Literature DB >> 25923525

Cathepsin Gene Family Reveals Transcriptome Patterns Related to the Infective Stages of the Salmon Louse Caligus rogercresseyi.

Waleska Maldonado-Aguayo1, Jacqueline Chávez-Mardones1, Ana Teresa Gonçalves1, Cristian Gallardo-Escárate1.   

Abstract

Cathepsins are proteases involved in the ability of parasites to overcome and/or modulate host defenses so as to complete their own lifecycle. However, the mechanisms underlying this ability of cathepsins are still poorly understood. One excellent model for identifying and exploring the molecular functions of cathepsins is the marine ectoparasitic copepod Caligus rogercresseyi that currently affects the Chilean salmon industry. Using high-throughput transcriptome sequencing, 56 cathepsin-like sequences were found distributed in five cysteine protease groups (B, F, L, Z, and S) as well as in an aspartic protease group (D). Ontogenic transcriptome analysis evidenced that L cathepsins were the most abundant during the lifecycle, while cathepsins B and K were mostly expressed in the larval stages and adult females, thus suggesting participation in the molting processes and embryonic development, respectively. Interestingly, a variety of cathepsins from groups Z, L, D, B, K, and S were upregulated in the infective stage of copepodid, corroborating the complexity of the processes involved in the parasitic success of this copepod. Putative functional roles of cathepsins were conjectured based on the differential expressions found and on roles previously described in other phylogenetically related species. Moreover, 140 single nucleotide polymorphisms (SNP) were identified in transcripts annotated for cysteine and aspartic proteases located into untranslated regions, or the coding region. This study reports for the first time the presence of cathepsin-like genes and differential expressions throughout a copepod lifecycle. The identification of cathepsins together with functional validations represents a valuable strategy for pinpointing target molecules that could be used in the development of new delousing drugs or vaccines against C. rogercresseyi.

Entities:  

Mesh:

Substances:

Year:  2015        PMID: 25923525      PMCID: PMC4414500          DOI: 10.1371/journal.pone.0123954

Source DB:  PubMed          Journal:  PLoS One        ISSN: 1932-6203            Impact factor:   3.240


Introduction

Caligus rogercresseyi, like the European Lepeophtheirus salmonis, is a marine ectoparasite that infests commercially produced salmonids, subsequently causing high economic losses for the industry [1]. This sea louse has reduced host specificity, and its lifecycle is divided into three planktonic stages (two nauplius phases and an infective copepodid phase) and five parasitic stages (four chalimus phases and an adult phase) [2]. The planktonic stages survive on endogenous reserves, but when the infective copepodid settles onto a host, it molts and extrudes a frontal filament with which it attaches itself to the host [2]. The chalimus stage develops attached to the host and feeds on mucus and skin from the area confined by the frontal filament. In contrast, mature adults are no longer attached to the host and can move freely over the host, thus increasing the area available for feeding. During the parasitic stages, C. rogercresseyi feed on the mucus, skin, and blood of the host [3], bringing as a consequence irritation, increased mucus secretion, abrasions, the loss of scales, skin disruptions, and wounds for the host, all of which affect the barrier function of the skin and fish osmoregulation [4]. This ultimately facilitates secondary infections, either indirectly or directly, as through a vector [5]. The control of caligidosis, or an infection of C. rogercresseyi, has primarily been through the use of chemical treatments, one of which is the pyrethroid deltamethrin. Apart from the environmental damage inherent to any large-scale therapeutic drug administration, deltamethrin has also been shown to induce treatment resistance in sea lice [6,7], thus highlighting the urgent need for alternative control strategies. As with any other parasite, the parasitic capacity and infectious success of C. rogercresseyi depends on its ability to eliminate and/or reduce host defenses so as to attach and remain on the host. The mechanisms employed by C. rogercresseyi to invade the host and evade subsequent defense responses are yet unclear, although Maldonado et al. [8] reported the presence of serine protease inhibitor-like genes differentially expressed throughout ontogenic development, which could represent a strategy for evading host defenses. Moreover, studies have shown that the saliva of parasitic arthropods is mainly composed of proteases, phosphatases, and prostaglandins [9] that have been shown to immunomodulate the host and facilitate the infestation process [10]. Additionally, pathogenicity has been related to protease activity in a number of different parasitic species [11], such as the ameba Entamoeba histolytica [12], the fluke Fasciola hepatica [13], the anisakid Anisakis simplex [14], and the myxozoan Myxobolus cerebralis [15]. Proteases are hydrolytic peptides that catalyze the cleavage of macromolecular unions between proteins and oligomer peptides. Proteases play a direct role in the growth and survival of parasites and are also considered essential during the most critical moments of the parasite-host interaction [16]. Of the different protease families, the cathepsins are among the most studied. These participate in protein degradation in lysosomes or endosomes at a low pH, as well as in cytosol and the nucleus. The cathepsins are divided into several groups according to catalytic mechanisms, and these include the serine (A and G), threonine, aspartate (D and E), and metallo- and cysteine proteases (B, C, H, F, K, L, O, S, V, and W). In mammals, proteolytic enzymes present a regulatory role in normal biological processes such as protein turnover and cell proliferation, migration, and death [17,18], resulting in their obligate participation in pathological conditions such as cancer [19] and other degenerative diseases such as atherosclerosis [20] and Alzheimer’s [21]. On the other hand, proteases in invertebrates can play a role in tissue penetration and digestion, molting, and in evading a host’s immune response [22-25]. For example, in the protozoan parasite Trypanosoma brucei, a cathepsin L participates in the process of blood-brain barrier crossing [26], whereas a cathepsin B regulates iron acquisition [27]. The roles of cathepsins in hematophagous parasites have been described in trematodes such as Schistosoma mansoni, where a cathepsin B was linked to hemoglobin degradation [28], and in the hookworm Necator americanus, where a cathepsin D was found not only to degrade hemoglobin but also digest connective tissue proteins [29]. In addition to this, invertebrate cathepsins have reported roles in the autophagy processes [30], extracellular digestion [31], vitellogenesis regulation, and the yolk protein process [25]. In the European salmon louse L. salmonis, cathepsins L [32] and B [33] have been described, and although their roles in parasitic success have yet to be uncovered, the emergent role of cathepsins as potential drug targets [34] stresses the need to investigate the presence and function of cathepsins in the sea louse C. rogercresseyi, with the goal of achieving an efficient control of this fish ectoparasite. The present study performed a comprehensive transcriptome survey of cathepsins and their expression patterns in C. rogercresseyi throughout ontogenic development using high-throughput sequencing.

Materials and Methods

Ethics statement

Animal procedures were conducted in accordance with the guidelines and approved by the ethics committee of University of Concepción. Samples from the adult male and female sea lice were collected from a commercial farm located in region X in Chile (41°40’48.5”S; 73°02’31.34”O¨). The permissions for the sea lice collections were authorized by Marine Harvest S.A, Ruta 226, Km. 8, Camino El Tepual, Puerto Montt, Chile. All efforts were made to minimize discomfort and suffering to the animals during handling and manipulation.

2.1 Salmon lice culturing and RNA extraction

Female specimens of C. rogercresseyi were collected from recently harvested fish at a salmon farm. Prior to the collection of salmon lice, fish were anaesthetized. The technical details of transported to the laboratory, egg string collection and culturing were described in a previous study [35]. Herein, twenty individuals from each instars of C. rogercresseyi including copepodid, chalimus 1–4 and adult were separately collected. Immediately after sampling, each salmon lice stage were pooled into two biological replicates in 1 mL of RNAlater stabilization solution (Ambion, USA) and stored at −80°C. Total RNA was extracted from pools using the Ribopure kit (Ambion, Life Technologies, USA) following the manufacturer's instructions.

2.2 Transcriptome sequencing from C. rogercresseyi

The encoded cathepsin genes were identified from the cDNA library for C. rogercresseyi. The library was established using Illumina MiSeq sequencing technology from the 6 developmental stages (nauplius I and II, copepodid, chalimus, and adult female and male). The technical details of library construction, including total RNA extraction from a tissue pool, mRNA purification, cDNA synthesis, and sequencing, were described in a previous study [35]. Sequence assembly was carried out using the CLC Genomics Workbench software (Version 7.1, CLC Bio, Denmark). For this, de novo assembly was applied with an overlap criterion of 70% and a similarity of 0.9 to exclude paralogous sequence variants (PSVs). Furthermore, the settings used were a mismatch cost of 2, deletion cost of 3, insert cost of 3, minimum contig length of 200 bp, and a trimming quality score of 0.05. After the assembly process, singletons were retained in the data set as possible representatives of low-expression transcript fragments. However, the sequence redundancy of these fragments was removed using the Duplicate Finder application incorporated in the Geneious v5.1.7 software (Biomatters, Auckland, New Zealand). To gauge the number of transcripts and to determine gene function, BLASTx analysis was carried out on consensus sequences. Consensus sequences from the C. rogercresseyi transcriptome were annotated to the UniprotKB/Swiss-Prot Database (http://uniprot.org) enriched with EST data for crustaceans to determine putative gene descriptions. A cutoff E-value of 1E-05 was used.

2.3 Data deposition

The sequences were deposited in the Sequence Read Archive (SRA) (http://www.ncbi.nlm.nih.gov/sra) under the accession number SRR1106551. The de novo assembly sequence data are available from corresponding author on request.

2.4 Identification of putative cathepsin-like transcripts

To determine C. rogercresseyi gene homology with other cathepsins previously sequenced in crustacean species, tBLASTn analysis was performed against crustacean EST-datasets downloaded from the NCBI, and specifically against ESTs encoding for putative cathepsin proteins. The tBLASTn results were parsed to retain contigs with an E-value < 1E-10. Additionally, EST mining of crustacean cathepsins was conducted using the online BLAST program and the tBLASTn algorithm (http://www.ncbi.nlm.nih.gov/) by applying known cathepsin sequences as a query. The structural motifs in proteins were analyzed with the SMART online tool (http://smart.embl-heidelberg.de/) [36].

2.5 Amino acid sequence and phylogenetic analyses of the C. rogercresseyi cathepsin family

Protein alignments and phylogenetic tree were constructed using the MUSCLE algorithm tool [37] included in the Geneious v5.1.7 software (Biomatter, New Zealand). One sequence from each of the found cathepsins was chosen to represent the most abundant groups, and these were the Cr-CatB4, Cr-CatZ10, Cr-CatD1, Cr-CatD6, Cr-CatL2, and Cr-CatK1 sequences (see S1 Table for further details). These sequences were chosen based on their length, highest Blast score, lowest e-value, and the presence of characteristic, conserved motifs in all of the studied C. rogercresseyi developmental stages. Exceptionally, two different D-like cathepsin transcripts were chosen, and cathepsin L sequences were used for alignment against arthropod sequences deposited in the public GenBank database (S1A and S1B Fig). The phylogenetic tree was constructed based on a Blosum62 matrix, with a gap open penalty of 12, gap extension penalty of 3, ends-free global alignment, Jukes–Cantor genetic distance model, and the neighbor-joining method. The data were bootstrapped 1000 times to estimate the internal stability of each node.

2.6 RNA-seq analysis of cathepsin-like genes

To identify differentially expressed cathepsin-like genes, trimmed reads for each developmental stage (nauplius I and II, copepodid, chalimus and adult female and male) were mapped against cathepsin sequences using CLC Genomic Workbench software (Version 7.1, CLC Bio, Denmark), with a significant annotation (E-value >1E-10) to the selected candidate genes. The RNA-seq was performed with a minimum length fraction of 0.6 and a minimum similarity fraction (long reads) of 0.5. The gene expression was quantified by reads per kilobase of exon model per million mapped reads (RPKM). The proportion-based test method were conducted to identify the differentially expressed genes among nauplius I and II, copepodid, chalimus and adult stages of developmental with false discovery rate (FDR)-corrected P value <0.05. In order to identify differences between stages, RNA-seq analyses were performed separately for Nauplius I and II-Copepodid, Copepodid-Chalimus and Female-male. Values obtained in RPKM were normalized and transformed (log2) and fold change between pair of stages was calculated. The Manhattan metric distance was used for hierarchical cluster analysis and genes were classified as differentially expressed if they exhibited more than one fold change between the two samples, and statistical significance at P <0.01 based on the Kal's test [38] between the pairs nauplius and copepodid, copepodid and chalimus and adult female and male.

2.7 qPCR Validation

The mRNA relative expression of selected cathepsins transcripts was analyzed to validate the differential expression profiles. Seven contigs of the cathepsins (generated by Illumina transcriptome sequencing) with higher differential expression between developmental stages were selected and measured by quantitative real time PCR. Specific primers were designed with Primer3 tool included in the Geneious Pro v. 5.1.7 software and β tubulin gene was used as endogenous control (Table 1). The qPCR runs were performed with StepOnePlus (Applied Biosystems, Life Technologies, USA) using the comparative 2ΔCt method [39]. To perform this, we conducted five cDNA dilution series, beginning with 80 ng of template and dilution factor of 1:5. Each reaction was conducted with a volume of 10 μL using the Maxima SYBR Green/ROX qPCR Master Mix (Thermo Scientific, USA). The amplification conditions were as follows: 95°C for 10 min, 40 cycles at 95°C for 30 s, 60°C for 30 s, and 72°C for 30 s. Significant differences between relative expression along development stages were analyzed by test of means Tukey HSD with the JMP software v.9.0 (SAS Institute Inc., USA) with P <0.05.
Table 1

Forward and reverse qPCR primer sequences used for expression analysis from different life stages of Caligus rogercresseyi cathepsins.

PrimersSequence (5’-3’)
Cr-CatB1-F CTAATAGTATCCTGTCATCG
Cr-CatB1-R AGGTAGTTAGAAGAAGTCTC
Cr-CatD1-F CTCTTCCATCTTCCTTATAG
Cr-CatD1-R CAGAAGTTTGAGGTCATC
Cr-CatD2-F GAGATCCATTCCCATAAATC
Cr-CatD2-R CAACATTGACTTCACTCTG
Cr-CatZ10-F CCAATCTAGTCATCAACTC
Cr-CatZ10-R CTCTTAACACATGACTCTC
Cr-CatL1-F GATCTACACTCTTTCCCTA
Cr-CatL1-R CTCCTTAATACCAACTACC
Cr-Catl26-F CAGTGAATAATAGTACCCG
Cr-Catl26-R GGCCAATACTTTATGAGAG
Cr-Catl27-F GGAGATCAAGGATACATCAA
Cr-Catl27-R TCTCCAGTATCTGTAATTGG
B-tubulinF ACCGCACATGGTGAGTGATA
B-tubulinR CTCGTAGAAAACAGGGACGA

2.8 Single nucleotide polymorphism (SNP) mining from cathepsin-like genes

SNP candidates were identified from the de novo assembly of the six developmental stages of C. rogercresseyi using the CLC Genomics Workbench software (Version 7.1, CLC Bio, Denmark) and quality base variant detection. SNPs mining followed a neighborhood radius of 11, a maximum gap and mismatch count of 2, a minimum neighborhood quality of 15, a minimum coverage of 20, a minimum variant frequency (%) of 25.0, and a maximum expected alleles (ploidy) of 2. The frequencies of SNPs found in all of the contigs were calculated using the same software and were tabulated in Excel spreadsheets for analysis.

Results

3.1 Identification of cathepsin sequences from C. rogercresseyi

Fifty-six putative, partial cathepsin-like sequences were found in the C. rogercresseyi transcriptome. For use in future discussions, the cathepsin-like sequences discovered in this study were denoted Cr-CatL, Cr-CatB, Cr-CatD, Cr-CatK, Cr-CatZ, Cr-CatW, and Cr-CatS (S1A Table and S2B Table). Structural analysis through the SMART program showed that the group of Cr-CatL, Cr-CatB, Cr-CatK, Cr-CatZ, and Cr-CatS sequences had the Papain family cysteine protease (Pept_C1). The Cr-CatF, Cr-CatK, and Cr-CatL group additionally presented the inhibition motif (Inhibitor I29) (S1A Table), while the majority of the Cr-CatD group showed a retropepsin-like domain.

3.2 In silico evidence for other crustacean cathepsins

The 56 cathepsins sequences identified for C. rogercresseyi were used as a reference for investigating their presence in other crustacean species. Of the 18 species present in the crustacean EST database, only 11 have reported EST sequences for cathepsins (Fig 1). The cathepsin L group was the most abundant between analyzed species, whereas cathepsin B was found in only Penaeus monodon and Homarus americanus, while cathepsin K was found only in Penaeus monodon (Fig 1). Similar to that described in other crustaceans, L-like cathepsin transcripts in C. rogercresseyi were the most abundant across all eight developmental stages, followed by cathepsins B and Z (Fig 2).
Fig 1

Diversity and abundance of cathepsin encoding transcripts in crustaceans based on available expressed sequence tag in NCBI (dataset with >10,000 ESTs as of 10th June 2014).

Fig 2

Distribution and abundance of cathepsin-like transcript identified in Caligus rogercresseyi in the six developmental stages.

3.3 Phylogenetic and amino acid sequence analyses

The phylogenetic analysis investigated the evolutionary relationships of the cathepsin-like sequences found in C. rogercresseyi, and the robustness of the nodes was supported by high bootstrap values (Fig 3). Each cathepsin group was differentiated by colors, and in the clade dominated by cathepsin L (red color), there was an evident sub-clade that included cathepsin K (blue color) from C. clemensi. Additionally, cathepsin Z formed part of a remote clade of the group that also included cathepsin D and C, while the amino acid sequences of cathepsin B were found distant to other intracellular hydrolase clades (Fig 3). Moreover, the alignment of cathepsin L sequences of arthropod organisms showed that the C. rogercresseyi transcript for Cr-CatL2 presented high levels of conservation. The catalytic triad of cysteine, histidine, and asparagine was highly conserved in all analyzed species as the active site cysteine is incorporated in the highly conserved peptide sequence CGSCWAFS as the signal sequence GCNGG (S1A Fig), and, following an analysis of the aligned sequence in the SIGNALP server (http://www.cbs.dtu.dk/services/SignalP/), the cleavage site of the signal peptide was predicted between positions 18/19.
Fig 3

Phylogenetic relationships between Caligus rogercresseyi cathepsins-like sequences and the cathepsins sequences of other crustacean species.

Clades for each cathepsin are differentiated by colour as follow: cathepsin B—orange; cathepsin C—yellow; cathepsin D—green; cathepsin K—blue; cathepsin Z—pink; and cathepsin L—red. The tree was constructed by Neighbour-joining method and confirmed by Bootstrap with 1000 iteractions. Support values at the nodes are shown and C. rogercresseyi cathepsins transcripts used were Cr-CatB4, Cr-CatZ10, Cr-CatD6, Cr-CatD1, Cr-CatL2 and Cr-CatK1 (see S1 Table for detailed information on each transcript).

Phylogenetic relationships between Caligus rogercresseyi cathepsins-like sequences and the cathepsins sequences of other crustacean species.

Clades for each cathepsin are differentiated by colour as follow: cathepsin B—orange; cathepsin C—yellow; cathepsin D—green; cathepsin K—blue; cathepsin Z—pink; and cathepsin L—red. The tree was constructed by Neighbour-joining method and confirmed by Bootstrap with 1000 iteractions. Support values at the nodes are shown and C. rogercresseyi cathepsins transcripts used were Cr-CatB4, Cr-CatZ10, Cr-CatD6, Cr-CatD1, Cr-CatL2 and Cr-CatK1 (see S1 Table for detailed information on each transcript).

3.4 Differential gene expression among developmental stages of C. rogercresseyi

The 56 cathepsin-related transcripts found in C. rogercresseyi were used for RNA-seq analysis, including cathepsin-like transcripts from groups L, D, F, B, Z, H, K, and S (see S1A Table for transcript details). Analysis revealed that the transcripts were differentially expressed between six developmental stages of C. rogercresseyi (Fig 4A). A sub-experiment with the 42 sequences included in clusters A and B revealed underlying differential expression patterns mainly associated with the copepodid stage, where several cathepsin B, D, F, K, L, S, and Z-like genes were upregulated (Fig 4B). A total of 26 cathepsin-like genes were differentially expressed throughout the different stages. Between the nauplius and copepodid stages, five genes were found to be up-regulated while another five were down-regulated (Table 2), with Cr-CatL2 being highly downregulated. On the other hand, between the copepodid and chalimus stages, five genes were upregulated while 13 were downregulated (Table 3). Of these, Cr-CatL2 was the most significantly expressed with an up-regulation of 198-fold. The analysis between adult females and males evidenced that 19 genes were upregulated while five cathepsin-like sequences were downregulated (Table 4), and among these, Cr-CatL26 was the most downregulated by more than 60-fold. The majority of the genes that were significantly regulated were those associated with the adult stage, while for the nauplius and copepodid stages, only ten cathepsin-like transcripts were differentially expressed. Finally, the seven cathepsin-like selected genes mRNA expression (Fig 5) validated the in silico differential expression observed in the study.
Fig 4

Heat maps of cathepsin-like transcripts from the six developmental stages of Caligus rogercresseyi representing all cathepsins found (A), and a magnification of the cathepsins found in cluster A and B (B).

Transcript abundance is represented as RPKM values and color scales show relative transcript expression.

Table 2

Genes showing differential transcription expression between nauplius I- II and copepodid stages of Caligus rogercresseyi.

RPKM
IDNauplius I-IICopepodidFC
Up- regulated
Cr-CatD6 2102,326940,232,96
Cr-CatD1 2654,557010,592,37
Cr-CatK1 2139,412825,071,19
Cr-CatZ10 48970,5259740,731,09
Cr-CatB1 145744,27162668,931,01
Down-regulated
Cr-CatL2 2630,31289,44-10,13
Cr-CatL26 58891,9523491,82-2,79
Cr-CatL27 87896,6349397,28-1,98
Cr-CatB2 13880,419164,45-1,69
Cr-CatL1 241570,61229736,15-1,17
Table 3

Genes showing differential transcription expression between copepodid and chalimus stages of Caligus rogercresseyi.

RPKM
IDCopepodidChalimusFC
Up- regulated
Cr-CatL2 289,4463944,18198,86
Cr-CatK1 2825,07270820,9586,29
Cr-CatD2 5013,69100833,3918,10
Cr-CatD1 7010,5995712,6512,29
Cr-CatD6 6940,2314520,441,88
Down-regulated
Cr-CatL27 49397,28734,97-74,67
Cr-CatL3 13988,952480,33-6,27
Cr-CatB1 162668,9329519,26-6,12
Cr-CatL6 7073,281350,61-5,82
Cr-CatB6 9164,452166,55-4,70
Cr-CatL24 29299,087392,75-4,40
Cr-CatZ10 59740,7325434,95-2,61
Cr-CatL1 229736,1597996,43-2,60
Cr-CatL5 7683,323353,36-2,54
Cr-CatL4 13499,176243,88-2,40
Cr-CatL26 23491,8216660,99-1,57
Cr-CatL7 1970,591397,59-1,57
Table 4

Genes showing differential transcription expression between adult female and male stages of Caligus rogercresseyi.

RPKM
IDFemaleMaleFC
Up-regulated
Cr-CatL22 78,111633,0321,20
Cr-CatB2 226,793017,4413,49
Cr-CatD3 558,787168,9113,01
Cr-CatL23 355,171518,884,34
Cr-CatL21 78,11296,913,85
Cr-CatL27 7898,8523007,222,95
Cr-CatL3 1557,844441,432,89
Cr-CatB7 185,00439,542,41
Cr-CatD5 99,99190,061,93
Cr-CatL5 702,061167,591,69
Cr-CatL1 57451,5689399,851,58
Cr-CatL4 5228,867122,511,38
Cr-CatD6 16591,1219913,041,22
Cr-CatL24 10541,3712721,131,22
Cr-CatL2 53807,0860202,091,13
Cr-CatB1 22679,3823923,961,07
Cr-CatD2 104435,33108749,481,06
Cr-CatD1 110861,39113847,141,04
Down-regulated
Cr-CatL26 47751,32742,99-63,39
Cr-CatL19 535,28169,56-3,11
Cr-CatZ10 28363,4313556,11-2,06
Cr-CatK1 342640,13303499,92-1,11
Cr-CatL6 969,47921,33-1,04
Fig 5

Relative expression of Caligus rogercresseyi selected cathepsins mRNA along developmental stages.

Data are presented as mean ± SEM and different letters indicate significant differences in the relative expression of the cathepsins between life stages (Tukey HSD, P< 0.05).

Heat maps of cathepsin-like transcripts from the six developmental stages of Caligus rogercresseyi representing all cathepsins found (A), and a magnification of the cathepsins found in cluster A and B (B).

Transcript abundance is represented as RPKM values and color scales show relative transcript expression.

Relative expression of Caligus rogercresseyi selected cathepsins mRNA along developmental stages.

Data are presented as mean ± SEM and different letters indicate significant differences in the relative expression of the cathepsins between life stages (Tukey HSD, P< 0.05).

3.5 SNPs identification

A total of 140 SNP type variants were identified in transcripts annotated for cathepsins distributed throughout six developmental stages of C. rogercresseyi (Table 4). Putative SNPs were classified in variants of transitions (A/G or C/T) since the proportions of A/C, G/T, and C/G transversions were similar in the six investigated developmental stages. Putative SNPs in cathepsin L, B, Z, and K transcripts were found in the nauplius I—II stages, while in the copepodid stage, SNPs were also identified in cathepsin D. In the chalimus, SNPs were found in cathepsins L, D, and Z. In adult males variants were identified in cathepsins L, K, and Z, and in females these were additionally found in cathepsin B. From the 140 identified SNPs, 43% were non-synonymous variations, while synonymous changes represented 13% and were distributed among the six examined life stages of the sea louse (Table 5).
Table 5

SNPs identification cathepsins- like sequences from Caligus rogercresseyi

IDConsensusConsensusFrecuencySubstitution
Nauplius I
Cr-CatL1 340A/G26,97Synonym
1144A/G37,36Synonym
1158C54,923´UTR
1161G54,243´UTR
1162A/G49,063´UTR
1174T/G52,083´UTR
1183G/T54,353´UTR
Cr-CatB1 1137T/C29,445´UTR
Cr-CatZ10 940G/T33,335´UTR
1076G/T37,215´UTR
1876C/T36,175´UTR
2462C/A40,005´UTR
2775A/G41,945´UTR
3154A/G39,135´UTR
3370A/G34,625´UTR
3457A/T25,715´UTR
4739C/A35,29No synonym
4864C/A43,75Synonym
5020G/A39,34Synonym
5158T/A44,44Synonym
5293T/A35,71Synonym
5311T/G44,64Synonym
5385A/G26,67No synonym
5558T/C46,58Synonym
5777C/G43,52No synonym
5778A/G43,52No synonym
6574A/T32,31Synonym
Cr-CatL13 870G/T25,53No synonym
1048A/G45,65No synonym
1176T/A30,43No synonym
Nauplius II
Cr-CatL1 57CT51,353´UTR
65T/C50,003´UTR
67T/G50,003´UTR
86C/A37,103´UTR
95A/C37,503´UTR
107C/T30,773´UTR
125T/C27,743´UTR
929T/C30,59No synonym
Cr-Cat Z10 22TA31,34Deletion
104T/A45,13No synonym
900T/C32,54Synonym
901G/C32,54No synonym
1120A/G44,55No synonym
1232G/A25,81No synonym
1367A/C44,44No synonym
1385A/T42,11No synonym
1520T/A49,07No synonym
1658C/T46,23No synonym
1814G/T34,65No synonym
1939T/G45,76No synonym
Cr-CatL13 889G/T28,57No synonym
1016A/G35,29No synonym
Cr-CatL26 445T/A33,33No synonym
926G/A37,23No synonym
Copepodid
Cr-Cat L1 341A/G34,76No synonym
1159C49,38Insertion
1203A/C27,59Synonym
Cr-CatL4 137A/G32,20No synonym
Cr-CatL26 264C/T36,365´UTR
1267A/C40,005´UTR
1364T/G28,575´UTR
1365G/A28,575´UTR
1424T/A37,505´UTR
1946C/T33,335´UTR
2063T/A36,365´UTR
2098C/G33,335´UTR
2985T/A33,87Synonym
3202C/T37,74No synonym
3466G/A31,88No synonym
Cr-CatB2 267T/C34,33Synonym
Cr-CatD6 131T/C37,50No synonym
461A/G45,83No synonym
509T/C42,31No synonym
651A/T40,00No synonym
Cr-CatL13 245C/T48,47No synonym
423C/A25,47Synonym
Cr-CatZ10 669C/T45,003´UTR
1648T/A47,903´UTR
2444T/C44,413´UTR
2445G/C44,413´UTR
2664A/G39,933´UTR
2911A/C43,593´UTR
2929A/T41,543´UTR
3064T/A45,613´UTR
3202C/T38,373´UTR
3358T/G50,003´UTR
3483T/G46,723´UTR
Chalimus
Cr-CatL1 130C/T43,183´UTR
289C/T34,39No synonym
319T/A25,93No synonym
Cr-Cat Z10 1144T27,27Insertion
1229T/A39,273´UTR
1301A/G31,083´UTR
2025T/C36,08Synonym
2026G/C36,08No synonym
2357G/A30,40No synonym
2492A/C44,78No synonym
2510A/T31,53No synonym
2645T/A47,51No synonym
2720G/T27,60No synonym
2783T/C35,12No synonym
Cr-CatL25 505C/T37,50No synonym
973C/T32,14No synonym
1024T/A27,593´UTR
1032G/A27,593´UTR
C-CatL13 409G/T40,59No synonym
1425G/A38,78Synonym
Cr-CatD6 672A/T26,09No synonym
1306T/C42,11No synonym
1339T/C26,85No synonym
1561G/A42,37No synonym
1728G/A41,25Synonym
Cr-CatB2 1262C/T49,49No synonym
Male
Cr-CatK1 616G/A29,95No synonym
1352C/T28,553´UTR
Cr-CatL25 536G/A27,503´UTR
Cr-CatZ10 77A/C38,955´UTR
202C/A27,885´UTR
358G/A46,605´UTR
496T/A34,55Synonym
649T/G49,793´UTR
784C/T41,673´UTR
896C/T43,513´UTR
Female
Cr-Cat Z10 203C/A44,55No synonym
328C/A45,72No synonym
484G/A49,32No synonym
622T/A47,99No synonym
757T/A39,81No synonym
910C/T26,59No synonym
1022C/T38,20No synonym
1241C/G38,19No synonym
1242A/G38,19No synonym
2038T/A45,59No synonym
2234T/A50,003´UTR
Cr-CatK1 128T/C34,835´UTR
1094A/C26,423´UTR
Cr-CatL14 452C/T50,003´UTR

Discussion

The ability to overcome and modulate a host's protective defenses is the key to the infectious success of parasites. Proteases are deployed in essential tasks such as tissue penetration and nutrient digestion, as well as in evading the immune response of the host [22-25]. This study reported for the first time the presence and differential expression of a group of proteases, the cathepsins, in C. rogercresseyi. Fifty-six cathepsin-like sequences were identified and distributed in the cysteine protease groups B, F, L, Z, and S and in the aspartic protease group D. Cysteine proteases present a signal sequence that allows for the orientation of the pro-peptide towards different storage sites. The present results, obtained from tBLASTx and SMART analyses, are congruent with this since the presence of the I29 inhibitor sequence was found in relation to a pro-peptide in inactive cathepsins, but this could activate through the proteolytic cleavage of the N-terminal pro-peptide [40]. This is in agreement with other cysteine proteases, such as that found in L. salmonis which presents two cathepsin L sequences with a pro-peptide sequence in the extreme N-terminal [32]. In addition to this, SMART analysis of identified aspartic proteases revealed a retropepsin-like domain, which is characteristic of aspartic proteases [41]. Members of the cathepsin L group have been described as some of the most common proteases among arthropods [42]. Indeed the majority of cathepsin ESTs available in the NCBI belongs to cathepsins L and B. The sea louse C. rogercresseyi was no exception, and in the present study, L cathepsins were the most abundant across all of the analyzed life stages of this copepod. This find was based on a multiple alignment of the Cr-CatL2 sequence with sequences from other arthropods, and the sequence obtained presented conserved domains characteristic of L cathepsins, including the signal peptides MKALSVLACVVA, GCNGG, and CGSCWAFS. The GCNGG sequence had a cysteine residue implied through the formation of a disulfur bridge, therefore indicating a structural function. Meanwhile, the CGSCWAFS sequence corresponded to the active cysteine site and the catalytic triad CHN. However, it was not possible to identify the ERFNIN motif, which is linked to auto-inhibitory functions, or the GNFD motif, which regulates the processing and folding of C1A proteases [43], even though these were found in the sea louse L. salmonis in sequences LsCL1 and LsCL2 [32]. The phylogenetic analysis of the transcripts annotated for cathepsins in C. rogercresseyi showed an evident relationship with the amino acid sequences of cathepsins reported for other arthropods. In the cathepsin L clade, another sub-clade was formed based on cathepsin K, and this is in line with the close relationship reported between cathepsins K and S with cathepsins L through the shared auto-inhibitory motif ERFNIN [11]. On the other hand, the other C. rogercresseyi identified cathepsin sequences (D, Z, and B) formed independent clades with the amino acid sequences reported for each arthropod species used in this study. Cysteine proteases have been identified as potential targets for drug or vaccine development against several parasites [44] as their function appears to be essential in a variety of important biological processes within the parasite, such as in molting, cuticle remodeling, embryogenesis, feeding, and immune evasion [45]. The expression analysis among the different life stages showed high Cr-CatK1 expression in adult females. This is in agreement with other studies in parasites that focused on the relationship between cysteine proteases and embryonic development [46,47]. For instance, in Caenorhabditis elegans, the cathepsin Ce-CPL-1 plays an essential role in yolk protein processing during embryonic development, and a loss of activity leads to enlarged cytoplasm yolk vesicles and embryonic mortality [46]. In addition to this, a dramatic reduction in the production and hatching of eggs occurs when parasites such as Fasciola hepatica infected a cathepsin L immunized host [47]. Similarly, the parasite Brugia malayi presented a cysteine protease, Bm_clp, in the egg yolk during its embryonic development [44]. In turn, Cr-CatL1, Cr-CatL26, and Cr-CatL27 cathepsin transcripts from group L, together with Cr-CatB1a from cathepsin group B, were found upregulated in the nauplius stages before becoming progressively downregulated throughout development. That adults presented the highest number of differentially expressed genes and that most were up-regulated in males might be due to the higher mobility in male sea lice and the capacity to change hosts [48]. This mobility is associated with defense mechanisms and reproductive success [48] and might translate into the increased expression of genes related to parasitic capacity, such as cathepsins. Phylogenetic analysis showed cathepsin B sequence similarities between C. rogercresseyi and other infectious arthropods such as Aedes aegypti, C. clemensi, and L. salmonis, thus suggesting similarities in functional aspects as well. Cathepsin B has been implicated in the digestion processes of L. salmonis and in other parasites [33,49], but it has also been associated with embryogenesis, tissue invasion, iron acquisition, immune response evasion, and the molting processes [27,50-53]. In the nematode Hysterothylacium aduncum, cathepsin B functions are associated with molting processes due to the variations presented during ontogenic development [45]. Similarly, the high expression found for Cr-CatL1, Cr-CatL26, Cr-CatL27, Cr-CatB1, and Cr-CatZ10 suggests possible involvement in the molting processes or shell remodeling in C. rogercresseyi, which would evidence the diversity of possible biological functions attributed to cathepsins [25]. Along this same line, the present results showed that a variety of cathepsins from groups Z, L, D, B, K, and S had high expression in the copepodid stage and might therefore be implicated in processes related to evading the host's immune system, feeding, or molting. Indeed, the participation of cathepsin B in the penetration of and migration to new host tissues after detecting juvenile secretions has been reported in the parasite Fasciola hepatica [24]. Finally, although cysteine proteases F and S were identified in this study, the functional properties of these in arthropods are poorly studied. In parasites such as Teladorsagia circumcincta and Clonorchis sinensis, cathepsin F is one of the most secreted products [54,55], suggesting a participation in host-parasite interactions. The higher differential expression found in the copepodid stage of C. rogercresseyi would indicate that these cathepsins participate in the parasitic approach towards the host. Aspartic proteases have been associated with key processes in the lifecycle of various endo- and ectoparasites such as ticks and flatworms [56,57]. However, these proteases have mainly been linked to endocytosis and intracellular protein degradation [58], with participation in processes such as metamorphosis in the silkworm Bombix mori [22] or in yolk degradation in the tick Boophilus microplus [56,59]. Additionally, aspartic proteases have been related to blood digestion in parasitic mites and ticks [60]. In Haemaphylasis longicornis, for example, the aspartic longepsin was found to be more expressed in the saliva glands than in the ovary, indicating an antigenic role during hematophagous feeding [56]. Similarly, in some pathogens such as plasmodium [61], Ancylostoma caninum [62], and Schistosoma [63], it has been demonstrated that these proteases play a key role in hemoglobin proteolysis. RNA-seq results obtained for C. rogercresseyi showed that two of the aspartic proteases from group D, Cr-CatD1 and Cr-CatD2, had higher transcriptomic expression in the chalimus and adult stages, while in the larval stages expression was not elevated. The high expression of these proteases in the parasitic stages suggests involvement in the hemoglobin proteolytic process during the adult feeding process of the parasite, which is supported by evidence of hematophagous behavior in caligid copepods [3]. Given that SNPs might be bound to differences in target genotypes or phenotypes, these are now widely studied [64]. Moreover, these markers have the advantage of being identifiable in non-model organisms through using high-throughput sequencing [65]. In C. rogercresseyi, 140 SNPs were identified in transcripts annotated for cysteine and aspartic proteases located in the 5'UTR, 3'UTR, or the coding region. From all of the identified variations, 22 SNPs were located in the 5'UTR, 37 in the 3'UTR of the mRNA of the respective cathepsin, and 78 in the coding region of the cathepsin, of which 60 were non-synonymous variations and 18 were synonymous variations. When analyzing the developmental stages of C. rogercresseyi that presented the highest proportion of SNPs, the copepodid evidenced the most polymorphisms in cathepsin L, whereas nauplius I was the ontogenic stage with the fewest SNPs. Only Cr-CatL26 in the copepodid stage showed 11 mutations, most of which were in the 5'UTR region. Studies regarding SNPs in the cathepsins of arthropods show a relationship between genotypic variation and the phenotypic response. As an example, Fenneropenaeus chinensis presents a synonymous mutation in the ORF of a cathepsin B corresponding to a C/T transition associated with resistance/susceptibility to the white spot virus that affects cultured crustaceans [66]. Moreover, Cr-CatZ10 was differentially expressed during the developmental stages and interestingly SNPs annotated in the nauplius I stage were the most abundant mutations in this sequence. Contrary to this, the copepodid stage only presented polymorphic variations in the 3'UTR region. In this context, the analysis of the differential expressions between the nauplius I-II and copepodid stages showed a positive regulation in the copepodid stage, while the transcriptomic expression between the copepodid and chalimus showed a downregulation with the development of the copepod to the parasitic stage. Moreover, Cr-CatZ10 was found more expressed in female adults. These results suggest that the presence of polymorphisms in the 3'UTR region of Cr-CatZ10 might have effects on the transcriptomic expression of these proteases during the C. rogercresseyi lifecycle. Indeed, polymorphisms present in the non-coding regions might affect gene transcription through the modification of regions that regulate mRNA stabilization [67].

Conclusion

The results presented in this study identify the presence of several cathepsin-like sequences in C. rogercresseyi that are differentially expressed during their ontogenic development stages. The putative roles of the identified cathepsins ranged from host tissue invasion and digestion to evading the host's immune system and to reproductive capacity. In this context, the functional analysis of cathepsins might be a major aid towards selecting target molecules for the development of new drugs or vaccines against C. rogercresseyi infestations. Nevertheless, further research should be undertaken so as to understand the expression of these proteins in response to host nutrition and immunocompetence, and also to develop a standardized procedure for the unbiased evaluation and manipulation of C. rogercresseyi digestive proteins. A. Amino acid alignment of Caligus rogercresseyi cathepsin L-like Cr-CatL2 against cathepsin L amino acid sequences from several species. B. Nucleotide sequence of Cr-Cath L2 from C. rogercresseyi. The primer used to amplify the sequence are marked with an arrow in forward and reverse sense. (DOCX) Click here for additional data file. A. tBLASTx analysis of Caligus rogercresseyi cathepsin-like transcripts. B. Sequences of primers used in this study for Cr-Cath L2 sequence. (DOCX) Click here for additional data file.
  56 in total

Review 1.  Digestive proteases of blood-feeding nematodes.

Authors:  Angela L Williamson; Paul J Brindley; David P Knox; Peter J Hotez; Alex Loukas
Journal:  Trends Parasitol       Date:  2003-09

2.  Reference-free transcriptome assembly in non-model animals from next-generation sequencing data.

Authors:  V Cahais; P Gayral; G Tsagkogeorga; J Melo-Ferreira; M Ballenghien; L Weinert; Y Chiari; K Belkhir; V Ranwez; N Galtier
Journal:  Mol Ecol Resour       Date:  2012-04-30       Impact factor: 7.090

3.  Lepeophtheirus salmonis secretory/excretory products and their effects on Atlantic salmon immune gene regulation.

Authors:  M D Fast; S C Johnson; T D Eddy; D Pinto; N W Ross
Journal:  Parasite Immunol       Date:  2007-04       Impact factor: 2.280

4.  Dynamics of gene expression revealed by comparison of serial analysis of gene expression transcript profiles from yeast grown on two different carbon sources.

Authors:  A J Kal; A J van Zonneveld; V Benes; M van den Berg; M G Koerkamp; K Albermann; N Strack; J M Ruijter; A Richter; B Dujon; W Ansorge; H F Tabak
Journal:  Mol Biol Cell       Date:  1999-06       Impact factor: 4.138

Review 5.  Cysteine proteinases and the pathogenesis of amebiasis.

Authors:  X Que; S L Reed
Journal:  Clin Microbiol Rev       Date:  2000-04       Impact factor: 26.132

6.  Cathepsin B- and L-like cysteine protease activities during the in vitro development of Hysterothylacium aduncum (Nematoda: Anisakidae), a worldwide fish parasite.

Authors:  David Malagón; Manuel Díaz-López; Rocío Benítez; Francisco Javier Adroher
Journal:  Parasitol Int       Date:  2009-11-20       Impact factor: 2.230

7.  The Caenorhabditis elegans cathepsin Z-like cysteine protease, Ce-CPZ-1, has a multifunctional role during the worms' development.

Authors:  Sarwar Hashmi; Jun Zhang; Yelena Oksov; Sara Lustigman
Journal:  J Biol Chem       Date:  2003-11-20       Impact factor: 5.157

Review 8.  Fasciola hepatica cathepsin L-like proteases: biology, function, and potential in the development of first generation liver fluke vaccines.

Authors:  John P Dalton; Sandra O Neill; Colin Stack; Peter Collins; Alan Walshe; Mary Sekiya; Sean Doyle; Grace Mulcahy; Deborah Hoyle; Eric Khaznadji; Nathalie Moiré; Gerard Brennan; Angela Mousley; Natalia Kreshchenko; Aaron G Maule; Sheila M Donnelly
Journal:  Int J Parasitol       Date:  2003-09-30       Impact factor: 3.981

Review 9.  How sea lice from salmon farms may cause wild salmonid declines in Europe and North America and be a threat to fishes elsewhere.

Authors:  Mark J Costello
Journal:  Proc Biol Sci       Date:  2009-07-08       Impact factor: 5.349

10.  Functional analysis of the cathepsin-like cysteine protease genes in adult Brugia malayi using RNA interference.

Authors:  Louise Ford; Jun Zhang; Jing Liu; Sarwar Hashmi; Juliet A Fuhrman; Yelena Oksov; Sara Lustigman
Journal:  PLoS Negl Trop Dis       Date:  2009-02-03
View more
  3 in total

1.  Enhanced transcriptomic responses in the Pacific salmon louse Lepeophtheirus salmonis oncorhynchi to the non-native Atlantic Salmon Salmo salar suggests increased parasite fitness.

Authors:  Laura M Braden; Ben J G Sutherland; Ben F Koop; Simon R M Jones
Journal:  BMC Genomics       Date:  2017-01-30       Impact factor: 3.969

2.  Transcriptomics and proteomic studies reveal acaricidal mechanism of octadecanoic acid-3, 4 - tetrahydrofuran diester against Sarcoptes scabiei var. cuniculi.

Authors:  Xu Song; Zhenzhen Chen; Renyong Jia; Mei Cao; Yuanfeng Zou; Lixia Li; Xiaoxia Liang; Lizi Yin; Changliang He; Guizhou Yue; Zhongqiong Yin
Journal:  Sci Rep       Date:  2017-03-31       Impact factor: 4.379

3.  Exploring Sea Lice Vaccines against Early Stages of Infestation in Atlantic Salmon (Salmo salar).

Authors:  Antonio Casuso; Valentina Valenzuela-Muñoz; Bárbara P Benavente; Diego Valenzuela-Miranda; Cristian Gallardo-Escárate
Journal:  Vaccines (Basel)       Date:  2022-07-01
  3 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.