A rapid and reliable PCR-restriction fragment length polymorphism (RFLP) marker for the identification of Amaranthus cruentus species.

A rapid and reliable PCR-restriction fragment length polymorphism (RFLP) marker was developed to identify the Amaranthus cruentus species by comparing sequences of the starch branching enzyme (SBE) locus among the three cultivated grain amaranths. We determined the partial SBE genomic sequence in 72 accessions collected from diverse locations around the world by direct sequence analysis. Then, we aligned the gene sequences and searched for restriction enzyme cleavage sites specific to each species for use in the PCR-RFLP analysis. The result indicated that MseI would recognize the sequence 5'-T/TAA-3' in intron 11 from A. cruentus SBE. A restriction analysis of the amplified 278-bp portion of the SBE gene using the MseI restriction enzyme resulted in species-specific RFLP patterns among A. cruentus, Amaranthus caudatus and Amaranthus hypochondriacus. Two different bands, 174-bp and 104-bp, were generated in A. cruentus, while A. caudatus and A. hypochondriacus remained undigested (278-bp). Thus, we propose that the PCR-RFLP analysis of the amaranth SBE gene provides a sensitive, rapid, simple and useful technique for identifying the A. cruentus species among the cultivated grain amaranths.

Introduction

The genus Amaranthus contains over 60 species that grow in many areas of the world. Amaranthus are drought-resistant C4 photosynthetic plants that can grow well in saline, alkaline, acidic, or poor soil (Saunders and Becker 1984). This genus, which is used in Central and South America, is an ancient crop that was already under cultivation 5,000 to 7,000 years ago (Sauer 1967). The ancient amaranth grains still used today include three species, Amaranthus caudatus, Amaranthus cruentus and Amaranthus hypochondriacus. Recently, grain amaranths have gained agronomic popularity because of the high protein content of the leaves and seeds and the high level of the essential amino acid, lysine, in the protein. Among the three cultivated species, A. cruentus is widely distributed and typically used, as both a seed and a vegetable, throughout the world. This crop is one of the New World super grains and is gaining favor among health-conscious consumers in many countries, including the USA and Japan (Park and Nishikawa 2012a). In particular, the economic value of A. cruentus as a popular market vegetable rank high, and it is a widespread traditional vegetable ranks in all of tropical Africa (Maundu ).

The correct identification of the cultivated amaranth species is essential for crop conservation and quality control. It is also necessary for the efficient use of plant genetic resource collections. Presently, many Amaranthus species are identified based on characteristic morphological features. However, distinguishing species based on morphological traits is a time-consuming operation. In addition, many Amaranthus species exhibit similar morphological characteristics during the vegetative stage (Wetzel ). In particular, the three cultivated grain species are very difficult to distinguish because their seeds show similar color variations, including white, tan, gold and pink (Park and Nishikawa 2012b). Recently, many researchers have reviewed the genetic relationships among species in the genus Amaranthus (Chan and Sun 1997, Costea , Das 2012, Mallory , Transue , Xu and Sun 2001). However, their interest was only in the origin and interrelationships of different species belonging to the same family or the genus. In our previous study, molecular techniques based on PCR-restriction fragment length polymorphism (RFLP) were developed to identify two cultivated grain species, A. caudatus and A. hypochondriacus (Park and Nishikawa 2012b). However, molecular techniques that can identify the species A. cruentus have not yet been reported.

The objective of this study was to develop a PCR-RFLP-based technique using the starch branching enzyme (SBE) gene to identify the economically important A. cruentus. The sequence polymorphisms in this single copy gene may be able to help identify A. cruentus among cultivated species because the non-coding regions provide phylogenetically informative characteristics with high levels of variation. Therefore, we evaluated this approach as a simple, reliable and rapid way to distinguish A. cruentus from other cultivated grain amaranths.

Materials and Methods

Plant materials

A total of 72 accessions from three species of grain amaranths were used (Table 1). All accessions were obtained from collections at the United States Department of Agriculture (USDA), USA and Shinshu University, Japan. The samples in these collections originated in the Americas (Argentina, Bolivia, Brazil, Chile, Guatemala, Mexico, Peru, Puerto Rico and the United States), Africa (Ghana, Nigeria, Uganda, Zaire and Zambia) and Asia (Afghanistan, Bhutan, China, India, Nepal, Pakistan and Sri Lanka).

Table 1

Summary of sampled the cultivated grain amaranth accessions and their polymorphism in species-specific sites from the SBE locus

Species	No.	Accession no.	Origin	T-C polymorphism in intron 11 of the SBE locus
A. cruentus	cr1	Ames 22000	Guatemala	T
	cr2	Ames 22004	Guatemala	T
	cr3	Ames 5676	Guatemala	T
	cr4	PI 511715	Guatemala	T
	cr5	PI 511718	Guatemala	T
	cr6	Ames 5165	United States	T
	cr7	Ames 5318	United States	T
	cr8	Ames 5677	United States	T
	cr9	Ames 5480	Mexico	T
	cr10	Ames 15189	Mexico	T
	cr11	PI 451710	Mexico	T
	cr12	PI 490662	Mexico	T
	cr14	PI 511726	Mexico	T
	cr15	PI 576481	Mexico	T
	cr16	PI 604558	Mexico	T
	cr17	PI 511713	Peru	T
	cr18	Ames 1977	India	T
	cr19	Ames 2037	India	T
	cr20	PI 566897	India	T
	cr21	PI 576448	Nigeria	T
	cr22	Ames 1968	Ghana	T
	cr23	Ames 5369	Zaire	T
	cr24	PI 494774	Zambia	T
A. caudatus	ca1	Ames 15176	Argentina	C
	ca2	Ames 15177	Argentina	C
	ca3	Ames 15179	Argentina	C
	ca4	PI 481607	Bhutan	C
	ca5	PI 490604	Bolivia	C
	ca7	PI 490607	Bolivia	C
	ca8	PI 568139	Bolivia	C
	ca10	PI 568153	Borivia	C
	ca11	PI 166107	India	C
	ca12	PI 175039	India	C
	ca13	Ames 10176	Pakistan	C
	ca15	PI 490614	Peru	C
	ca16	PI 490621	Peru	C
	ca17	PI 490626	Peru	C
	ca18	PI 490639	Peru	C
	ca19	PI 511683	Peru	C
	ca20	PI 511693	Peru	C
	ca21	PI 511705	Peru	C
	ca23	IB 85-3291a	Nepal	C
A. hypochondriacus	hy1	Ames 5436	Mexico	C
	hy2	Ames 5467	Mexico	C
	hy5	Ames 5132	Mexico	C
	hy8	PI 477917	Mexico	C
	hy9	PI 604576	Mexico	C
	hy10	PI 490755	Mexico	C
	hy11	PI 604560	Mexico	C
	hy12	PI 604794	Mexico	C
	hy13	Ames 5158	Puerto Rico	C
	hy14	Ames 5689	Brazil	C
	hy15	Ames 5355	Chile	C
	hy16	Ames 21766	China	C
	hy17	PI 542595	China	C
	hy18	PI 590991	China	C
	hy19	PI 337611	Uganda	C
	hy20	Ames 1972	Nigeria	C
	hy21	Ames 1975	Nigeria	C
	hy22	PI 558499	United States	C
	hy23	PI 274279	India	C
	hy24	85-10-10-3-15a	India	C
	hy25	Almoraa	India	C
	hy26	85-10-27-3-5a	India	C
	hy27	Ac#00406a	Sri Lanka	C
	hy28	PI 540446	Pakistan	C
	hy29	Ames 5609	Afghanistan	C
	hy30	BU 95007a	Bhutan	C
	hy31	Ames 5660	Zambia	C
	hy32	TMN-638a	Nepal	C
	hy33	TMN-647a	Nepal	C
	hy34	SU87-871478a	Nepal	C

The collection in Shinshu University, Japan.

Genomic DNA extraction and PCR amplification

Genomic DNA was extracted from young leaves using the CTAB method (Murray and Thompson 1980) or the DNeasy Plant Mini kit (Qiagen, Hilden, Germany). The quality and concentration of the DNA were evaluated by viewing samples in agarose gels and by a ND-1000 Nanodrop spectrophotometer (Nanodrop Technologies). A fragment of the SBE genomic DNA was amplified by using gene-specific primers, which have been designed previously (Table 2). PCR reactions were conducted in 50 μl volumes containing 2 μl of total DNA, 5 μl of 10× PCR buffer, 4 μl of 2.5 mM dNTP mixture, 10 pmol of each primers and 0.5 μl of EX Taq polymerase. Amplification conditions were as follows: 30 cycles of 98°C for 10 s, 58°C for 30 s and 72°C for 1 min. The PCR products were purified using MultiScreen PCRμ96 plates (Millipore), according to the manufacturer’s instructions. The size of the PCR products was assessed by electrophoresis. The agarose gels were stained with ethidium bromide and visualized under UV light.

Table 2

Primer sequences and annealing temperatures used for amplification of fragments from SBE locus

Fragment	Primer pairs	Forward and reverse PCR primer sequences (5′→3′)	Amplified region	Expeceted length	Annealing temperature
1	SBEg-F3/SBEg-R3	F: TGCAGCACCGTATGACGGAGTATACTR: ATACCGGAAACATCTTCTGCGACTACC	partial exon 5–partial exon 6	853	58°C
2	SBEg-F4/SBEg-R4	F: ATGGGGTGACATCCATGCTATATCATCAR: CCACCCATGGCCATTGTAATTAAATGA	partial exon 6–partial exon 8	924	58°C
3	SBEg-F5/SBEg-R5	F: AGTTGAGAGGGGAATTGCTCTTCATAAR: TGCACATTTTGTAACTCCAACCATTGCC	partial exon 7–partial exon 9	594	58°C
4	SBEg-F6/SBEg-R6	F: AGGCTACCTTAACTTCATGGGAAATGAR: TCCAACAAATTCATGGCACCGTTGAATA	partial exon 8–partial exon 10	1,134	58°C
5	SBEg-F7/SBE-R2	F: ATGGAATCTTCCTGATACAGATCACCTR: TGGAAGTTGAAGACAAACACCAAGTC	partial exon 9–partial exon 11	1,124	58°C
6	SBEg-F8/SBEg-R8	F: ATTGTGAGCAGTGCAAATGAAGTAGACAR: ACGAATTGGGACGATTGTTGAAATTTGT	partial exon 10–partial exon 13	936	58°C
7	SBEg-F9a/SBE-R3	F: TGATGCATTGATGTTCGGTGGAAAAGGAR: TCACACCGAGAAAAGGAAACCG	partial exon 12–exon 14	1,181	58°C

Selection of restriction enzymes and PCR-RFLP analysis

Based on the DNA sequence information obtained in this study, we surveyed the restriction sites of the SBE locus extensively using Geneious Pro 7.1.5 (Biomatters Ltd.). The restriction enzymes with digestion sites that were conserved within a species and variable among other species in a given sequence were selected. The intron 11 of the SBE gene was used for the identification of A. cruentus. A fragment from the SBE gene of 278 bp (position 3,536 to 3,240) containing an MseI restriction site was amplified by PCR using the primers crsbe-F: 5′-AGCGAATTGCGACGAATTATGTTACAT-3′ and crsbe-R: 5′-TTCCTTTTCCACCGAACATCAATGCAT-3′. PCR conditions were as follows: 30 cycles of 98°C for 10 s, 55°C for 30 s and 72°C for 30 s. PCR products were digested with the MseI (RspRSII) restriction enzymes (Takara) in a total volume of 20 μl at 60°C for 1 h based on the manufacturer’s instructions, with some modifications. The digested fragments were separated in 2% agarose gels by electrophoresis in TBE buffer for approximately 45 min and visualized by staining with ethidium bromide.

Sequence analyses

The DNA sequences of the amplified products were determined in both directions using the BigDye Terminator Cycle Sequencing Kit (version 3.1, Applied Biosystems) on an ABI 3130xl Genetic Analyzer (Applied Biosystems). The sequencing primer (3.2 pmol) and dye terminator ready-reaction sequencing premix (8 μl) were added to each template. Following a denaturation step at 96°C for 2 min, the dye terminator reaction was performed for 25 cycles of 96°C for 15 s, 50°C for 1 s and 60°C for 4 min. A multiple sequence alignment and analyses of the deduced amino acid and nucleotide sequences were performed using ClustalW 2.1 as a module of Geneious Pro 7.0.5 (Biomatters). Polymorphic site candidates were identified using CodonCode Aligner 4.2.5 (CodonCode Co., Dedham, MA, USA).

Results and Discussion

Previous analyses of the genetic relationships in the genus Amaranthus have used several techniques, including the chromosome number and hybrid fertility (Gupta and Gudu 1991, Pal and Khoshoo 1974), isozymes (Chan and Sun 1997, Hauptli and Jain 1984), random amplified polymorphic DNAs (Chan and Sun 1997, Das 2012, Transue ), restriction-site variation of chloroplasts and nuclear DNAs (Lanoue ), DNA fingerprints (Sun ), amplified fragment-length polymorphisms and inter-sequence simple repeats (Xu and Sun 2001), micromorphology (Costea ), microsatellite markers (Mallory ) and protein markers (Džunková ). However, most of these studies focused on genetic diversity and/or evolutionary relationships among the cultivated species and their wild ancestors. We therefore wanted to provide a rapid molecular technique to distinguish among the cultivated grain species that are typically widely used around the world. Recently, molecular techniques, based on PCR-RFLP marker analysis, were developed for the identification of two cultivated species, A. caudatus and A. hypochondriacus (Park and Nishikawa 2012b). This was the first study using molecular techniques to identify species among the cultivated grain amaranths within the genus Amaranthus. The use of molecular techniques for species identification is very uncommon for this crop and a rapid molecular technique to identify the A. cruentus species is required.

In this study, we first developed a PCR-RFLP marker, which was able to identify the A. cruentus species, by comparing SBE locus sequences among the grain amaranth species. We determined the partial SBE genomic sequence in 72 accessions of the cultivated grain amaranths by direct sequence analysis. The alignments of the 72 SBE sequences produced a matrix of 7,453 bp. Comparisons of the aligned SBE sequences revealed several substitutions and insertions/deletions. On the basis of DNA sequence data, the digestion patterns were predicted for various restriction enzymes using Geneious Pro 7.0.5 software. Finally, the MseI enzyme was selected to achieve the best species-specific pattern for identification of A. cruentus. The sequence data for the SBE locus in all A. cruentus accessions contained 5′-T/TAA-3′ in intron 11, while the other two species, A. caudatus and A. hypochondriacus contained 5′-TCAA-3′ in intron 11 (Fig. 1). This result indicated that the SBE gene is highly conserved and, consequently, a good molecular marker for diagnostic studies. Thus, the comparative analysis of SBE sequences from 72 amaranth accessions provided the basis for the design of diagnostic primers having the potential for the species-specific identification of A. cruentus by the PCR-RFLP method. In this study, we designated this one-base substitution as the “T-C polymorphism” (Table 1).

Fig. 1

Partial sequence alignment of the SBE locus from A. cruentus, A. caudatus and A. hypochondriacus. Solid black box shows the species-specific restriction cleavage site for the enzyme Mse I. Major SNP, T-C polymorphism is underlined. Shaded area is partial exon 12.

Next, we examined the genetic variation in intron 11 of the SBE locus from 72 accessions using the PCR-RFLP method (Fig. 2). The primer set crsbe-F/crsbe-R successfully amplified a control region using DNA extracts from all samples. This PCR product, located from 3,240-bp (intron 11) to 3,536-bp (exon 12), was approximately 278 bp (Fig. 2a). After restriction enzyme digestion, the results indicated that PCR-RFLP was a suitable tool for identifying A. cruentus accessions. As shown in Fig. 2b, digestion of the control region in A. cruentus by MseI produced two fragments, 174 bp and 104 bp, whereas A. caudatus and A. hypochondriacus produced the original PCR fragment of approximately 278 bp. This result indicated that the fragment of A. cruentus species contained an MseI site, while the fragments of the other two amaranths had no MseI sites. Thus, our results clearly showed that this PCR-RFLP method was highly reliable for identifying A. cruentus from among the cultivated grain amaranths. Finally, the PCR-RFLP method developed here will save a significant amount of time and reagents when identifying the A. cruentus species within the cultivated grain amaranths.

Fig. 2

PCR-RFLP method to identify A. cruentus. a. A single 278-bp fragment was amplified from three cultivated grain species of Amaranthus using primers specific for the SBE locus (see Materials and Methods for details). Markers represent a 100-pb DNA ladder. b. Schematic and result of PCR-RFLP for identifying A. cruentus using intron 11 of the SBE locus. Restriction profiles of PCR amplification of intron 11 of SBE followed by digestion with Mse I. Restriction enzyme cleavage site is shown in bold, and one-base substitution, T-C polymorphism is underlined. Markers represent a100-bp DNA ladder.