Literature DB >> 25904942

Comparison of Proteome Profiling of Two Sensitive and Resistant Field Iranian Isolates of Leishmania major to Glucantime® by 2- Dimensional Electrophoresis.

Mehdi Zarean1, Sharif Maraghi2, Homa Hajjaran3, Mehdi Mohebali3, Mohammad Hossein Feiz-Hadad1, Mohammad Ali Assarehzadegan4.   

Abstract

BACKGROUND: In this study, two-dimensional gel electrophoresis (2-DE) method was applied to determine and compare the protein spots expressed in the two field isolates of Leishmania major and recovered from the patients who were clinically sensitive and resistant to Glucantime® treatment.
METHODS: Leishmania parasites were isolated from the cutaneous lesions of two CL infected patients in Shiraz, south of Iran. The species of the two isolates were identified as L. major using Nested-PCR. Sensitivity (Sh-214S) and resistance (Sh-120R) of the two isolates to meglumine antimonite were checked by the standard in vitro assays. Both sensitive and resistant L. major isolates were harvested in RPMI 1640 medium. Protein extractions were performed using TCA/Acetone method and the protein spots were determined by a two-dimensional gel electrophoresis (2-DE). The gels were stained with silver nitrate and analyzed by Image Master 2D Melanie-6 software.
RESULTS: About 2967 protein spots were detected. Overall, 89 protein spots represented considerable changes of expression in the resistant isolate of L. major compared to the sensitive isolate. Of these, 60 and 29 protein spots were up-and down regulated, respectively. In addition, 11 protein spots present in the resistant isolate were noticed to be absent in the sensitive isolate.
CONCLUSION: A number of proteins showed significant changes of expression in the drug-resistant L. major; moreover, the roles of these proteins probably enhanced the parasite resistance to the drug and increased parasite survival in the cells.

Entities:  

Keywords:  2- Dimensional Gel Electrophoresis; Iran; Leishmania major; Meglumine Antimoniate (Glucantime®); Proteome map; Resistant; Sensitive

Year:  2015        PMID: 25904942      PMCID: PMC4403536     

Source DB:  PubMed          Journal:  Iran J Parasitol        ISSN: 1735-7020            Impact factor:   1.012


Introduction

Leishmaniasis is a vector-born disease disseminated throughout the world, especially in tropical and subtropical regions, causing serious public health problems in 77 countries with an incidence of 1-1.5 million cases annually (1). Cutaneous leishmaniasis (CL) is one of the most common forms of the disease reported to be endemic in different parts of Iran (2). In general CL presents in two main forms: anthroponotic CL (ACL) and zoonotic CL (ZCL), ACL and ZCL are caused by L. tropica and L. major, respectively. ZCL reaches out from northeast to the center and west of Iran as well as all the southern provinces (3–5). Approximately, 75% of CL cases belong to ZCL (6). Most of ACL are reported from northeast and central parts of Iran (3, 5). Recently, cases of cutaneous leishmaniasis reported have increased in most parts of Iran (2, 5). Regarding the difficulty of vector control and absence of vaccine against this parasite, chemotherapy has an important role in controlling the disease (7). Meglumine antimoniate (Glucantime®) is the best option for the treatment of leishmaniasis, but the prevalence of parasites resistant to this drug in ACL and ZCL cases have enhanced. Antimonial treatment failure has been reported in 10–12% of ACL patients and 16% of ZCL patients in Iran because of drug resistance (6, 8). Within the first course of treatment, 40% of patients have not shown a suitable response to meglumine antimoniate (9). Studies on gene amplification can be helpful, but since they are involved in different mechanisms and several genes are up- or down-regulated concurrently, this problem is hard to be conducted. Proteins play an important role in the regulation of cellular responses against the drugs (10, 11). Proteomic approaches have been employed to investigate protein expressions of protozoan parasites such as Plasmodium falciparum (12), Trichomonas vaginalis (13), and Giardia lamblia (14). Comparative proteome analyses have been successfully used in Leishmania spp. for an understanding of diverse outcomes of Leishmania against drug responses (15). Proteomic approaches to study Leishmania in general are at their early stages and partial proteome maps have only recently been reported based on the two-dimensional gel electrophoresis (2- DE) to separate proteins with regard to their isoelectric and molecular weight points (16,17). The goal of our study was to perform a comparative analysis of 2-DE protein maps of the two clinical sensitive and resistant field isolates of L.major to Glucantime® for the study of over- or down-expression patterns of proteins with the final objective of employing proteomic technologies to search for specific proteins of resistant Leishmania to the drug. This is the first proteomic analysis of the two sensitive and resistant field isolates of L. major to Glucantime® in Iran.

Materials and Methods

Leishmania parasite isolates

Leishmania parasites were isolated from the cutaneous lesions of two patients infected with cutaneous leishmaniasis in Shiraz as the capital city of Fars Province, south of Iran. They revealed a significant level of unresponsiveness to Glucantime® among other patients with cutaneous leishmaniasis caused by L. major in Iran (18). One of them was clinically resistant (Sh- 120R) to Glucantime® and the other was sensitive (Sh- 214S) to the drug. The resistant case was treated during two full courses of intralesional Glucantime® administration (Rhone Poulenc Rorer, Paris, France) but no recovery was achieved and the patient still presented an active lesion (2). During parasitological examinations, infection was confirmed by the microscopic identification of Leishmania amastigotes in stained smears via a high magnification (1000×). A susceptible CL case after treatment with Glucantime® and the follow- up course led to a complete recovery since no amastigotes were found during the following parasitological investigations. The patients reported no previous use of anti- leishmanial drugs, CL history or acute or chronic medical conditions. This study was reviewed and approved by the Ethics Committees of Ahvaz Jundishapur University of Medical Sciences, Iran.

Species identification DNA extraction and Nested PCR

DNA extraction was performed according to the protocol of commercial kit (Roche, Germany). To carry out the Nested PCR, we used the primers CSB1XR (ATTTTTCGCGATTTTCGCAGAACG) and CSB2XF (CGAGTA GCAGAAACTCCCGTTCA) as the forward and reverse primers, respectively, in the first step and in the second step, 13Z (ACTGGGGGTTGGTGTAAAATAG) and LiR (TCGCAGAACGCCCCT) were used to amplify the mini-circle variable kDNA (19, 20).

Amastigote drug (Glucantime®) susceptibility assay

The drug susceptibility of the two clinical isolates was implemented in the J774A.1 monocyte-macrophage mouse cell-line. Briefly, J774A.1 (5×104 cells/well) were grown in RPMI (Gibco/BRL) with a 15% FBS (Gibco/BRL) plated in 8 chamber LabTek tissue culture slides (Nunc, NY, USA) and incubated at 37°C for 24 h to allow cell adherence. Then, the cells were infected with late logarithmic promastigotes at a parasite-to-macrophage ratio of 10:1. After 5 h of incubation at 37°C, free promastigotes were removed with 3 times washing and the cells were re-incubated at the presence of serial dilution of Glucantime® for 72 h. Each 5-ml ampoule of Glucantime® (Sanofi-Aventis, Paris, France) contained 1.5 g meglumine antimoniate. The serial dilutions of Glucantime® used for the sensitive and resistant isolates were 2, 4, 6, 8, 10, 12, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, and 70 μg/ ml (the doses were obtained based on the previous screening test). Fresh Glucantime® was added and slides were incubated for an additional 72 h and then stained with Giemsa. 3 slides were used for each isolate. The number of amastigotes was counted in 100 randomly chosen macrophages. The percentage of infected macrophages and the number of parasites per infected cell were evaluated through microscopic examinations. An inhibitory concentration of 50% (IC50) is defined as the effective dose of Glucantime® that decreases the survival of L. major by 50% (21, 22).

Cell culture

L. major including the sensitive (Sh- 214S) and resistant Sh(- 120R) isolates was selected for mass production. Three replicates of promastigotes of each isolate were separately cultured. Promastigotes were sub- cultured in RPMI1640 medium (Gibco/ BRL) supplemented with 10% FBS (Gibco/BRL), 100 U/ml penicillin, and 100 μg/ml streptomycin (Gibco/ BRL). Cultures were incubated at 25°C. Promastigotes were harvested after the last 5- day sub-culture at the late log phase and centrifuged at 3000 rpm and then washed 3 times with sterile PBS (pH 7.2–7.4). Afterwards, 400 × 106/ ml of promastigotes were collected for the protein extraction.

Protein Extraction

The promastigotes were re-suspended in 5 mM Tris-HCl (Roche, Germany), pH= 7.8, containing 1mM of phenylmethylsulfonyl fluoride as a protease inhibitor (Roche, Germany), sonicated 3 times at 40 Hz for 10 seconds with the intervals of 50 seconds, and kept at 4°C for 4 hours. A 20% TCA with mM DTT (Merck, Germany) were used for the precipitation of proteins at −20°C for 1h. Samples were then centrifuged at 13000×g at 4°C for 15 minutes and washed with cold acetone containing 20 mM DTT and the residual acetone was removed by air-drying overnight. The samples were dissolved in 100 μl lysis buffer containing 7M urea, 2M thiourea (Merck, Germany), 1% ampholyte, pH=4- 6.5, 1% ampholyte, pH= 5- 7 (Bio-Rad), and 4% CHAPS (Merck, Germany) detergent (23, 24). Protein concentration was determined by Bradford assay using BSA as the standard (25).

Two-dimensional gel Electrophoresis assay (2-DE)

For the first dimension, electrophoresis was applied onto IPG strips of 18 cm, pH=4–7 (Bio-Rad, Hercules, CA) rehydrated by loading the samples diluted with rehydration buffer (8M urea, 4% CHAPS, 2% ampholyte, 50 mM DTT, and traces of bromophenol blue) overnight. After the gel rehydration, IEF was performed at 300V/ 1h, 500V/ 1h, 1000V/ 2h, and 3500V/ 12h using a Multiphor II electrophoresis unit and EPS 3500 XL power supply (Amersham, Piscataway, NJ) (26). For the protein to be transferred from the first to the second dimension, IPG strips were incubated in an equilibration solution (50 mM Tris- HCl, pH= 8.8, 6M urea, 20% glycerol) (Merck, Germany), 2% SDS (Sigma), and 0.01% bromophenol blue (Merck, Germany) containing 2% DTT for 15 minutes and then re- incubated in the equilibration solution containing 2.5% iodoacetamide (Merck, Germany) for 15 minutes. Strips were placed on top of 10–15% gradient SDS-PAGE and sealed with agarose solution (Bio- Rad) (0.5% agarose plus a few grains of bromophenol blue). The 2DE was carried out at 16 mA/gel and 24 mA/gel at 20 °C for 30 minutes until the dye front reached the bottom of the gel (24, 26, 27). Gels were silver- stained under the same conditions by freshly prepared silver reagents.

Image analysis

The gels were stained with silver nitrate scanned at a resolution of 300 dpi using the Bio- Rad GS- 800 densitometer and analyzed by Image Master 2D Melanie- 6 software. Each set of gel replicates for both the sensitive and resistant L. major isolates was combined into the average gels, which represented spots reproducibly present on both sets of the replicate gels. Spot filtering and editing were performed manually since the spots were neither detected by the software's automatic spot detection process nor separated correctly. Statistical analysis of protein variations was implemented by Student's t- test. It was concluded that protein spots are significantly up- or down- regulated when P< 0.05. The PI and molecular mass of proteins were assessed by standard markers (Amersham Pharmacia Biotech) (24, 27).

Statistical analysis

In vitro drug susceptibility assay was presented as IC50 (50% of inhibitory concentration), which was subsequently determined using linear regression analysis. All experiments were conducted at least 3 times and the results are expressed as the mean ± standard deviations (SDs). The significance of differences was designated by Student's t-test and the level of acceptable significance was 95% (P < 0.05).

Results

Nested PCR

The two sensitive and resistant Leishmania isolated produced amplified fragments of 560 bp for L. major. Amplification reactions in 1.5 % agarose gel electrophoresis using a 100 bp DNA ladder (Roche, Germany) are shown in Fig. 1.
Fig. 1:

Gel electrophoresis of PCR products. Lane 1) DNA size marker 100bp, lane 2) Negative control, lane3) L. tropica (positive control standard = 750bp), lane 4) L. major (positive control = 560 bp), lanes 5, 6) L. major isolates obtained from skin lesions of the patients sensitive and resistant isolates to Glucantime®

Gel electrophoresis of PCR products. Lane 1) DNA size marker 100bp, lane 2) Negative control, lane3) L. tropica (positive control standard = 750bp), lane 4) L. major (positive control = 560 bp), lanes 5, 6) L. major isolates obtained from skin lesions of the patients sensitive and resistant isolates to Glucantime®

Drug susceptibility of L. major field isolates to Glucantime®

In vitro drug sensitivity of L. major to Glucantime® was determined in J774-1 cells. The results indicated IC50 value of Sb (V) for the resistant isolate was 25.6± 3.7 μg/ ml, whereas that of the sensitive isolate was 5.12± 1.3 μg/ ml. The IC50 of the resistant isolate was about 5- fold higher than that of the sensitive isolate.

Expression of protein spots in a two-dimensional gel electrophoresis

After the completion of automated and manual editing of the image for refining the artifacts, approximately 2967 protein spots were detected in each isolate. Overall, there was a significant homogeneity in the protein distribution and positioning between the two sensitive and resistant Leishmania isolates. Images resulted from the triplicate gels were analyzed. Representative 2DE maps of the sensitive and resistant L. major isolates are shown in Fig. 2.
Fig. 2:

2DE gel image of Glucantime® sensitive (S) and resistance (R) isolates of L. major promastigotes that stained by silver nitrate on 18 cm IPG strips with pH range of 4–7 and SDS-PAGE 12%

2DE gel image of Glucantime® sensitive (S) and resistance (R) isolates of L. major promastigotes that stained by silver nitrate on 18 cm IPG strips with pH range of 4–7 and SDS-PAGE 12% Overall, 650 protein spots visually noticeable by Melanie- 6 software analysis were done while 115 protein spots displayed significant changes under drug resistance. Proteins were extracted from the two sensitive and resistant L. major isolates with a pH of 4–7. PH range of the IPG strips of isoelectric focusing of the differentiated proteins was 4.16 to 6.52. Molecular weights of the differentiated proteins were between 14.1 and 83.2 kDa. IF of 115 proteins from among 650 spots were detected with remarkable changes under drug resistance in the two isolates. Induction factor (IF), pH isoelectric focusing (PI), and molecular weights (MW) of the differentiated proteins between the two isolates are shown in Table 1.
Table 1

Spots differently expressed between Glucantime® sensitive and resistant L. major isolates detected after 2D gels. (A) IF >2 showed the high expression (B) IF< 0.5 demonstrated the down expression (C) Absence of protein spots in resistant L. major isolate (D) Presence of protein spots in resistant L. major isolate

(A) High expression protein spots in resistant L. major isolate
No.Spot NumberIFaPIbMWcNo.Spot NumberIFPIMW
1132.0454564.1614.32312202.6621665.9146.19
2212.5989375.4214.92 32 2352.2986486.3643.10
3232.9075495.2014.28 33 2584.2543914.7214.15
4242.2795195.3415.18 34 2593.814014.9415.22
5262.0165945.3015.17352713.7720846.5215.17
6312.2713915.1816.13362814.7306065.1715.16
7363.741826.1115.17372842.2559514.9816.10
8412.9819076.3015.20 38 2862.6330214.8917.15
9562.5977535.7221.32 39 2892.7598025.4915.79
10582.5526585.5218.35 40 2942.0746875.8019.85
11602.7951475.2220.18 41 3062.0392975.1220.14
12702.528785.5020.37 42 3173.2701615.0721.96
13802.6665485.1129.11 43 3182.7301425.1221.94
14842.3718625.0529.9 44 3192.6674695.0718.17
15882.4849615.3126.9 45 3532.5940215.4729.92
16902.1866845.2127.14 46 3604.365265.4827.57
17942.2515845.5330.13 47 3622.3377955.5325.19
181152.077555.9229.8 48 3643.2872265.3732.11
191252.862596.1325.8 49 3852.7750425.0836.90
201282.4506416.2326.6 50 3922.2594976.1043.12
211333.0914655.0126.9 51 4032.4284656.0941.91
221394.1449155.2736.11 52 4114.6101715.5440.14
231402.6590755.7233.6 53 4162.8288725.9562.48
241502.6238456.1618.18 54 4283.1501424.7027.12
251582.5643014.9420.85 55 4307.848495.1936.48
261732.864515.8640.52 56 4313.2430785.6239.19
271762.6759835.5545.78 57 4339.2568585.8642.98
281832.0014095.7838.72 58 4356.0684365.3237.86
292043.8364055.6757.69 59 45410.48844.9615.87
302182.6209855.7555.10 60 46133.864965.3426.99

IF. Induction Factor. The induction factor calculated by dividing the percent volume of spots in gels. / PI. PH Isoelectric/MW. Molecular Weight

Spots differently expressed between Glucantime® sensitive and resistant L. major isolates detected after 2D gels. (A) IF >2 showed the high expression (B) IF< 0.5 demonstrated the down expression (C) Absence of protein spots in resistant L. major isolate (D) Presence of protein spots in resistant L. major isolate IF. Induction Factor. The induction factor calculated by dividing the percent volume of spots in gels. / PI. PH Isoelectric/MW. Molecular Weight These data were indicative of the differential expression of the resistant isolate to Glucan-time® compared to that of the sensitive isolate in 115 protein spots from among which, 60 and 29 protein spots were significantly over-expressed and down-expressed, respectively. Additionally, 11 protein spots present in the resistant isolate were absent in the sensitive isolate. IF<0.5 and IF>2 were demonstrated for the down-and over-expressions of the protein spots. Close-up and 3D images revealed some protein spots between the two isolates are different in the expressed protein spots (Fig. 3, A and B).
Fig. 3: A:

Close- up views of differentially expressed protein spots in the promastigotes of L.major with significant vol. % changes in two Glucantime® sensitive and resistant isolates 1-Presence protein spot 423 in resistance isolate 2) Absence protein spot 432 in resistance isolate 3) Up regulate protein spot 36 in resistance isolate 4) Down regulate protein spot 73 in resistance isolate

Fig. 3: B:

3D views of differentially expressed protein spots 73 (A) and 36 (B) in the promastigotes of L.major with significant vol. % changes in two Glucantime® sensitive and resistant isolates

Close- up views of differentially expressed protein spots in the promastigotes of L.major with significant vol. % changes in two Glucantime® sensitive and resistant isolates 1-Presence protein spot 423 in resistance isolate 2) Absence protein spot 432 in resistance isolate 3) Up regulate protein spot 36 in resistance isolate 4) Down regulate protein spot 73 in resistance isolate 3D views of differentially expressed protein spots 73 (A) and 36 (B) in the promastigotes of L.major with significant vol. % changes in two Glucantime® sensitive and resistant isolates

Discussion

The first-line choice for the treatment of all forms of leishmaniasis in Iran is meglumine antimoniate (Glucantime®), which has been in use for more than 70 years in the world (28). Occurrence of the parasite resistance to this drug is increasing in some parts of the world, while the failure of antimonial treatment was especially reported in 16% of ZCL in Iran (6). The intracellular model in a macrophage cell line is appropriate for evaluating the activity of anti-Leishmania drugs and identification of the resistant parasites can lead to the treatment failure. This approach was used to study the susceptibility of L. major isolates to Glucan-time®. Some genes whose expressions were significantly changed in Glucantime®-resistant Leishmania isolates might be implicated in the natural antimony resistance compared to the sensitive isolate genes (29, 30) such as over-expression of ubiquitin and AAP3 genes, up-regulation of MRPA, PTP, and PGK genes, and down-regulation of AQP1, MAPK (21, 31), and calcineurin genes (22). Proteins have the most important role against the drugs and regulation of cellular responses (10, 11, 32), while changes have been less remarkable in the protein profiles. One of the best techniques among the proteomic studies of protein profiling is 2- DE but it is not complete until the proteins could be identified by Mass spectrometry (24). Although a considerable amount of research on proteomic profiling exists for virulence factors in humans and bacteria, there are only a few reports for profiling parasite proteins (33). Yet, proteomes of many parasites stay unclear, but completion of genome sequencing and development of methods for protein separations will improve proteomic studies for these organisms. In this study, we used a 2- DE protein map to study the protein expression patterns of the sensitive and resistant L.major isolates to Glucantime® in the same region of the old world that allowed for the comparison of protein distribution and positioning between the resistant and sensitive Leishmania major isolates. Close matching of protein distribution and positioning for the two isolates was apparent. However, variability of some protein spots was observed. After the analysis of each isolate, about 2967 protein spots were obtained, whereas approximately 3700, 2000, and 2236 protein spots in L. major (16), L. donovani (34), and L. tropica were discovered in other studies on a 2- DE gel map, respectively (24). In this study, approximately 37% of 46% of Leishmania proteomic map found out by other researchers were covered in comparison with the prior studies carried out on Leishmania genome projects (16). Comparison of the protein maps of the two isolates showed the molecular weights of all the proteins were 14.1 to 83.2 kDa with the PI of 4.16 to 6.52, while an enrichment of the protein spots within a pH of 4–7 has been also reported for other Leishmania species (29). Protein database analysis revealed most of these proteins have a role as the transferring proteins, heat shock proteins, skeletal proteins, and hypothetical proteins, while playing an important role in the protection of DNA structure and normal metabolism in the cells and enhancement of the parasite toleration during the drug resistance (30, 32). Leishmania genome contains 8272 protein-coding genes, only 36% of which can be ascribed to a putative function (35). Therefore, protein identification for proteomic studies will be reliable in future when gel-to-gel reproducibility improves spot resolutions. Furthermore, for a complete study of proteomic map for the identification and determination of the functioning of this protein, other techniques such as mass spectrometry and western blot detection system can be very useful for knowing which proteins with what mechanisms have important roles in drug resistance (36).

Conclusion

2- DE is a strong tool to prove protein expression profiles between the two species of resistant and sensitive Leishmania major isolates. In addition, immunological assays can lead to the recognition of necessary parasite proteins and improvement of new Leishmania treatments and control strategies. Identification of more proteins related to the resistance mechanism requires further studies involving other technical methods like mass spectrometry.
  31 in total

1.  Role of CD4+ T cells in pathogenesis associated with Leishmania amazonensis infection.

Authors:  L Soong; C H Chang; J Sun; B J Longley; N H Ruddle; R A Flavell; D McMahon-Pratt
Journal:  J Immunol       Date:  1997-06-01       Impact factor: 5.422

2.  Characterization of Leishmania infection in rodents from endemic areas of the Islamic Republic of Iran.

Authors:  M Mohebali; E Javadian; M R Yaghoobi-Ershadi; A A Akhavan; H Hajjaran; M R Abaei
Journal:  East Mediterr Health J       Date:  2004 Jul-Sep       Impact factor: 1.628

3.  Proteomic analysis identifies novel proteins of the Maurer's clefts, a secretory compartment delivering Plasmodium falciparum proteins to the surface of its host cell.

Authors:  Laetitia Vincensini; Sophie Richert; Thierry Blisnick; Alain Van Dorsselaer; Emmanuelle Leize-Wagner; Thierry Rabilloud; Catherine Braun Breton
Journal:  Mol Cell Proteomics       Date:  2005-01-24       Impact factor: 5.911

4.  Comparative study of the efficacy of combined cryotherapy and intralesional meglumine antimoniate (Glucantime) vs. cryotherapy and intralesional meglumine antimoniate (Glucantime) alone for the treatment of cutaneous leishmaniasis.

Authors:  A Asilian; A Sadeghinia; G Faghihi; A Momeni
Journal:  Int J Dermatol       Date:  2004-04       Impact factor: 2.736

5.  Identification of antimony resistance markers in Leishmania tropica field isolates through a cDNA-AFLP approach.

Authors:  Elham Kazemi-Rad; Mehdi Mohebali; Mohammad Bagher Khadem-Erfan; Mojtaba Saffari; Reza Raoofian; Homa Hajjaran; Ramtin Hadighi; Ali Khamesipour; Sassan Rezaie; Hoda Abedkhojasteh; Mansour Heidari
Journal:  Exp Parasitol       Date:  2013-08-06       Impact factor: 2.011

6.  Identification and phylogenetic relationship of Iranian strains of various Leishmania species isolated from cutaneous and visceral cases of leishmaniasis based on N-acetylglucosamine-1-phosphate transferase gene.

Authors:  Homa Hajjaran; Mehdi Mohebali; Aref Teimouri; Mohammad Ali Oshaghi; Hamed Mirjalali; Elham Kazemi-Rad; Mohammad Reza Shiee; Saied Reza Naddaf
Journal:  Infect Genet Evol       Date:  2014-06-07       Impact factor: 3.342

7.  Comparison of miltefosine and meglumine antimoniate for the treatment of zoonotic cutaneous leishmaniasis (ZCL) by a randomized clinical trial in Iran.

Authors:  M Mohebali; A Fotouhi; B Hooshmand; Z Zarei; B Akhoundi; A Rahnema; A R Razaghian; M J Kabir; A Nadim
Journal:  Acta Trop       Date:  2007-05-18       Impact factor: 3.112

8.  Comparative proteomics study on meglumine antimoniate sensitive and resistant Leishmania tropica isolated from Iranian anthroponotic cutaneous leishmaniasis patients.

Authors:  H Hajjaran; B Azarian; M Mohebali; R Hadighi; A Assareh; B Vaziri
Journal:  East Mediterr Health J       Date:  2012-02       Impact factor: 1.628

9.  Spatial distribution and molecular identification of leishmania species from endemic foci of South-eastern iran.

Authors:  F Sharifi; I Sharifi; M Zarean; M Hakimi Parizi; Mr Aflatoonian; M Fasihi Harandi; R Zahmatkesh; M Mashayekhi; Ar Kermanizadeh
Journal:  Iran J Parasitol       Date:  2012       Impact factor: 1.012

10.  Overexpression of ubiquitin and amino acid permease genes in association with antimony resistance in Leishmania tropica field isolates.

Authors:  Elham Kazemi-Rad; Mehdi Mohebali; Mohammad Bagher Khadem-Erfan; Homa Hajjaran; Ramtin Hadighi; Ali Khamesipour; Sassan Rezaie; Mojtaba Saffari; Reza Raoofian; Mansour Heidari
Journal:  Korean J Parasitol       Date:  2013-08-30       Impact factor: 1.341

View more
  10 in total

1.  Typical features of cutaneous leishmaniasis in the Ilam province, Iran.

Authors:  Fatemeh Shahidi-Hakak; Ali Ashraf Aivazi; Fariba Mokhtari; Ali Jalilian; Mousa Khosravani; Azam Rafatpanah
Journal:  J Parasit Dis       Date:  2020-08-11

2.  Comparative Two-dimensional Gel Electrophoresis Maps for Amastigote-like Proteomes of Iranian Leishmania Tropica and Leishmania Major Isolates.

Authors:  Marzieh Ashrafmansouri; Fatemeh Sadat Sadjjadi; Seyyedjavad Seyyedtabaei; Ali Haghighi; Mostafa Rezaei-Tavirani; Nayebali Ahmadi
Journal:  Galen Med J       Date:  2019-08-15

Review 3.  Understanding Leishmania parasites through proteomics and implications for the clinic.

Authors:  Shyam Sundar; Bhawana Singh
Journal:  Expert Rev Proteomics       Date:  2018-05-02       Impact factor: 3.940

Review 4.  Experimental Strategies to Explore Drug Action and Resistance in Kinetoplastid Parasites.

Authors:  Magali Van den Kerkhof; Yann G-J Sterckx; Philippe Leprohon; Louis Maes; Guy Caljon
Journal:  Microorganisms       Date:  2020-06-24

5.  Investigation of Visceral Leishmaniasis among 192 Dog Carcasses Killed by Road Accidents in Khorasan Razavi, Northeastern Iran during 2014-2016.

Authors:  Elham Moghaddas; Abdolmajid Fata; Mehdi Zarean; Majid Derakhshani; Mahdi Fakhar; Seyed Aliakbar Shamsian
Journal:  Iran J Public Health       Date:  2018-11       Impact factor: 1.429

6.  Antimicrobial activity of an antimicrobial peptide against amastigote forms of Leishmania major.

Authors:  Sara Khalili; Mehdi Mohebali; Elaheh Ebrahimzadeh; Ebrahimzadeh Shayan; Samira Mohammadi-Yeganeh; Mehrdad Moosazadeh Moghaddam; Samira Elikaee; Behnaz Akhoundi; Mohammad Kazem Sharifi-Yazdi
Journal:  Vet Res Forum       Date:  2018-12-15       Impact factor: 1.054

7.  Treatment Failure in Cutaneous Leishmaniasis Patients Referred to the School of Public Health, Tehran University of Medical Sciences during 2008-2017.

Authors:  Zahra Kakooei; Homa Hajjaran; Behnaz Akhoundi; Sorour Charehdar; Samira Elikaee; Zahra Shafeghat; Hamid Hassanpour; Mohammad Taghi Satvat; Elham Kazemi-Rad; Mehdi Mohebali
Journal:  J Arthropod Borne Dis       Date:  2020-12-31       Impact factor: 1.198

8.  Molecular Characterization of Aquaglyceroporine: A Novel Mutation in LmAQP1 from Leishmania major (MRHO/IR/75/ER).

Authors:  Gilda Eslami; Maryam Ghavami; Ali Reza Moradi; Hamid Nadri; Salman Ahmadian
Journal:  Iran J Parasitol       Date:  2019 Jul-Sep       Impact factor: 1.012

9.  A Novel Strategy for Enhance Potentiation of Meglumine antimoniate against Leishmania major In Vitro.

Authors:  Farzaneh Mirzaei; Hossein Khanahmad; Fatemeh Namdar; Shahrokh Izadi; Seyed Hossein Hejazi
Journal:  Iran J Parasitol       Date:  2019 Oct-Dec       Impact factor: 1.012

10.  Evaluation of MDR1 and MRPA genes expression in different types of dry cutaneous leishmaniasis.

Authors:  Maryam Fekrisoofiabadi; Meisam Fekri; Alireza Moradabadi; Reza Vahidi; Morteza Khaleghi; Maryam Ram; Shahriar Dabiri
Journal:  BMC Res Notes       Date:  2019-12-12
  10 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.