Literature DB >> 25986488

Protective role of p120-catenin in maintaining the integrity of adherens and tight junctions in ventilator-induced lung injury.

Changping Gu1, Mengjie Liu2, Tao Zhao3, Dong Wang4, Yuelan Wang5.   

Abstract

BACKGROUND: Ventilator-induced lung injury (VILI) is one of the most common complications for patients with acute lung injury (ALI) or acute respiratory distress syndrome (ARDS). Although p120 is an important protein in the regulation of cell junctions, further mechanisms should be explored for prevention and treatment of VILI.
METHODS: Mouse lung epithelial cells (MLE-12), which were transfected with p120 small interfering (si)RNA, p120 cDNA, wild-type E-cadherin juxtamembrane domain or a K83R mutant juxtamembrane domain (K83R-JMD), were subjected to 20% cyclic stretches for 2 or 4 h. Furthermore, MLE-12 cells and mice, which were pretreated with the c-Src inhibitor PP2 or RhoA inhibitor Y27632, underwent 20% cyclic stretches or mechanical stretching, respectively. Moreover, wild-type C57BL/6 mice were transfected with p120 siRNA-liposome complexes before mechanical ventilation. Cell lysates and lung tissues were then analyzed to detect lung injury.
RESULTS: cyclic stretches of 20% actived c-Src, which induced degradation of E-cadherin, p120 and occludin. However, loss of p120 increased the degradation and endocytosis of E-cadherin. Immunoprecipitation and Immunofluorescence results showed a decrease in the association between p120 and E-cadherin, while gap formation increased in p120 siRNA and K83R-JMD groups after 20% cyclic stretches. Loss of p120 also reduced the occludin level and decreased the association of occludin and ZO-1 by enhancing RhoA activity. However, the altered levels of occludin and E-cadherin were reversed by PP2 or Y27632 treatments compared with the cyclic stretch group. Consistently, the expression, redistribution and disassociation of junction proteins were all restored in the p120 overexpression group after 20% cyclic stretches. Moreover, the role of p120 in VILI was confirmed by increased wet/dry weigh ratio and enhanced production of cytokines (tumor necrosis factor-α and interleukin-six) in p120-depleted mice under mechanical ventilation.
CONCLUSIONS: p120 protected against VILI by regulating both adherens and tight junctions. p120 inhibited E-cadherin endocytosis by increasing the association between p120 and juxtamembrane domain of E-cadherin. Furthermore, p120 reduced the degradation of occludin by inhibiting RhoA activity. These findings illustrated further mechanisms of p120 in the prevention of VILI, especially for patients with ALI or ARDS.

Entities:  

Mesh:

Substances:

Year:  2015        PMID: 25986488      PMCID: PMC4489357          DOI: 10.1186/s12931-015-0217-3

Source DB:  PubMed          Journal:  Respir Res        ISSN: 1465-9921


Background

Mechanical ventilation is an indispensable therapy for patients with acute lung injury and acute respiratory distress syndrome. However, irregular mechanical stresses and strains can easily cause airway and alveolar damage, known as ventilator-induced lung injury (VILI). Moreover, VILI is one of the most significant complications for patients with mechanical ventilation [1, 2]. VILI is mainly characterized by an increase in pulmonary vascular permeability and influx of inflammatory cells and cytokines [3]. The primary causes of the increase in alveolar membrane permeability are the destroyed alveolar membrane and the decreased expression of junction proteins. Pulmonary epithelial cells undergo biaxial stretching as the surface area of the basement membrane increases, which can affect the integrity of the alveolar membrane during mechanical ventilation. Mechanical stretching in the form of cyclic stretching induces structural and cytosolic changes in alveolar epithelial cells and finally causes alveolar epithelial barrier dysfunction and pulmonary hyperpermeability [4-7]. And the disruption of intercellular junctions, which is caused by the decreases in junction protein is a major factor of the increase of epithelial permeability. Adherens and tight junction are important components to maintain the integrity of the epithelial barrier. Adherens junctions depend on the associations of p120, E-cadherin, β-catenin and α-catenin, which act as transducers, mediating the transduction of shear-stress signals into vascular endothelial cells [7]. Previous studies have revealed that p120 is a key factor in the prevention of VILI. p120 binds to E-cadherin and contributes to the integrity of cell-cell junctions in endothelial cells [8]. In addition, down-regulation of p120 disrupts the integrity of the alveolar epithelial barrier. Tight junction proteins including occludin, ZO-1 and claudins are also affected during cyclic stretching [7, 9]. A previously study showed that intracellular protein kinases, such as protein kinase C (PKC) and c-Src, phosphorylated or dephosphorylated occludin, which contributed to the degradation or synthesis of tight junction proteins [10]. Moreover, in our previously study, activation of PKC was found to reduce the expression of occludin in a rat VILI model [11]. Therefore, both adherens and tight junctions play an indispensable role in maintaining the integrity of the epithelial barrier. However, the mechanisms of p120 in regulation of cell junctions need further exploration. In present study, we found that cyclic stretches induced c-Src activation leading to p120 degradation and disassociation from the juxtamembrane domain (JMD) of E-cadherin. Furthermore, p120 degradation activated RhoA, which reduced the association of occludin and ZO-1. Therefore, we revealed that p120 might play an important role in regulation of adherens and tight junctions in VILI. These findings shed more lights on the importance of p120 in the treatment and prevention of VILI.

Methods

Cell culture and cyclic stretching

Mouse lung epithelial cells (MLE-12) were obtained from the American Type Culture Collection (Manassas, VA). The cells were seeded at a density of 8 × 105 cells/well on collagen I-coated flexible bottom BioFlex plates in Dulbecco’s modified Eagle’s medium with 10 % fetal bovine serum and cultured. Confluent MLE-12 monolayers were serum starved for 2 h, and then the c-Src inhibitor PP2 (100 μmol/L) or RhoA inhibitor Y27632 (20 μM) were added to the medium at 30 min prior to cyclic stretches. Alveolar epithelial cell monolayers on flexible membranes were mounted for cyclic stretching using the FX-4000 T Flexercell Tension Plus system (Flexcell International, McKeesport, PA). Cyclic stretches were conducted with a 20 % change in the basement surface area at a frequency of 30 cycles/min (0.5 Hz) and a stretch-to-relaxation ratio of 1:1 applied in a cyclic manner [7]. The flexible cell-covered elastomer membranes were stretched by applying an oscillating vacuum to the underside of the membranes. The duration, amplitude, and frequency of the applied stretches were controlled by a computer. Non-stretched cells were used as the control group.

p120 knockdown and overexpression in MLE-12 cells

p120 small interfering (si)RNA, which was a pool of three target-specific 20–25 nt siRNAs, scrambled (sc)siRNA, p120 1A cDNA, or the empty vector were transfected into 70 % confluent MLE-12 cells according to the instructions of Lipofectamine 2000 transfection regent. All experiments were conducted after 48 h and successful transfection was determined by western blot analysis.

cDNA constructs and transfections

The JMD fragment (91 amino acids) of E-cadherin was generated according to the protocol by Hartsock et al. [8]. The wild-type JMD (WT-JMD) was obtained by subcloning the mouse E-cadherin JMD from the cytoplasmic domain of E-cadherin using EcoRI at the 3′end and BamHI at the 5′end (forward primer: GGGAATTCCGCCACCATGCGGTACCTCAGAAC; reverse primer: CCGGATCCCCTCCTCCTGCCGTGGGGTCG). A Stratagene QuikChange® Site-Directed mutagenesis kit (Stratagene cloning system, LA, USA) was used to produce a JMD mutation. The reverse primer was the reverse compliment of the forward primer K83R: GATGAAAACCTGAGG-GCAGCC-GA-CAGCGACCCC. The mutation was examined by DNA sequencing. WT-JMD and the Flag-tagged K83R mutant JMD (Flag-K83R-JMD) were then transfected into MLE-12 cells. MLE-12 cells were cultured until 70 % confluence. WT-JMD or Flag-K83R-JMD plasmids were then transfected into the cells using Lipofectamine 2000 cDNA transfection regent. All experiments were conducted after 36 h, and successful transfection was verified by western blot analysis.

GST pull down assay for activated Rho GTPases

GST pull-down assays were performed according to a previous study [12]. The cDNAs of the Rho-binding domain of rhotekin (RBD) and GTPase-binding domain of p21-activated kinase-1 (PBD) were cloned into a pGEX4T-1 plasmid. The GST fusion proteins in bacteria were purified using glutathione-sepharose beads. After treatment with Y27632 or cyclic stretching, a total of 2 × 106 MLE-12 cells cultured in 100 mm dishes were washed with ice-cold PBS and harvested. The cells were lysed using lysis buffer [50 mM Tris-HCl, pH 7.2, 1 % Triton X-100, 0.1 % SDS, 0.5 % sodium deoxycholate, 500 mM NaCl, 10 mM MgCl2, 5 μg/ml each of leupeptin and aprotinin, and 1 mM phenylmethylsulfonyl fluoride (PMSF)]. After 30 min, the lysates were centrifuged at 15,000 × g for 15 min at 4 °C. The supernatant were added to GST-RBD or GST-PBD which have been incubated with 50 μg of GST fusion proteins for 1 h. The beads were washed and bound proteins were subjected to sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE). Total RhoA and GTP-RhoA were determined as described previously [12, 13]

Immunofluorescence staining

At the end of stretching, MLE-12 cells were fixed with 4 % paraformaldehyde and permeabilized with 0.2 % Triton X-100 for 10 min. Then, the cells were blocked with 5 % bovine serum albumin and incubated with anti-p120 (1:300) and anti-E-cadherin (1:300) antibodies overnight at 4 °C. Subsequently, the cells were incubated with appropriate Alexa Fluor-labeled secondary antibodies for 1 h at room temperature. For the negative control, cells were incubated with normal IgG. Actin filaments were stained with Texas red-conjugated phalloidin (1:40). Cell nuclei were stained with 4′, 6-diamidino-2-phenyl indole dihydrochloride (DAPI, 2 μg/ml) for 20 min, and then the cells were rinsed three times. Finally, the Flex membranes were excised with a razorblade and mounted on glass slides with ProLong Antifade Mountain Medium (Molecular Probes). The co-localization of junction proteins and the cell gap was imaged with a laser scanning confocal microscope (Zeiss LSM 510 META, Carl Zeiss, Germany). Paracellular gaps were marked out and images were segmented between gaps and cells according to the grayscale levels of the image. 5 × 60 fields for each independent experiment were analyzed in different areas (both central and peripheral) of the total field. ImageJ software (http://rsb.info.nih.gov/ij National Institutes of Health, Bethesda, MD) was used to quantify the gap formation. Epithelial monolayers of the confocal images indicated the average value of the surface area of the silastic membrane. Therefore, the monolayer could be used to demonstrate the effects of cyclic stretching on interepithelial gap formation. The gap formation was expressed as the ratio of the gap area to the area of the whole image [7].

Western blot and immunoprecipitation

Western blot analysis of cell lysates and lung tissues was performed as described previously [7, 14, 15]. Briefly, MLE-12 cells and lung tissues were lysed on ice in RIPA buffer containing 1 mM protease inhibitor, 1 mM sodium orthovanadate and 1 mM PMSF. After sonication, the protein concentration in the supernatants was measured using a bicinchoninic acid protein assay kit (Pierce, Rockford, IL). Equal amounts of protein were loaded for 10 % SDS-PAGE, and then the proteins were transferred to polyvinylidene fluoride membranes. The membranes were blocked in 5 % non-fat dry milk in TBS containing 0.1 % Tween-20 (pH 8.8) for 1 h at room temperature. Then, primary antibodies were added to the membranes, followed by incubation overnight at 4 °C. After washing with TBST, the membranes were finally incubated with the appropriate secondary antibody for 1 h at room temperature. Protein bands were detected with ECL SuperSignal reagent (Pierce). Relative band densities of the various proteins were analyzed using ImageJ Software. Immunoprecipitation was performed. MLE-12 cell lysates were obtained. After centrifugation, the supernatants were precleared by incubation with 1 mg normal IgG and protein A/G PLUS-agarose beads for 30 min, and then the supernatant was incubated on a shaker overnight with anti-E-cadherin, anti-p120 or anti-occludin antibodies together with 20 μl protein A/G PLUS-agarose beads. The final immunoprecipitates were dissolved in 20 μl SDS-PAGE sample buffer for immunoblot analysis.

Animals

Animal experiments were approved by the Animal Ethics Committee of Shandong University. 40 wild-type male C57BL/6 mice (25–30 g) were obtained from the Animal Care and Use Committee of Shandong University. Mice were housed under specific pathogen-free conditions and used in experiments at 8–12 weeks of age.

Liposome preparation and in vivo gene delivery

To deplete p120 in vivo, we used liposome-based vectors for the purpose of systemic and targeted delivery of p120 siRNA through retinal vein plexus injection [16]. Briefly, liposomes consisting of dimethyl dioctadecyl ammonium bromide and cholesterol (1:1 M ratio) were dried using a Rotavaporator (Brinkman, Westbury, NY), dissolved in 5 % glucose, and sonicated. Each animal received 150 μl siRNA-liposome complexes consisting of 50 μl p120 siRNA (50 nM) and 100 μl sonicated liposomes through retinal vein plexus injection. After 48 h, mouse lungs were obtained to detect the transfection efficiency. Successful transfection of p120 siRNA was confirmed by western blot analysis of lung homogenates. All mice appeared normal from the time of injection until sacrifice in every experiment [17].

Experimental protocols

In some experiments, animals were pretreated with the c-Src inhibitor PP2 (2 μg/kg, intravenous) dissolved in DMSO or the RhoA inhibitor Y27632 (2 mg/kg, intravenous) at 1 h before exposure to mechanical ventilation. In addition, liposome-based vectors were used to deplete p120 in vivo. 2 days later, we established the VILI model that has been described in previous studies [14, 15, 18]. C57BL/6 mice were anesthetized by intraperitoneal injection of a 75 mg/kg ketamine. Then, the mice were tracheotomized and treated with various models of mechanical ventilation. Mice without ventilation were used as the control group. For the high tidal volume group, the tidal volume was 28 ml/kg with a frequency of 60 breaths/min. All experiments were conducted on a heating lamp to maintain the temperature at 37 °C. After 4 h of mechanical ventilation, the mice were euthanized and lung injury was assessed by analysis of cytokines in bronchoalveolar lavage (BAL) fluid, the wet/dry (W/D) ratio, and the p120 level in lung tissue.

Wet/dry weight ratio

The lung W/D weight ratio was determined to quantify pulmonary edema. One lobe of the right lung tissue was obtained after mechanical ventilation. Blood and water were removed from the lung surface. The lung tissues were weighed and then dried in an oven to a constant weight (60 °C for 72 h). Finally, we measured the dry weight and calculated the W/D ratio.

Cytokine assays

Levels of tumor necrosis factor-α (TNF-α) and interleukin-6 (IL-6) in BAL fluid were detected using commercial enzyme-linked immunosorbent assay (ELISA) kits (R&D System, MN, USA) according to the manufacturer’s instructions [14]. Each value represents the means of triplicate determinations.

Drugs, reagents and antibodies

p120 siRNA was purchased from Dharmacon. Stratagene QuikChange® Site-Directed mutagenesis kit was from Stratagene cloning system. PP2 and Y27632 were obtained from Sigma-Aldrich. All antibodies and normal IgG were from Santa Cruz Biotechnology. The transfection regents, DAPI, Alexa Fluor-labeled secondary antibodies and Alexa Fluor 546-phalloidin were purchased from Invitrogen.

Statistical analysis

One-way analysis of variance (ANOVA) with a post-hoc Turkey’s pairwise comparison was used for statistical analysis among groups. The Student’s t-test was performed for paired samples. Parameter changes between groups overtime were evaluated by two-way ANOVA with repeated measures. All results are expressed as the mean ± standard error of the mean. P < 0.05 was considered statistically significant.

Results

Cyclic stretching affects junction proteins and increases intercellular gap formation

Initially, we detected the expression and distribution of junction proteins including adherens and tight junction proteins. Western blotting showed that 20 % cyclic stretches for 2 h induced degradation of E-cadherin, p120 and occludin. After exposure of epithelial cells to 20 % cyclic stretches for 4 h, all protein levels were decreased by 60 % (Fig. 1a), which is similar to a previous study [7]. Consistently, 20 % cyclic stretches induced E-cadherin endocytosis. The expression of E-cadherin was decreased in the cell membrane but increased in the cytoplasm after cyclic stretching (Fig. 1b).
Fig. 1

Effects of cyclic stretch on adherens junction and tight junction proteins. MLE-12 cell monolayers on Flex cell plates were subjected to 20 % cyclic stretches for 2 or 4 h. (a) Western blot showed p120, E-cadherin and occludin decreased after cyclic stretch. (b) Membrane and cytoplasm protein were extracted. The expression of E-cadherin in membrane and cytoplasm were determined by western blot. Cyclic stretch could induce E-cadherin endocytosis. (c) Immunofluorescence staining and quantification data showed the binding of p120 and E-cadherin under cyclic stretch. MLE-12 cells were fixed and stained with anti-p120 and anti-E-cadherin followed by Alexa-conjugated secondary antibody. (d) Actin cytoskeletal remodeling was determined by immunofluorescent staining with Texas red-conjugated phalloidin (red). Intercellular gaps induced by cyclic stretch were marked by arrows. The nucleus (blue) was stained with 4′, 6-diamidino-2-phenyl indole dihydrochloride (DAPI). Scale bars = 10 μm. *p < 0.05 versus control group, +p < 0.05 versus CS 2 h group. Experiments were repeated at least three times

Effects of cyclic stretch on adherens junction and tight junction proteins. MLE-12 cell monolayers on Flex cell plates were subjected to 20 % cyclic stretches for 2 or 4 h. (a) Western blot showed p120, E-cadherin and occludin decreased after cyclic stretch. (b) Membrane and cytoplasm protein were extracted. The expression of E-cadherin in membrane and cytoplasm were determined by western blot. Cyclic stretch could induce E-cadherin endocytosis. (c) Immunofluorescence staining and quantification data showed the binding of p120 and E-cadherin under cyclic stretch. MLE-12 cells were fixed and stained with anti-p120 and anti-E-cadherin followed by Alexa-conjugated secondary antibody. (d) Actin cytoskeletal remodeling was determined by immunofluorescent staining with Texas red-conjugated phalloidin (red). Intercellular gaps induced by cyclic stretch were marked by arrows. The nucleus (blue) was stained with 4′, 6-diamidino-2-phenyl indole dihydrochloride (DAPI). Scale bars = 10 μm. *p < 0.05 versus control group, +p < 0.05 versus CS 2 h group. Experiments were repeated at least three times Immunofluorescence showed the effect of cyclic stretching on the association of p120 and E-cadherin as well as the epithelial monolayer integrity. Cyclic stretches at 20 % reduced the co-localization of p120 and E-cadherin (Fig. 1c), which increased intercellular gap formation (Fig. 1d). In addition, all of these responses were dramatically enhanced after 20 % cyclic stretches for 4 h. Quantitative analysis of the co-localization of junction proteins and stretch-induced gap formation suggested that the total gap area after 4 h of cyclic stretches was increased significantly compared with the control group, which was consistent with previous study [7].

p120 induces E-cadherin endocytosis and epithelial gap formation after cyclic stretching

To explore the role of p120 in cyclic stretch-induced epithelial barrier dysfunction, we depleted p120 in MLE-12 cells by transfection of p120 siRNA. At 48 h post-transfection, western blot analysis revealed that p120 decreased in the p120 siRNA group and increased in the p120 cDNA group compared with the control group (Fig. 2a). The total level of E-cadherin was decreased in the p120 siRNA group compared with the control group, and this effect was enhanced after 2 h of 20 % cyclic stretches in the p120 siRNA group (Fig. 2b). Therefore, we detected E-cadherin in the cell membrane and cytoplasm after cyclic stretching in control and p120 siRNA groups. The results showed that the level of E-cadherin decreased in the cell membrane but increased in the cytoplasm after cyclic stretching, which was enhanced in the p120 siRNA group under 20 % cyclic stretches (Fig. 2c). Conversely, E-cadherin degradation and E-cadherin endocytosis were rescued in the p120 overexpression group after 20 % cyclic stretches (Fig. 2d, f). In addition, the association between p120 and E-cadherin was increased in the p120 overexpression group under 20 % cyclic stretches (Fig. 2e). Immunofluorescence suggested that p120 knockdown cells applied to 20 % cyclic stretches showed a significant increase in gap formation, but the cell gaps were restored in the p120 overexpression group (Fig. 2h). All of these results indicated that p120 regulated the integrity of the epithelial monolayer through E-cadherin endocytosis.
Fig. 2

The regulating effects of p120 in E-cadherin endocytosis and epithelial gap formation. MLE-12 cells were transfected with p120 siRNA or p120 cDNA. After 48 h posttransfection, cells were exposed to 20 % cyclic stretches for 2 h. (a) Successful transfection was detected by western blot. (b, d) The effect of p120 siRNA and p120 cDNA transfection on E-cadherin degradation. Loss of p120 could significantly decrease the expression of E-cadherin. However, p120 overexpression reversed E-cadherin degradation. (c, f) Cytoplasm E-cadherin increased after p120 depletion while it was restored by p120 overexpression under cyclic stretch. (e) The association of p120 and E-cadherin was examined by immunoprecipitation after 2 h cyclic stretch in p120 cDNA transfection group. (g) Immunofluorescence and quantification data revealed the association of p120 and E-cadherin after stretch in p120 siRNA group and p120 cDNA group. Fixed Cells were incubated with anti-p120 and anti-E-cadherin primary antibody followed by Alexa-conjugated secondary antibody. (h) Immunofluorescence showed the gap formation in p120 siRNA group and p120 cDNA group. The F-actin was stained with Alexa 546 phalloidin (red). The nucleus were stained with DAPI (blue). Scale bars = 10 μm. *p < 0.05 versus control group, +p < 0.05 versus CS group. Experiments were repeated at least three times

The regulating effects of p120 in E-cadherin endocytosis and epithelial gap formation. MLE-12 cells were transfected with p120 siRNA or p120 cDNA. After 48 h posttransfection, cells were exposed to 20 % cyclic stretches for 2 h. (a) Successful transfection was detected by western blot. (b, d) The effect of p120 siRNA and p120 cDNA transfection on E-cadherin degradation. Loss of p120 could significantly decrease the expression of E-cadherin. However, p120 overexpression reversed E-cadherin degradation. (c, f) Cytoplasm E-cadherin increased after p120 depletion while it was restored by p120 overexpression under cyclic stretch. (e) The association of p120 and E-cadherin was examined by immunoprecipitation after 2 h cyclic stretch in p120 cDNA transfection group. (g) Immunofluorescence and quantification data revealed the association of p120 and E-cadherin after stretch in p120 siRNA group and p120 cDNA group. Fixed Cells were incubated with anti-p120 and anti-E-cadherin primary antibody followed by Alexa-conjugated secondary antibody. (h) Immunofluorescence showed the gap formation in p120 siRNA group and p120 cDNA group. The F-actin was stained with Alexa 546 phalloidin (red). The nucleus were stained with DAPI (blue). Scale bars = 10 μm. *p < 0.05 versus control group, +p < 0.05 versus CS group. Experiments were repeated at least three times

K83R-JMD abolishes the role of p120 in the regulation of E-cadherin endocytosis

To further determine the mechanism of p120 in the regulation of E-cadherin endocytosis, we constructed expression vectors for the E-cadherin WT-JMD and flag-K83R-JMD (Fig. 3a) and transfected them into MLE-12 cells before 20 % cyclic stretches. Successful transfection of flag-K83R-JMD was determined by western blotting (Fig. 3b). Immunoprecipitation revealed that the binding between p120 and E-cadherin was abolished in the K83R-JMD group compared with the WT-JMD group (Fig. 3c). Immunofluorescence also demonstrated a decrease in the association between p120 and E-cadherin in cyclic stretch and K83R-JMD groups, which was enhanced after 20 % cyclic stretches in K83R-JMD group (Fig. 3d).
Fig. 3

The relation between p120 and JMD domain contributed to the endocytosis of E-cadherin. MLE-12 cells were transfected with WT-JMD or flag-K83R-JMD using lipofectamine 2000. (a) Mouse E-cadherin JMD sequence and the mutant JMD sequence. (b) Successful transfection of flag-K83R-JMD was determined by western blot. (c) The association of p120 and E-cadherin in the JMD mutant transfection group. K83R mutant abolished E-cadherin JMD/p120 binding. (d) MLE-12 cells were transfected with WT-JMD or K83R-JMD. And the E-cadherin JMD/120 binding was determined by immunofluorescence. The nucleus were stained with DAPI (blue). Scale bars = 10 μm. *p < 0.05 versus control group, +p < 0.05 versus CS group. Experiments were repeated at least three times

The relation between p120 and JMD domain contributed to the endocytosis of E-cadherin. MLE-12 cells were transfected with WT-JMD or flag-K83R-JMD using lipofectamine 2000. (a) Mouse E-cadherin JMD sequence and the mutant JMD sequence. (b) Successful transfection of flag-K83R-JMD was determined by western blot. (c) The association of p120 and E-cadherin in the JMD mutant transfection group. K83R mutant abolished E-cadherin JMD/p120 binding. (d) MLE-12 cells were transfected with WT-JMD or K83R-JMD. And the E-cadherin JMD/120 binding was determined by immunofluorescence. The nucleus were stained with DAPI (blue). Scale bars = 10 μm. *p < 0.05 versus control group, +p < 0.05 versus CS group. Experiments were repeated at least three times

Effects of c-Src and RhoA activation on cyclic stretch-induced epithelial gap formation

Previous studies [12, 13] have shown that cyclic stretching activates c-Src and RhoA, and induces p120 degradation. To confirm the effects of c-Src and RhoA on other junction proteins during cyclic stretching, we treated MLE-12 cells with the c-Src inhibitor PP2 (100 μmol/L) or RhoA inhibitor Y27632 (20 μM) and detected the expression of junction proteins under 20 % cyclic stretches for 2 h. The levels of phosphorylated c-Src (Tyr535) and c-Src, and the activity of RhoA were detected by western blotting and pull-down assays respectively (Fig. 4a, b). Expression of E-cadherin and occludin was decreased after cyclic stretching, which was reversed by PP2 or Y27632 treatments (Fig. 4c). Consistently, immunofluorescence showed that cyclic stretch-induced epithelial gap formation was restored in PP2 and Y27632 treatment groups (Fig. 4d). Moreover, the quantification data showed a significant difference in PP2 and Y27632 treatment groups compared with the cyclic stretch group.
Fig. 4

The effects of c-Src inhibitor PP2 and RhoA inhibitor Y27632 on epithelia gap formation. MLE-12 cells were pretreated with PP2 (100 μmol/L) or Y27632 (20 μM) for 30 min before cyclic stretching. (a, b) The effects of PP2 or Y27632 on the activation of c-Src or RhoA. (c) The expression of adherens junction and tight junction proteins after PP2 or Y27632 treatment. (d) The epithelial gap formation determined by immunofluorescence and quantification data for the gap formation. Scale bars = 10 μm. *p < 0.05 versus control group, +p < 0.05 versus CS group, #p < 0.05 versus DMSO + CS group. Experiments were repeated at least three times

The effects of c-Src inhibitor PP2 and RhoA inhibitor Y27632 on epithelia gap formation. MLE-12 cells were pretreated with PP2 (100 μmol/L) or Y27632 (20 μM) for 30 min before cyclic stretching. (a, b) The effects of PP2 or Y27632 on the activation of c-Src or RhoA. (c) The expression of adherens junction and tight junction proteins after PP2 or Y27632 treatment. (d) The epithelial gap formation determined by immunofluorescence and quantification data for the gap formation. Scale bars = 10 μm. *p < 0.05 versus control group, +p < 0.05 versus CS group, #p < 0.05 versus DMSO + CS group. Experiments were repeated at least three times

p120 regulates tight junction proteins by inhibiting RhoA activation after cyclic stretching

Cyclic stretching affects not only adherens junctions, but also tight junctions. We found that p120 restored the disrupted tight junctions induced by cyclic stretching. To gain a deeper insight into the role of p120 in protection of tight junctions, we detected the levels of occludin and its association with ZO-1 after transfection of p120 siRNA or cDNA. Western blotting revealed a significant decrease in the level of occludin by p120 knockdown, which was reversed in the p120 overexpression group under 20 % cyclic stretches (Fig. 5a, b). In addition, immunoprecipitation showed that occludin disassociated from ZO-1 under 20 % cyclic stretches in a time-dependent manner (Fig. 5c). Moreover, their association was significantly decreased in the p120 siRNA group but increased in the p120 overexpression group after cyclic stretching (Fig. 5d, e).
Fig. 5

The regulation role of p120 on the RhoA activation induced tight junction dysfunction. MLE-12 cells were transfected with p120 siRNA, p120 cDNA or pretreated with Y27632 before 20 % cyclic stretches. (a, b) The level of occludin and p120 were detected by western blot in p120 siRNA or cDNA transfected group after cyclic stretch. (c) The effects of cyclic stretch on the association of occludin and ZO-1. (d, e) The association of occludin and ZO-1 was detected by immunoprecipitation in p120 siRNA or cDNA transfected group after cyclic stretch. (f, g) The activity of RhoA was examined by pull down assay in p120 siRNA group or p120 cDNA group. *p < 0.05 versus control group, +p < 0.05 versus CS group. Experiments were repeated at least three times

The regulation role of p120 on the RhoA activation induced tight junction dysfunction. MLE-12 cells were transfected with p120 siRNA, p120 cDNA or pretreated with Y27632 before 20 % cyclic stretches. (a, b) The level of occludin and p120 were detected by western blot in p120 siRNA or cDNA transfected group after cyclic stretch. (c) The effects of cyclic stretch on the association of occludin and ZO-1. (d, e) The association of occludin and ZO-1 was detected by immunoprecipitation in p120 siRNA or cDNA transfected group after cyclic stretch. (f, g) The activity of RhoA was examined by pull down assay in p120 siRNA group or p120 cDNA group. *p < 0.05 versus control group, +p < 0.05 versus CS group. Experiments were repeated at least three times To determine the relationship between p120 and RhoA, we used a pull-down assay to examine the activity of RhoA in p120 siRNA and cDNA groups. The results showed that the activity of RhoA was increased in the p120 siRNA group but decreased in the p120 overexpression group (Fig. 5f, g). Therefore, down-regulation of p120, which was induced by cyclic stretching, disrupted tight junction proteins through activation of RhoA.

Effects of p120, c-Src and RhoA in ventilator-induced lung injury

Based on the cyclic stretch data, we verified the mechanisms in vivo. Some mice were transfected with p120 siRNA or sc siRNA using liposomes. Successful transfection was examined by western blotting (Fig. 6a). In addition, RhoA activity was determined in the p120 siRNA-treated group. The results showed that RhoA activity was increased in the p120 siRNA-treated group, which was enhanced after mechanical ventilation (Fig. 6b). Some mice were pretreated with PP2 or Y27632 at 1 h before mechanical ventilation. After 2 h of ventilation, BAL fluid and lung tissues were obtained. Junction proteins in the lung tissues were detected by western blot analysis. Moreover, the cytokines in BAL fluid were examined by ELISA. As shown in Fig. 6c, both the adherens junction protein E-cadherin and tight junction protein occludin were decreased in the p120 siRNA-treated group, which was decreased further after high tidal volume ventilation. However, the c-Src inhibitor PP2 and RhoA inhibitor Y27632 restored the decrease in junction proteins induced by mechanical ventilation (Fig. 6d).
Fig. 6

The role of p120, PP2 and Y27632 in mechanical ventilator-induced lung injury in mice. Some mice were injected with the complex composed of liposome and p120 siRNA through retinal vein plexus to delete p120. Some mice were pretreated with PP2 (2 μg/kg) or Y27632 (2 mg/kg) for 1 h before exposure to high tidal volume mechanical ventilation (MV) for 2 h. Mice without ventilation was regarded as control group. (a) Successful transfection of p120 siRNA was confirmed by western blot of lung homogenates in mice. (b) RhoA activity in p120 knockout group (KO). (c) Effects of p120 depletion on the junction proteins. Loss of p120 could cause the degradation of E-cadherin, occludin. (d) Effects of pretreatment with PP2 or Y27632 on junction proteins in mice lung tissue after mechanical ventilation. (e, h) Lung W/D ratio. (f, i) IL-6 level in BAL fluid. (g, j) TNF-α level in BAL fluid. Quantitative analysis: *p < 0.05 versus control group, +p < 0.05 versus MV group. #p < 0.05 versus p120 KO (knockout) and MV group. Experiments were repeated at least three times

The role of p120, PP2 and Y27632 in mechanical ventilator-induced lung injury in mice. Some mice were injected with the complex composed of liposome and p120 siRNA through retinal vein plexus to delete p120. Some mice were pretreated with PP2 (2 μg/kg) or Y27632 (2 mg/kg) for 1 h before exposure to high tidal volume mechanical ventilation (MV) for 2 h. Mice without ventilation was regarded as control group. (a) Successful transfection of p120 siRNA was confirmed by western blot of lung homogenates in mice. (b) RhoA activity in p120 knockout group (KO). (c) Effects of p120 depletion on the junction proteins. Loss of p120 could cause the degradation of E-cadherin, occludin. (d) Effects of pretreatment with PP2 or Y27632 on junction proteins in mice lung tissue after mechanical ventilation. (e, h) Lung W/D ratio. (f, i) IL-6 level in BAL fluid. (g, j) TNF-α level in BAL fluid. Quantitative analysis: *p < 0.05 versus control group, +p < 0.05 versus MV group. #p < 0.05 versus p120 KO (knockout) and MV group. Experiments were repeated at least three times The W/D lung weight ratio was determined to quantify pulmonary edema. We found an increase in the W/D ratio of the high tidal volume ventilation group, which was similar to previous studies [14, 15]. In addition, the W/D ratio was increased in the p120-depleted group, which was enhanced after high tidal volume ventilation. However, the high W/D ratios in the mechanical ventilation and p120-depleted groups were all reduced by pretreatment with PP2 or Y27632, illustrating that c-Src and RhoA inhibitors alleviate pulmonary edema (Fig. 6e, h). Moreover, secretion of TNF-α and IL-6 into the BAL fluid was significantly increased in the mechanical ventilation and p120-depleted groups. These effects were enhanced in the p120-depleted group by high tidal volume ventilation. However, the cytokine production was reversed in the mechanical ventilation and p120-depleted groups by pretreatment with PP2 or Y27632 (Fig. 6f–g, i–j).

Discussion

VILI is characterized by destruction of the alveolar membrane barrier and an inflammatory response. Adherens and tight junctions are important structures to maintain the alveolar membrane barrier and the permeability of pulmonary epithelial cells. p120 is as a prototypic member of a growing subfamily of Armadillo-domain proteins, which contributes to cell conjunction unification, basement membrane integrity, and even more directly influences permeability, tissue and organ functions. In the present study, we identified a precise role of p120 in regulation of pulmonary edema that contributed to the molecular pathogenesis of VILI. Mechanical ventilation with a high tidal volume activated c-Src and reduced p120 expression in epithelial cells and lung tissue, followed by disruption of the association between p120 and the JMD of E-cadherin. In addition, activation of RhoA kinase induced disassociation of occludin and ZO-1. All of these changes induced by cyclic stretching resulted in epithelial gap formation and lung injury (Fig. 7). The results were further verified in MLE-12 cells and mice with depletion of p120. However, p120 overexpression and treatments with the c-Src inhibitor PP2 and RhoA inhibitor Y27632 restored the cell-cell junctions and reduced the mice lung inflammatory response caused by mechanical stretching.
Fig. 7

Mechanisms of p120 in regulating epithelial cell junctions

Mechanisms of p120 in regulating epithelial cell junctions One of the main findings of this study was that p120 played an essential role in maintaining the integrity of both adherens and tight junctions. This conclusion was based on the following findings. First, p120 played an essential role in protecting the integrity of adherens junctions. The disassociation of p120 and E-cadherin was the main factor in the induced dysfunction of adherens junctions under cyclic stretching. Our results showed that cyclic stretching reduced the expression of p120, which in turn induced endocytosis and degradation of E-cadherin (Fig. 1a, b). These results were similar to previous studies [7, 13, 16]. E-cadherin degradation induced by cyclic stretching is caused by the E3 ubiquitin ligase Hakai. Internalized E-cadherin can bind to Hakai and activates the ubiquitin mechanism [17, 18]. Then, E-cadherin is degraded. Moreover, the regulating role of p120 in E-cadherin endocytosis was supported by p120 siRNA and cDNA transfection experiments. Depletion of p120 by siRNA transfection increased the degradation and endocytosis of E-cadherin (Fig. 2b, c), whereas overexpression of p120 restored E-cadherin endocytosis and epithelial gap formation. These results were consistent with previous investigations where they demonstrated that depletion of p120 decreased the level of E-cadherin in tumor cells [18] and endothelial cells [16, 19]. Iyer et al. used various JMD lysine mutants to reveal that ubiquitination of the JMD or JMD lysine mutants inhibited p120 binding and targeted E-cadherin for degradation [16]. In addition, Hartsock et al. mutated the JMD at various sites including K5R and K83R to explore the degradation of E-cadherin and the relationship between E-cadherin and p120 in MDCK cells. They found that K83 was required for ubiquitination and proteasomal degradation of the JMD [8]. Therefore, the level of E-cadherin in K83R-JMD group had no difference compared with the level in WT-JMD group. To further characterize the relationship between p120 and E-cadherin in MLE-12 cells, we constructed E-cadherin WT-JMD and flag-K83R-JMD expression vectors and transfected these plasmids into MLE-12 cells. And K83R-JMD directly abolished the association of p120 and E-cadherin (Fig. 3c, d). Second, cyclic stretch-induced p120 degradation activated RhoA, which was the main reason for the degradation of occludin and disassociation of occludin and ZO-1. RhoA was the first member of the Rho subfamily and a key mediator of cytoskeletal dynamics. Previous studies have suggested that mechanical stretching regulated Rho activity in other cell types [1, 9, 10]. In addition, RhoA activity is increased in alveolar type II cells under high tidal volume mechanical ventilation. RhoA is regarded as an important regular of cadherin-mediated adhesion [20, 21]. Several studies have revealed the relationship between RhoA and p120, and suggest that p120 might be directly responsible for the activity of RhoA in adherens junction [21-23]. Moreover, Qin et al. found that p120 suppressed RhoA activity in N-cadherin complex recruitment of p190A Rho GTPase-activating protein in NIH3T3 cells [22]. Our results suggested that cyclic stretching caused p120 degradation and RhoA activation, leading to a decrease of occludin and its association with ZO-1. Occludin and ZO-1 are co-localized with a linear distribution at intercellular junctions [24]. However, tight junctions were disrupted by the disassociation of occludin and ZO-1 after 2 h of cyclic stretching. Therefore, our results indicate that p120 restores tight junctions through regulation of RhoA activity. Third, the role of p120 in protecting the integrity of various cell junctions was further analyzed by depletion or overexpression of p120 as well as applying inhibitors of c-Src and RhoA. The endocytosis and degradation of E-cadherin were enhanced after p120 depletion both in vitro and in vivo. Moreover, p120 knockdown significantly up-regulated the activity of RhoA and down-regulated the association of occludin and ZO-1 after 20 % cyclic stretches. In vivo, depletion of p120 increased the lung W/D ratio and production of cytokines (TNF-α and IL-6) in mice with high tidal volume ventilation. All of these changes induced damage of the epithelial monolayer as well as pulmonary edema. However, p120 overexpression reversed the dysfunction of cell junctions caused by the degradation of E-cadherin and occludin. Finally, the c-Src inhibitor PP2 and RhoA inhibitor Y27632 were used to verify the regulating role of p120 in cell junctions. Many studies have shown that p120 is a substrate of c-Src and can be phosphorylated and degraded [23, 25, 26]. Our findings showed that the degradation of p120 was associated with c-Src activation, which is consistent with previous studies [27, 28]. Moreover, PP2 reversed the degradation of E-cadherin and occludin, which was induced by the loss of p120. In addition, Y27632 inhibited occludin degradation and gap formation. The effects of PP2 and Y27632 were also confirmed in mice subjected to high tidal volume ventilation. Ventilation increased the lung W/D ratio and cytokines in BAL fluid. However, PP2 and Y27632 reduced the inflammatory response caused by high tidal volume ventilation or p120 depletion. These results indicate that c-Src is the upstream signaling protein under high tidal volume ventilation, and p120 regulates tight junctions through modulation of RhoA activity during such ventilation.

Conclusions

This study demonstrated the essential intermediary role of p120 between adherens and tight junctions in VILI. Mechanical stretching activated c-Src in lung epithelial cells, which in turn induced the degradation of p120. First, p120 degradation caused disassociation of p120 and the JMD domain of E-cadherin, leading to the dysfunction of adherens junctions. Second, loss of p120 up-regulated the activity of RhoA and down-regulated occludin, which contributed to the damage of tight junctions. Moreover, loss of p120 exacerbated the pulmonary inflammation under mechanical ventilation. Our findings provide the precise mechanisms of the dysfunction of adherens and tight junctions, and suggest potential therapeutic approaches to inhibit the degradation of p120 for the treatment of VILI.
  28 in total

1.  Frequency and peak stretch magnitude affect alveolar epithelial permeability.

Authors:  T S Cohen; K J Cavanaugh; S S Margulies
Journal:  Eur Respir J       Date:  2008-07-09       Impact factor: 16.671

2.  TNF-alpha increases tyrosine phosphorylation of vascular endothelial cadherin and opens the paracellular pathway through fyn activation in human lung endothelia.

Authors:  Daniel J Angelini; Sang-Won Hyun; Dmitry N Grigoryev; Pallavi Garg; Ping Gong; Ishwar S Singh; Antonino Passaniti; Jeffery D Hasday; Simeon E Goldblum
Journal:  Am J Physiol Lung Cell Mol Physiol       Date:  2006-08-04       Impact factor: 5.464

3.  Cyclic stretch induces alveolar epithelial barrier dysfunction via calpain-mediated degradation of p120-catenin.

Authors:  Yuelan Wang; Richard D Minshall; David E Schwartz; Guochang Hu
Journal:  Am J Physiol Lung Cell Mol Physiol       Date:  2011-05-13       Impact factor: 5.464

4.  p190RhoGAP mediates protective effects of oxidized phospholipids in the models of ventilator-induced lung injury.

Authors:  Anna A Birukova; Noureddine Zebda; Ivan Cokic; Panfeng Fu; Tinghuai Wu; Oleksii Dubrovskyi; Konstantin G Birukov
Journal:  Exp Cell Res       Date:  2010-11-25       Impact factor: 3.905

5.  Acidic extracellular pH induces p120-catenin-mediated disruption of adherens junctions via the Src kinase-PKCδ pathway.

Authors:  Ying Chen; Hsiu-Ni Kung; Chia-Hui Chen; Shih-Horng Huang; Kuo-Hsin Chen; Seu-Mei Wang
Journal:  FEBS Lett       Date:  2011-01-18       Impact factor: 4.124

6.  MAPK activation modulates permeability of isolated rat alveolar epithelial cell monolayers following cyclic stretch.

Authors:  Taylor S Cohen; Gladys Gray Lawrence; Amit Khasgiwala; Susan S Margulies
Journal:  PLoS One       Date:  2010-04-28       Impact factor: 3.240

Review 7.  p120 catenin: an essential regulator of cadherin stability, adhesion-induced signaling, and cancer progression.

Authors:  Antonis Kourtidis; Siu P Ngok; Panos Z Anastasiadis
Journal:  Prog Mol Biol Transl Sci       Date:  2013       Impact factor: 3.622

8.  Occludin phosphorylation in regulation of epithelial tight junctions.

Authors:  Radhakrishna Rao
Journal:  Ann N Y Acad Sci       Date:  2009-05       Impact factor: 5.691

9.  Molecular mechanisms regulating dissociation of cell-cell junction of epithelial cells by oxidative stress.

Authors:  Junko Inumaru; Osamu Nagano; Eri Takahashi; Takatsugu Ishimoto; Satoshi Nakamura; Yoshimi Suzuki; Shin-Ichiro Niwa; Kazuo Umezawa; Hidenobu Tanihara; Hideyuki Saya
Journal:  Genes Cells       Date:  2009-04-30       Impact factor: 1.891

10.  Competitive regulation of E-cadherin juxtamembrane domain degradation by p120-catenin binding and Hakai-mediated ubiquitination.

Authors:  Andrea Hartsock; W James Nelson
Journal:  PLoS One       Date:  2012-05-31       Impact factor: 3.240

View more
  12 in total

Review 1.  Effects of melatonin on protecting against lung injury (Review).

Authors:  Weiwei Wang; Ju Gao
Journal:  Exp Ther Med       Date:  2021-01-20       Impact factor: 2.447

Review 2.  Tight Junctions, the Epithelial Barrier, and Toll-like Receptor-4 During Lung Injury.

Authors:  Nachiket M Godbole; Asif Alam Chowdhury; Neha Chataut; Shanjana Awasthi
Journal:  Inflammation       Date:  2022-07-02       Impact factor: 4.657

Review 3.  Ubiquitin-proteasome signaling in lung injury.

Authors:  Natalia D Magnani; Laura A Dada; Jacob I Sznajder
Journal:  Transl Res       Date:  2018-04-23       Impact factor: 7.012

Review 4.  Endothelial cell signaling and ventilator-induced lung injury: molecular mechanisms, genomic analyses, and therapeutic targets.

Authors:  Ting Wang; Christine Gross; Ankit A Desai; Evgeny Zemskov; Xiaomin Wu; Alexander N Garcia; Jeffrey R Jacobson; Jason X-J Yuan; Joe G N Garcia; Stephen M Black
Journal:  Am J Physiol Lung Cell Mol Physiol       Date:  2016-12-15       Impact factor: 5.464

5.  BMSC-derived exosomes ameliorate sulfur mustard-induced acute lung injury by regulating the GPRC5A-YAP axis.

Authors:  Guan-Chao Mao; Chu-Chu Gong; Zhen Wang; Ming-Xue Sun; Zhi-Peng Pei; Wen-Qi Meng; Jin-Feng Cen; Xiao-Wen He; Ying Lu; Qing-Qiang Xu; Kai Xiao
Journal:  Acta Pharmacol Sin       Date:  2021-03-02       Impact factor: 6.150

6.  Up-Regulation of Claudin-6 in the Distal Lung Impacts Secondhand Smoke-Induced Inflammation.

Authors:  Joshua B Lewis; Dallin C Milner; Adam L Lewis; Todd M Dunaway; Kaleb M Egbert; Scott C Albright; Brigham J Merrell; Troy D Monson; Dallin S Broberg; Jason R Gassman; Daniel B Thomas; Juan A Arroyo; Paul R Reynolds
Journal:  Int J Environ Res Public Health       Date:  2016-10-17       Impact factor: 3.390

7.  P120 regulates beta-catenin nuclear translocation through E-cadherin endocytosis in ventilator-induced lung injury.

Authors:  Changping Gu; Chenyang Dai; Yongtao Sun; Mengjie Liu; Yuelan Wang; Xinyi Wu
Journal:  Oncotarget       Date:  2016-12-20

8.  Role of p120 Catenin in Epac1-Induced Chronic Postsurgical Pain in Rats.

Authors:  Peng Pan; Sai-Sai Huang; Shi-Ren Shen; Cui-E Lu; Yi-Bin Qin; Jia-Long Zhang; Su Cao
Journal:  Pain Res Manag       Date:  2019-02-03       Impact factor: 3.037

9.  High Tidal Volume Induces Mitochondria Damage and Releases Mitochondrial DNA to Aggravate the Ventilator-Induced Lung Injury.

Authors:  Jin-Yuan Lin; Ren Jing; Fei Lin; Wan-Yun Ge; Hui-Jun Dai; Linghui Pan
Journal:  Front Immunol       Date:  2018-07-03       Impact factor: 7.561

10.  Keratinocyte Growth Factor-2 Is Protective in Oleic Acid-Induced Acute Lung Injury in Rats.

Authors:  S Tenghao; M Shenmao; W Zhaojun; B Jijia; Z Wenjie; Z Wenyan; M Xigang
Journal:  Evid Based Complement Alternat Med       Date:  2019-07-15       Impact factor: 2.629

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.