.99 ± 0.045 BCDEbcd1801.92 ± 0.055832.14 ± 0.079
BB/G+/TT222.18 ± 0.156 BCDbc122.17 ± 0.207102.20 ± 0.249
B+/++/CC182.22 ± 0.191 BCb82.25 ± 0.250102.20 ± 0.291
B+/G+/CC182.39 ± 0.164 Bb112.27 ± 0.23772.57 ± 0.202
BB/G+/TC252.40 ± 0.200 Bb172.59 ± 0.21182.00 ± 0.423
BB/G+/CC23.50 ± 0.500 Aa14.0013.00

The different superscript letters in the same column for each gene in lowercase represent significant level at p < 0.05, which letters in uppercase represent significant level at p < 0.01, and the same letter represents no significant difference (p > 0.05). B means FecB mutation; G means FecX mutation; + means wild-type; C means FSHR g.47C>T mutation; T means wild-type.

3. Discussion

In the present study, we selected the ovine BMPR-IB, BMP-15 and FSHR as candidate genes to analyze the effect of single-marker and multi-marker on litter size. The FecB gene is crucial in the regulation of prolificacy phenotype in sheep [1,2]. Several studies indicated that ewes carrying FecB-mutation have significantly higher ovulation rates if compared with their wild-type contemporaries [1,2,14]. In this study, the FecB-mutation was found in Small Tailed Han sheep and Hu sheep, and was significantly associated with litter size, which is consistent with previous reports [15,16,17,18]. Ovine BMP-15 gene plays a vital role in growth and differentiation of early ovarian follicles [19,20,21,22]. In Inverdale and Hanna sheep, the c.718C>T mutation of the BMP-15 gene has been reported to show an increased ovulation rate under heterozygous conditions, and homozygotes are otherwise infertile [17]. Chu et al. (2005), Wang et al. (2005) and Davis et al. (2006) failed to detect the BMP-15 (FecXI) mutation in Hu sheep [17,23,24], but a BMP-15 (FecXG) was identified in the Small Tailed Han Sheep by Chu et al. [15]. In the present study, the BMP-15 (FecXG) mutation was detected in both Small Tailed Han and Hu sheep breeds. We also found that the c.718C>T mutation of the BMP-15 gene was significantly association with litter size, similar with previous studies in the Inverdale and Hanna sheep [17]. Interestingly, there were no homozygotes (GG genotype) detected in Small Tailed Han sheep (n = 869) and Hu sheep (n = 761). Chu et al. also reported the absence of GG genotype in Small Tailed Han sheep [15]. There are two potential reasons for the lack of GG genotype ewes in the population, one simple explanation is that GG ewes did not exist in our population, another reason is that the GG ewes may have existed in our population, but we selected the ewes with litter size records, and the infertile GG ewes were excluded in this study. About 29% of ewes in the population are G+ genotype and mating occurred under a random model; we believe GG genotype ewes should be generated under this model and therefore the GG genotype ewes should be detected in the infertile group. Mating of the G+ genotype rams and G+ genotype ewes can help verify this speculation. Numerous reports have shown that the FSHR gene plays a key role in animal reproduction [25,26,27]. Chu et al. found two mutation (g.681T>C and g.629C>T) in the 5' flanking region of the FSHR gene in Hu sheep and three novel mutations (g.200G>A, g.197G>A and g.98T>C) in Small Tail Han Sheep [12]. In our previous study, a novel SNP (g.47C>T) was found in the 5' flanking region of the FSHR gene in the Small Tailed Han sheep and Hu sheep [14]. This SNP was significantly associated with litter size. Therefore, the ovine FSHR gene could be selected as a candidate gene for improving litter size traits in sheep husbandry. Interestingly, several groups have reported the multi-marker combination effect on litter size in sheep. Chu et al. reported that the Small Tailed Han ewes carried BB/G+ genotype (BMPR-IB and BMP-15) showed more litter size than those with either mutation alone [15]. Individuals in Cambridge and Belclare breeds with mutations in both the GDF9 and BMP15 genes were found to be associated with greater ovulation rate than those with either single mutation [6]. In the present study, mutations in both the BMPR-IB and BMP-15 genes were also detected in Hu sheep and Small Tailed Han sheep and we also found a third mutations (FSHR g.47C>T) in these two breeds. The single marker-trait association analysis revealed that each mutation in ovine BMPR-IB, BMP-15 and FSHR genes was significantly associated with litter size in this population, and multi-marker analysis showed that individuals with the BB/G+/CC genotype had more lambs than those with only one predominant genotype, indicating that multiple markers may have a greater effect on contributing to the litter size in sheep and that the BB/G+/CC genotype combinations of BMPR-IB, BMP-15 and FSHR genes was considered as the superior genotype.

4. Experimental Section

4.1. Ethics Statement

The experimental procedures were performed according to protocols approved by the Biological Studies Animal Care and Use Committee of Gansu Province, China. All efforts were made to minimize any discomfort during blood collection.

4.2. Experimental Population

A total of 1630 ewes aged from 12 to 30 months were collected from Gansu Zhongtian Sheep Ltd., including 869 Small Tail Han Sheep and 761 Hu sheep. All the sheep were in the artificial insemination system and raised in the same managed conditions. The litter size data for ewes was from the first or second parity (Table 5).
Table 5

Experimental population structure and litter size phenotypic value.

BreedNo.Litter Size
Hu Sheep7611.706 ± 0.024 a
Small Tail Han Sheep8691.791 ± 0.025 a
Total16301.752 ± 0.017

The numbers in the table are the LSMEAN ± standard error of the litter size. The same letter represents no significant difference (p > 0.05).

Experimental population structure and litter size phenotypic value. The numbers in the table are the LSMEAN ± standard error of the litter size. The same letter represents no significant difference (p > 0.05).

4.3. DNA Extraction and Genotyping

Genomic DNA was extracted from the venous jugular blood samples (5 mL per ewes) by the phenol-chloroform method, then dissolved in TE buffer solution (10 mM Tris-HCl and 1 mM EDTA, pH 8.0), and kept at −20 °C. The polymorphisms were genotyped by PCR-RFLP. The primers and restriction enzymes used in the genotyping analysis are listed in Table 6. The information of the primers of BMPR-IB, BMP-15 and FSHR are shown elsewhere [1,6,13]. The PCR was performed in a volume of 10 μL, containing 10× PCR buffer, 0.15 μM primer, 35 μM of dNTP, and 20 ng of genomic DNA, 0.5 U Taq DNA Polymerase (TransGen Biotech, Beijing, China). The PCR was performed as below: 5 min at 94 °C, followed by 35 cycles for 30 s at 94 °C, 30 s at 58~63 °C, 25 s at 72 °C and a final extension of 5 min at 72 °C. Five μL of each PCR product was digested with 3 U restriction endonuclease overnight at 37 °C, then the different sizes were separated on a 3% agarose gel, subsequently stained by GelRed. PCR fragments from different genotypes were cloned and sequenced for validation.
Table 6

Primers and restriction endonucleases.

GenePrimer Sequences (5'-3')Tm (°C)PCR Product Size (bp)Restriction EndonucleaseCitation
BMPR-IB-FGTCGCTATGGGGAAGTTTGGATG59140Ava II[1]
BMPR-IB-RCAAGATGTTTTCATGCCTCATCAACACGGTC
BMP-15-FCACTGTCTTCTTGTTACTGTATTTCAATGAGAC63141Hinf I[6]
BMP-15-RGATGCAATACTGCCTGCTTG
FSHR-FCGTATCTTTCCACGCCCTCT58244BsiE I[14]
FSHR-RCCATCCACCCGATTGCTT
Primers and restriction endonucleases.

4.4. Statistical Analysis

The association analysis between single marker and litter size was performed by GLM (General liner model) procedure in the SAS software package (SAS Inst. Inc., Cary, NC, USA). The linear model was as follows: Y where Yijl was the ijl traits’ observation value; μ was the mean; Gi was the effect of the ith genotypes; Bj was the effect of jth breeding; Sl was the effect within season and εijl was residual corresponding to the traits observation value with var (ε) = Iσe2. The model of association analysis between multiple markers and litter size was as follows: Y = μ + SNP1 + SNP2 + SNP1 × SNP2 + B and Y = μ + SNP1 + SNP2 + SNP3 + SNP1 × SNP2 + SNP1 × SNP3 + SNP2 × SNP3+ SNP1 × SNP2 × SNP3 + B where μ was the traits’ mean; SNP1, SNP2 and SNP3 were the effect of the genotypes; SNP1 × SNP2, SNP1 × SNP3 and SNP2 × SNP3 were combined effects of double genes; SNP1 × SNP2 × SNP3 was combined effect of three genes; Bj was the effect of jth breeding; Sl was the effect within season; Combinationm was the effect of combination and εjlm was residual corresponding to the traits observation value with var (ε) = Iσe2. p ≤ 0.05 was considered as the statistically significant criterion.

5. Conclusions

In summary, our present study indicated that the Small Tailed Han sheep and Hu sheep carried three polymorphisms (FecB, FecG and FSHR g.47C>T) associated with litter size. The ovine BMPR-IB, BMP-15 and FSHR genes have a combined effect on litter size in Small Tailed Han sheep and Hu sheep. Using BMPR-IB, BMP-15 and FSHR genes as genetic markers for multi-gene pyramiding can provide a way to improve litter size and shorten the breeding process of highly prolific sheep.
  26 in total

1.  Mutation in bone morphogenetic protein receptor-IB is associated with increased ovulation rate in Booroola Mérino ewes.

Authors:  P Mulsant; F Lecerf; S Fabre; L Schibler; P Monget; I Lanneluc; C Pisselet; J Riquet; D Monniaux; I Callebaut; E Cribiu; J Thimonier; J Teyssier; L Bodin; Y Cognié; N Chitour; J M Elsen
Journal:  Proc Natl Acad Sci U S A       Date:  2001-04-24       Impact factor: 11.205

2.  DNA tests in prolific sheep from eight countries provide new evidence on origin of the Booroola (FecB) mutation.

Authors:  George H Davis; Susan M Galloway; Ian K Ross; Scott M Gregan; Jamie Ward; Bon V Nimbkar; Pradip M Ghalsasi; Chanda Nimbkar; G Douglas Gray; Ismeth Inounu; Bess Tiesnamurti; Elzbieta Martyniuk; Emma Eythorsdottir; Philippe Mulsant; Frederic Lecerf; James P Hanrahan; G Eric Bradford; Theresa Wilson
Journal:  Biol Reprod       Date:  2002-06       Impact factor: 4.285

Review 3.  Molecular biology of the pituitary gonadotropins.

Authors:  S D Gharib; M E Wierman; M A Shupnik; W W Chin
Journal:  Endocr Rev       Date:  1990-02       Impact factor: 19.871

4.  The Booroola (FecB) phenotype is associated with a mutation in the bone morphogenetic receptor type 1 B (BMPR1B) gene.

Authors:  C J Souza; C MacDougall; C MacDougall; B K Campbell; A S McNeilly; D T Baird
Journal:  J Endocrinol       Date:  2001-05       Impact factor: 4.286

5.  The testicular receptor for follicle stimulating hormone: structure and functional expression of cloned cDNA.

Authors:  R Sprengel; T Braun; K Nikolics; D L Segaloff; P H Seeburg
Journal:  Mol Endocrinol       Date:  1990-04

6.  Mutations in an oocyte-derived growth factor gene (BMP15) cause increased ovulation rate and infertility in a dosage-sensitive manner.

Authors:  S M Galloway; K P McNatty; L M Cambridge; M P Laitinen; J L Juengel; T S Jokiranta; R J McLaren; K Luiro; K G Dodds; G W Montgomery; A E Beattie; G H Davis; O Ritvos
Journal:  Nat Genet       Date:  2000-07       Impact factor: 38.330

7.  FSH receptor-specific residues L501 and I505 in extracellular loop 2 are essential for its function.

Authors:  Antara A Banerjee; Madhavi Dupakuntla; Bhakti R Pathak; Smita D Mahale
Journal:  J Mol Endocrinol       Date:  2015-03-19       Impact factor: 5.098

Review 8.  The oocyte and its role in regulating ovulation rate: a new paradigm in reproductive biology.

Authors:  K P McNatty; L G Moore; N L Hudson; L D Quirke; S B Lawrence; K Reader; J P Hanrahan; P Smith; N P Groome; M Laitinen; O Ritvos; J L Juengel
Journal:  Reproduction       Date:  2004-10       Impact factor: 3.906

Review 9.  The bone morphogenetic protein system in mammalian reproduction.

Authors:  Shunichi Shimasaki; R Kelly Moore; Fumio Otsuka; Gregory F Erickson
Journal:  Endocr Rev       Date:  2004-02       Impact factor: 19.871

10.  Mutations in the genes for oocyte-derived growth factors GDF9 and BMP15 are associated with both increased ovulation rate and sterility in Cambridge and Belclare sheep (Ovis aries).

Authors:  James P Hanrahan; Scott M Gregan; Philippe Mulsant; Michael Mullen; George H Davis; Richard Powell; Susan M Galloway
Journal:  Biol Reprod       Date:  2003-11-19       Impact factor: 4.285

View more
  12 in total

1.  Association and expression analyses of the Ucp2 and Ucp3 gene polymorphisms with body measurement and meat quality traits in Qinchuan cattle.

Authors:  Yaning Wang; Wucai Yang; Linsheng Gui; Hongbao Wang; Linsen Zan
Journal:  J Genet       Date:  2016-12       Impact factor: 1.166

2.  An ancient positively selected BMPRIB missense variant increases litter size of Mongolian sheep populations following latitudinal gradient.

Authors:  Yuqing Chong; Xunping Jiang; Guiqiong Liu
Journal:  Mol Genet Genomics       Date:  2022-01-11       Impact factor: 3.291

3.  Are Copy Number Variations within the FecB Gene Significantly Associated with Morphometric Traits in Goats?

Authors:  Yi Bi; Zhiying Wang; Qian Wang; Hongfei Liu; Zhengang Guo; Chuanying Pan; Hong Chen; Haijing Zhu; Lian Wu; Xianyong Lan
Journal:  Animals (Basel)       Date:  2022-06-15       Impact factor: 3.231

4.  Genome-wide differential expression profiling of mRNAs and lncRNAs associated with prolificacy in Hu sheep.

Authors:  Xu Feng; Fengzhe Li; Feng Wang; Guomin Zhang; Jing Pang; Caifang Ren; Tingting Zhang; Hua Yang; Ziyu Wang; Yanli Zhang
Journal:  Biosci Rep       Date:  2018-04-27       Impact factor: 3.840

5.  Molecular Characterization and Expression Profiles of the Ovine LHβ Gene and Its Association with Litter Size in Chinese Indigenous Small-Tailed Han Sheep.

Authors:  Weimin Wang; Yongfu La; Fadi Li; Shijia Liu; Xiangyu Pan; Chong Li; Xiaoxue Zhang
Journal:  Animals (Basel)       Date:  2020-03-10       Impact factor: 2.752

6.  Pituitary Transcriptomic Study Reveals the Differential Regulation of lncRNAs and mRNAs Related to Prolificacy in Different FecB Genotyping Sheep.

Authors:  Jian Zheng; Zhibo Wang; Hua Yang; Xiaolei Yao; Pengcheng Yang; CaiFang Ren; Feng Wang; YanLi Zhang
Journal:  Genes (Basel)       Date:  2019-02-18       Impact factor: 4.096

7.  Luzhong mutton sheep: inbreeding and selection signatures.

Authors:  Lin Tao; Xiaoyun He; Fengyan Wang; Yingjie Zhong; Linxiang Pan; Xiangyu Wang; Shangquan Gan; Ran Di; Mingxing Chu
Journal:  J Anim Sci Technol       Date:  2020-11-30

8.  Detection of Selection Signatures on the X Chromosome in Three Sheep Breeds.

Authors:  Caiye Zhu; Hongying Fan; Zehu Yuan; Shijin Hu; Li Zhang; Caihong Wei; Qin Zhang; Fuping Zhao; Lixin Du
Journal:  Int J Mol Sci       Date:  2015-08-28       Impact factor: 5.923

9.  Genetic polymorphisms of fecundity genes in Watish Sudanese desert sheep.

Authors:  Sara E Ibrahim Mohamed; Romaz M Ahmed; Khaleel I Z Jawasreh; M A M Salih; Dalia Mursi Abdelhalim; A W Abdelgadir; Md T Obeidat; L M A Musa; Mohammed-Khair A Ahmed
Journal:  Vet World       Date:  2020-04-05

10.  Detection of Novel Variations Related to Litter Size in BMP15 Gene of Luzhong Mutton Sheep (Ovis aries).

Authors:  Ran Di; Fengyan Wang; Ping Yu; Xiangyu Wang; Xiaoyun He; Joram Mwashigadi Mwacharo; Linxiang Pan; Mingxing Chu
Journal:  Animals (Basel)       Date:  2021-12-10       Impact factor: 2.752

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.