Tomomi Tsumuraya1,2, Hirokazu Ohtaki3, Dandan Song4, Atsushi Sato5,6, Jun Watanabe7, Yutaka Hiraizumi8, Tomoya Nakamachi9,10, Zhifang Xu11, Kenji Dohi12,13, Hitoshi Hashimoto14, Takashi Atsumi15, Seiji Shioda16. 1. Department of Anatomy, Showa University School of Medicine, 1-5-8 Hatanodai, Shinagawa-ku, Tokyo, 142-8555, Japan. milky-t9@wg8.so-net.ne.jp. 2. Department of Orthopedic Surgery, Showa University Fujigaoka Hospital, 1-30 Fujigaoka, Aoba-ku, Yokohama, Kanagawa, 227-8501, Japan. milky-t9@wg8.so-net.ne.jp. 3. Department of Anatomy, Showa University School of Medicine, 1-5-8 Hatanodai, Shinagawa-ku, Tokyo, 142-8555, Japan. taki@med.showa-u.ac.jp. 4. Department of Anatomy, Showa University School of Medicine, 1-5-8 Hatanodai, Shinagawa-ku, Tokyo, 142-8555, Japan. dandansong1202@gmail.com. 5. Department of Anatomy, Showa University School of Medicine, 1-5-8 Hatanodai, Shinagawa-ku, Tokyo, 142-8555, Japan. atsushi@med.showa-u.ac.jp. 6. Department of Orthopedic Surgery, Showa University Fujigaoka Hospital, 1-30 Fujigaoka, Aoba-ku, Yokohama, Kanagawa, 227-8501, Japan. atsushi@med.showa-u.ac.jp. 7. Department of Anatomy, Showa University School of Medicine, 1-5-8 Hatanodai, Shinagawa-ku, Tokyo, 142-8555, Japan. watanabe@med.showa-u.ac.jp. 8. Department of Orthopedic Surgery, Showa University School of Medicine, 1-5-8 Hatanodai, Shinagawa-ku, Tokyo, 142-8555, Japan. hiraizum@med.showa-u.ac.jp. 9. Department of Anatomy, Showa University School of Medicine, 1-5-8 Hatanodai, Shinagawa-ku, Tokyo, 142-8555, Japan. nakamachi@sci.u-toyama.ac.jp. 10. Laboratory of Regulatory Biology, Graduate School of Science and Engineering, University of Toyama, 3190 Gofuku, Toyama, Toyama, 930-8555, Japan. nakamachi@sci.u-toyama.ac.jp. 11. Department of Anatomy, Showa University School of Medicine, 1-5-8 Hatanodai, Shinagawa-ku, Tokyo, 142-8555, Japan. xuzhifang@med.showa-u.ac.jp. 12. Department of Anatomy, Showa University School of Medicine, 1-5-8 Hatanodai, Shinagawa-ku, Tokyo, 142-8555, Japan. kdoppy@jikei.ac.jp. 13. Department of Emergency Medicine, Tokyo Jikei University School of Medicine, 3-25-8 Nishishinnbashi, Minato-ku, Tokyo, 105-8461, Japan. kdoppy@jikei.ac.jp. 14. Laboratory of Molecular Neuropharmacology, Graduate School of Pharmaceutical Sciences, Osaka University, 1-6 Yamadaoka, Suita, Osaka, 565-0871, Japan. hasimoto@phs.osaka-u.ac.jp. 15. Department of Orthopedic Surgery, Showa University Fujigaoka Hospital, 1-30 Fujigaoka, Aoba-ku, Yokohama, Kanagawa, 227-8501, Japan. atsumi@med.showa-u.ac.jp. 16. Department of Anatomy, Showa University School of Medicine, 1-5-8 Hatanodai, Shinagawa-ku, Tokyo, 142-8555, Japan. shioda@med.showa-u.ac.jp.
Abstract
BACKGROUND: Adult human mesenchymal stem/stromal cells (hMSCs) from bone marrow have been reported to exhibit beneficial effects on spinal cord injury (SCI). A neuropeptide, pituitary adenylate cyclase-activating polypeptide (PACAP) is known to decrease neuronal cell death and inflammatory response after ischemia, SCI, and other neuronal disorders. Recently, we found that expression of the gene for mouse PACAP (Adcyap1) was greater in animals receiving hMSCs with neural injury such as ischemia. However, the association of PACAP with hMSCs to protect nerve cells against neural injuries is still unclear. METHODS: Wild-type and PACAP-gene-deficient (Adcyap1 (+/-) ) mice were subjected to spinal cord transection, and hMSCs (5 × 10(5) cells) were injected into the intervertebral spinal cord on day 1 post-operation (p.o.). Locomotor activity, injury volume, retention of hMSCs, mouse and human cytokine genes (which contribute to macrophage (MΦ) and microglial activation), and Adcyap1 were evaluated. RESULTS: hMSCs injected into wild-type mice improved locomotor activity and injury volume compared with vehicle-treated mice. In contrast, non-viable hMSCs injected into wild-type mice, and viable hMSCs injected into Adcyap1 (+/-) mice, did not. Wild-type mice injected with hMSCs exhibited increased Adcyap1 expression, and observed PACAP immunoreaction in neuron-like cells. Gene expression levels for IL-1, tumor necrosis factor α (TNFα), interleukin-10 (IL-10), and transforming growth factor β (TGFβ) decreased, while that for interleukin-4 (IL-4) increased, in hMSC-injected wild-type mice. In contrast, IL-1, TGFβ, and IL-4 gene expression levels were all abolished in hMSC-injected Adcyap1 (+/-) mice on day 7 post-operation. Moreover, the mice-implanted hMSCs increased an alternative activating macrophage/microglial marker, arginase activity. The human gene profile indicated that hMSCs upregulated the gene of IL-4 and growth factors which were reported to enhance Adcyap1 expression. Finally, we demonstrated that hMSCs express human ADCYAP1 and its receptor gene after the inflammation-related interferon-γ (IFNγ) in vitro. CONCLUSIONS: These results suggest that hMSCs attenuate the deleterious effects of SCI by reducing associated inflammatory responses and enhancing IL-4 production. This effect could be mediated in part by cell-cell cross-talk involving the neuropeptide PACAP.
BACKGROUND: Adult human mesenchymal stem/stromal cells (hMSCs) from bone marrow have been reported to exhibit beneficial effects on spinal cord injury (SCI). A neuropeptide, pituitary adenylate cyclase-activating polypeptide (PACAP) is known to decrease neuronal cell death and inflammatory response after ischemia, SCI, and other neuronal disorders. Recently, we found that expression of the gene for mousePACAP (Adcyap1) was greater in animals receiving hMSCs with neural injury such as ischemia. However, the association of PACAP with hMSCs to protect nerve cells against neural injuries is still unclear. METHODS: Wild-type and PACAP-gene-deficient (Adcyap1 (+/-) ) mice were subjected to spinal cord transection, and hMSCs (5 × 10(5) cells) were injected into the intervertebral spinal cord on day 1 post-operation (p.o.). Locomotor activity, injury volume, retention of hMSCs, mouse and human cytokine genes (which contribute to macrophage (MΦ) and microglial activation), and Adcyap1 were evaluated. RESULTS:hMSCs injected into wild-type mice improved locomotor activity and injury volume compared with vehicle-treated mice. In contrast, non-viable hMSCs injected into wild-type mice, and viable hMSCs injected into Adcyap1 (+/-) mice, did not. Wild-type mice injected with hMSCs exhibited increased Adcyap1 expression, and observed PACAP immunoreaction in neuron-like cells. Gene expression levels for IL-1, tumor necrosis factor α (TNFα), interleukin-10 (IL-10), and transforming growth factor β (TGFβ) decreased, while that for interleukin-4 (IL-4) increased, in hMSC-injected wild-type mice. In contrast, IL-1, TGFβ, and IL-4 gene expression levels were all abolished in hMSC-injected Adcyap1 (+/-) mice on day 7 post-operation. Moreover, the mice-implanted hMSCs increased an alternative activating macrophage/microglial marker, arginase activity. The human gene profile indicated that hMSCs upregulated the gene of IL-4 and growth factors which were reported to enhance Adcyap1 expression. Finally, we demonstrated that hMSCs express humanADCYAP1 and its receptor gene after the inflammation-related interferon-γ (IFNγ) in vitro. CONCLUSIONS: These results suggest that hMSCs attenuate the deleterious effects of SCI by reducing associated inflammatory responses and enhancing IL-4 production. This effect could be mediated in part by cell-cell cross-talk involving the neuropeptide PACAP.
Every year, more than 10,000 people in the United States are victims of spinal cord injury (SCI) caused by traffic, sports, and other trauma-related accidents. While medication during the acute injury period involves the administration of large amounts of steroids and other anti-inflammatory drugs, the recovery of neurological function relies on neural plasticity and compensatory mechanisms specific to each patient. Many of these patients end up being permanently paralyzed [1,2].Observations made on animal models suggest that a potential therapy for disorders of the central nervous system (CNS) is the administration of adult mesenchymal stem/stromal cells (MSCs) from bone marrow [3-6]. While humanMSCs (hMSCs) initially attracted interest for their ability to differentiate into multiple cellular phenotypes in vitro and in vivo, part of the interest in them is due to their anti-inflammatory and immunosuppressive properties [4,7-10]. MSCs also cross-talk with host tissues to enhance protective factors and the microenvironment, inducing the release of a range of cytokines and growth factors from those tissues [4,9]. We reported that hMSCs injected into the mouse hippocampus after ischemia improved the neurological symptom, and that hMSCs increased the recipient microglia/macrophage (MΦ) to alternatively activated M2 type (AAM) [11], which are known to promote repair and regeneration after injury [12]. We also determined by microarray analysis the implanted hMSC-suppressed interferon-related genes. Recently, we reanalyzed the microarray data and found that the expression of the gene for mousepituitary adenylate cyclase-activating polypeptide (PACAP; gene: Adcyap1) increased approximately ten fold in animals receiving hMSCs after ischemia compared with animals receiving the vehicle after ischemia, or hMSCs after sham-operation (see Additional file 1: Figure S1). However, no evidence has thus far been provided to demonstrate the involvement of neuropeptides in the neuroprotective properties exerted by hMSCs.PACAP, which was first isolated from the ovine hypothalamus, belongs to the secretin/glucagon/vasoactive intestinal peptide (VIP) superfamily. PACAP exerts multiple functions through three specific receptors - PACAP receptor 1 (PAC1R) and two VIP/PACAP receptors [13,14]. Exogenous and endogenous PACAPdecreases neuronal cell death after ischemia, SCI, and other neuronal disorders [15-20]. PACAP also contributes to suppress inflammatory/immune responses. Adcyap1-deficientmice exhibited increased deterioration in an experimental model for multiple sclerosis [21]. Severe combined immunodeficiency (SCID)-type immune-deficient mice showed decreased Adcyap1 expression after facial nerve-crush. Adcyap1-deficientmice also exhibited increased levels of proinflammatory cytokines such as IL-6, tumor necrosis factor α (TNFα), and interferon-γ (IFNγ) and decreased levels of interleukin-4 (IL-4) [22]. Although a synergistic protective effect in response to co-treatment with hMSCs and PACAP after SCI has been reported [17], no evidence has been shown that hMSCs regulate the expression of PACAP.We hypothesized here that the anti-inflammatory effect of hMSCs in response to CNS damage could involve Adcyap1 regulation. We transplanted hMSCs into the spinal cord after a SCI in wild-type (WT) and Adcyap1+/− mice and compared the determined neurological symptoms and mouseAdcyap1 and Adcyap1r1 (PAC1R gene) expression after SCI. Moreover, the effects of mouse- and human-specific cytokine gene expression to determine mechanisms underlying the anti-inflammatory action of hMSCs were also examined.
Methods
Animals
Wild-type C57BL/6 mice were purchased from Sankyo Lab Service Corporation (Tokyo, Japan). Adcyap1+/− mice on a C57BL/6 background were originally provided by Dr. Hashimoto of Osaka University [23]. All mice were housed in the specific pathogen-free animal facility at Showa University and had free access to food and water. In all experiments, adult male mice (8 to 12 weeks old, weighing 17 to 25 g) were used. All experimental procedures involving animals were approved by the Institutional Animal Care and Use Committee of Showa University (#00168 and 01150).
SCI model
The SCI mouse model was produced according to our previous report [24]. Anesthesia was induced in mice by inhalation of 4.0% sevoflurane and maintained with 3.0% sevoflurane. Under aseptic conditions, an incision was made along the midline of skin of the back, and the muscles, soft tissues, and yellow ligaments overlying the spinal column between T9 and T10 were removed. The intervertebral spinal cord between T9 and T10 was then transected with a thin-bladed razor (FEATHER, Osaka, Japan). After bleeding had stopped and coagulated blood was removed, the incision was closed and the animals were given 1.0-mL lactate Ringer’s solution (s.c., Otsuka, Tokyo, Japan) to avoid dehydration. Following recovery, foods were placed on the cage floor and the intake of the water bottle was lowered to allow for easy access. All mice were allowed to recover in a room maintained at 24°C ± 1°C during the experimental period. To support urination, the region of the lower abdomen in all mice was gently stimulated a few times a day.
Preparation of implanted hMSCs
Frozen vials of hMSCs from bone marrow were obtained from Dr. Prockop (The Center for the Preparation and Distribution of Adult Stem Cells (http://medicine.tamhsc.edu/irm/msc-distribution.html)) under the auspices of a National Institutes of Health (NIH)/National Center for Research Resources grant (P40 RR 17 447-06). The experiments were performed with hMSCs from donor 281L [11,25]. To expand hMSCs, a frozen vial of 1.0 × 106 passage 3 cells was thawed and plated at 100 cells/cm2 in multiple 150-mm plates (Nunclon, Thermo Fisher Scientific, Rochester, NY) with a 20-mL complete culture medium (CCM) that consisted of α-minimal essential medium (α-MEM; Invitrogen, Grand Island, NY), 20% heat-inactivated fetal bovine serum (FBS, Hyclone; Thermo Fisher Scientific), 100 units/mL penicillin, 100 μg/mL streptomycin (Invitrogen), and 2 mM L-glutamine (Invitrogen). The cultures were incubated, and the medium replaced every 3 days for approximately 8 days until cells were 70% to 80% confluent. The medium was then discarded, and the cultures plates were washed with PBS. Adherent cells were harvested with 0.25% trypsin and 1 mM EDTA (Invitrogen) for 5 min at 37°C and were resuspended at 5 × 105 cells in 0.5 μL of sterile Hank’s balanced salt solution (HBSS; Invitrogen) for injection. Unviable hMSCs were prepared by repeated freezing and thawing (three times) of aliquots of these cells.PKH26-labeled hMSCs were prepared according to instructions provided with the PKH26 Red Fluorescent Cell Linker Kit (Sigma-Aldrich, St Louis, MO). In brief, harvested hMSCs (approximately 1 × 107 cells) were washed with α-MEM and centrifuged at 1,500 rpm for 7 min. The cells were then suspended for 3 min at 25°C in 1.0 mL of Diluent C with 1.0 mL of a PKH26 solution diluted 250-fold in Diluent C. Two mL of FBS was added to the suspension and incubated for 1 min at room temperature. A further 4.0 mL of CCM was added, and the suspension was centrifuged at 1,500 rpm for 6 min. After discarding the supernatant, the cells were washed three times with CCM and resuspended finally with HBSS at 5 × 105 cells/mL. In a preliminary study, we confirmed that the cell suspension showed greater red fluorescence (Ex 544, Em580-10) than naive hMSCs or HBSS (Additional file 2: Figure S2). The red fluorescence of the hMSCs was also confirmed with fluorescence immunocytochemistry with CD59 (BD Bioscience) or HuNu (Chemicon) antibodies (Additional file 2: Figure S2).
Injection of hMSCs into spinal cord
The day following surgery to invoke SCI, mice were reanesthetized by inhalation of 4.0% sevoflurane. The animals were placed face-down and a 29G-needle (HAMILTON, Reno, NV) with a 5.0-μL glass syringe (HAMILTON) was inserted directly into the intervertebral spinal cord between T10 and T11. hMSCs (5 × 105 cells/μL) or HBSS were infused at a rate of 0.5 μL/min with an Ultra Micro Pump (World Precision Instruments, Sarasota, FL). After infusion, the needle was left in place for 1 min to enable the solution to diffuse into the tissue. We have shown that the fate of hMSCs was not different between immunocompetent and immunodeficient animals after ischemia [11]. Therefore, the present study did not use any immunosuppressant after cell implantation.
Assessment of locomotor function
Motor function after SCI was assessed by using an open-field behavior test that focused on hindlimb function according to the Basso Mouse Scale (BMS) [26]. The BMS consists of an open-field locomotor rating scale, ranging from 0 (complete paralysis) to 9 (normal mobility). Briefly, individual mice were placed in the center of the open field (e.g., 50 × 50 cm2) with a smooth, non-slip floor and monitored for 4 min. The hindlimb movements, trunk/tail stability, and forelimb-hindlimb coordination were assessed and graded. Mice were tested daily until post-operative (p.o.) day 7. Mice with peritoneal infection, hindlimb wounds, and/or tail or foot autophagia were excluded from the study. Scoring was done by randomly numbering the mice to ensure that the investigators were not aware of the treatment groups.
Measurement of injury volume
After anesthesia with sodium pentobarbital (50 mg/kg, i.p.), the animals were perfused transcardially on p.o. day 7 with 0.9% saline followed by 4% paraformaldehyde (PFA) in 50 mM phosphate buffer (pH 7.2) and the spinal cord removed (T7 to L1 vertebrae). Spinal cords were then post-fixed with 20% sucrose in 0.1 M phosphate buffer (pH 7.2) for two nights, and then embedded in an O.C.T. compound (Sakura Finetech, Tokyo, Japan) for subsequent preparation of frozen blocks. Five spinal cord sections (5-μm thickness) were obtained from each mouse: at the midline which included the central canal nearby to the core-injury site, and bilaterally at 30 μm and 60 μm lateral to the midline (total five sections from each mouse). The damaged area can be identified by glial fibrillary acidic protein (GFAP) immunostaining of the surrounding area, which is considered to be indicative of glial scarring [24]. The frozen sections were washed with phosphate-buffered saline (PBS) and incubated in 0.3% H2O2. The sections were blocked with 2.5% normal horse serum (NHS) in PBS for 1 h at room temperature. Subsequently, the sections were incubated overnight with rabbit anti-GFAP antibody (1:10, DAKO, Glostrup, Denmark). The sections were washed with PBS and immersed with goat anti-rabbit IgG (1:200, Santa Cruz, Santa Cruz, CA) for 2 h. They were then incubated in an avidin-biotin complex solution (Vector, Burlingame, CA) followed by diaminobenzidine (DAB; Vector) as a chromogen. Control staining involved carrying out the same steps without the incubation with the primary antibody. The injury area consisting of GFAP-immunopositive cells was measured by DP2-BSW image analysis software (Olympus, Tokyo, Japan), and the estimated injury volume was calculated by integration of the injured areas.
Human Alu (hAlu) real-time PCR assays
Immediately following, and then at 7 and 14 days after injection of hMSCs, mice were anesthetized with sodium pentobarbital (50 mg/kg, i.p.) and the spinal cord was dissected. The tissue was snap frozen in liquid nitrogen and stored at −80°C until use. Genomic DNA was extracted (n = 4; DNeasy, Qiagen, Valencia, CA) and total DNA was assayed by UV absorbance. Real-time PCR was performed with 100 ng of target DNA, hAlu-specific primers, and a fluorescent probe (Model 7700; Applied Biosystems, Foster City, CA). The primers were as follows: Alu forward, 5′-CAT GGT GAA ACC CCG TCT CTA-3′; Alu reverse, 5′-GCC TCA GCC TCC CGA GTA G-3′; Probe, 5′-FAM-ATT AGC CGG GCG TGG TGG CG-TAMRA-3′. Standard curves were prepared by adding 1 × 102 to 1 × 106 hMSCs to samples of spinal cord from uninjuredmice.
Multiple-immunostaining
Spinal cords (T7 to L1 segment) from immediately after the injection of hMSCs and on p.o. day 7 were obtained and frozen sections prepared as described above. Microscope slides containing attached hMSCs in culture were washed three times with HBSS, fixed with 4% PFA for 15 min, and immersed in PBS containing 0.1% Tween 20 (PBST).Tissue sections or microscope slides were washed several times with PBST and incubated in 2.5% NHS/PBST for 1 h. Subsequently, the sections were incubated overnight with primary antibodies. The sections were then rinsed with PBST and immersed with appropriate fluorescently labeled secondary antibodies for 2 h. Control staining involved carrying out the same procedures but without the incubation with primary antibodies. The primary antibodies were used as follows: rabbit anti-β2-microglobulin (B2M, 1:1000; LifeSpan Biosciences, Seattle, WA), rabbit anti-PACAP (1:1000; Peninsula Laboratories, San Carlos, CA), and rabbit anti-type1 PACAP receptor (PAC1R, 1:400). The rabbit anti-PAC1R antibody was raised by using the N-terminal residue as an antigen [15,27]. The secondary antibody used was goat anti-rabbitAlexa 488 (1:400; Invitrogen). Some sections were stained with 4,6-Diamidine-2-phenylindole dihydrochloride (DAPI, 1:10,000; Roche, Manheim, Germany) to identify cell nuclei. Fluorescence was detected using an Axio Imager optical sectioning microscope with ApoTome (Carl Zeiss, Inc.; Oberkochen, Germany).
Isolation of RNA
Immediately after injection of hMSCs, or on p.o. days 3 or 7, mice were anesthetized with sodium pentobarbital (50 mg/kg, i.p.) and the spinal cord was dissected (T7 to L1 vertebrae). The excised tissue was snap frozen in liquid nitrogen and stored at −80°C until use. The total RNA was isolated from the culturedhMSCs or the spinal cord samples using the TRIZOL Reagent (Invitrogen, Carlsbad, CA) according to the manufacturer’s instructions. In brief, culturedhMSCs (1 × 106 cells) or spinal cord tissue samples (40 mg) in 1.0 mL of TRIZOL Reagent were homogenized using a Dounce tissue grinder (WHEATON, Millville, NJ). Added to the homogenized samples was 0.2 mL of chloroform per 1 mL of TRIZOL Reagent. Following centrifugation, the aqueous phase (containing RNA) was separated from the mixture. Added to this aqueous phase was 0.5 mL of isopropyl alcohol per 1 mL of TRIZOL Reagent. After centrifugation, RNA precipitate was formed on the bottom of sample tube. The RNA precipitate was washed with 75% ethanol and dried completely at room temperature. The RNA was dissolved in RNase-free water. The purity and concentration of extracted RNA were determined spectrophotometrically (NanoDrop, Wilmington, DE). Extracted RNA was stored at −80°C until use.
Real-time PCR
cDNA was then synthesized with a TaKaRa PrimeScript RT reagent Kit (TaKaRa BIO Inc., Shiga, Japan), using 3 μg of the total RNA. The synthesized cDNA was made up to a volume of 30 μL with sterile distilled water. Real-time PCR was performed as previously reported by our group [28], with minor modifications. Reverse transcription PCR (RT-PCR) for tumor necrosis factor α-induced protein 6 (TSG-6) was performed on a Taqman system [29], while for the others, SYBR Green was used. All human- or mouse-specific primers and probes were designed as described in Table 1.
Table 1
Primers and probe to use for real-time PCR
Name
Official symbol
Species
Forward (5′ to 3′)
Reverse (5′ to 3′)
System
PACAP
Adcyap1
mouse
AACCCGCTGCAAGACTTCTATGAC
TTAAGGATTTCGTGGGCGACA
Cyber green (TaKaRa)
PAC1R
Adcyap1r1
mouse
GGCTGTGCTGAGGCTCTACTTTG
AGGATGATGATGATGCCGATGA
IL-1β
Il1b
mouse
TCCAGGATGAGGACATGAGCAC
GAACGTCACACACCAGCAGGTTA
TNFα
Tnf
mouse
GTTCTATGGCCCAGACCCTCAC
GGCACCACTAGTTGGTTGTCTTTG
IL-10
Il10
mouse
GACCAGCTGGACAACATACTGCTAA
GATAAGGCTTGGCAACCCAAGTAA
TGFβ1
Tgfb1
mouse
GTGTGGAGCAACATGTGGAACTCTA
TTGGTTCAGCCACTGCCGTA
IL-4
Il4
mouse
TCTCGAATGTACCAGGAGCCATATC
AGCACCTTGGAAGCCCTACAGA
RPLP1
Rplp1
mouse
TCCGAGCTCGCTTGCATCTA
CAGATGAGGCTCCCAATGTTGA
PACAP
ADCYAP1
human
GTGAGGTAAGCAAGCTCCAACAGAC
CTCGATCTGATTGCTGGGTGAA
Cyber green (TaKaRa)
PAC1R
ADCYAPR1
human
CTCACCACTGCCATGGTCATC
GCCCTCAGCATGAACGACAC
NGF
NGF
human
AGCGTCCGGACCCAATAACA
CCTGCAGGGACATTGCTCTC
BDNF
BDNF
human
GTCAAGTTGGGAGCCTGAAATAGTG
AGGATGCTGGTCCAAGTGGTG
NT-3
NTF3
human
GAAACGGTACGCGGAGCATAA
GTCGGTCACCCACAGACTCTCA
IL-4
IL4
human
AGCAGCTGATCCGATTCCTGA
TCCAACGTACTCTGGTTGGCTTC
IL-10
IL10
human
GAGATGCCTTCAGCAGAGTGAAGA
AGTTCACATGCGCCTTGATGTC
TGFβ1
TGFB1
human
GCGACTCGCCAGAGTGGTTA
GTTGATGTCCACTTGCAGTGTGTTA
β2-microgloblin
B2M
human
CGGGCATTCCTGAAGCTGA
GGATGGATGAAACCCAGACACATAG
TSG-6
TNFAIP6
human
AAGCAGGGTCTGGCAAATACAAGC
ATCCATCCAGCAGCACAGACATGA
Taqman (Japan Bio Service)
probe:FAM-TTTGAAGGCGGCCATCTCGCAACTT-TAMRA
BDNF brain-derived neurotrophic factor, IL interleikin, NGF nerve growth factor, NT-3 neurotrophin 3, PACAP pituitary adenylate cyclase-activating polypeptide, PAC1R pituitary adenylate cyclase-activating polypeptide specific receptor, RPLP1 large ribosomal protein P1, TGFβ transforming growth factor β, TNFα tumor necrosis factor α, TSG-6 tumor necrosis factorα-induced protein 6.
Primers and probe to use for real-time PCRBDNFbrain-derived neurotrophic factor, IL interleikin, NGFnerve growth factor, NT-3 neurotrophin 3, PACAPpituitary adenylate cyclase-activating polypeptide, PAC1Rpituitary adenylate cyclase-activating polypeptide specific receptor, RPLP1 large ribosomal protein P1, TGFβ transforming growth factor β, TNFα tumor necrosis factor α, TSG-6tumor necrosis factorα-induced protein 6.
Assay for arginase activity
Arginase is a marker for AAM, and its activity was measured according to our previous report [24]. Briefly, spinal cord sections containing the T5 and L1 vertebrae from p.o. day 7 animals were removed. The tissues were homogenized with a lysis buffer (10 mM Tris-HCl (pH 7.4), 0.15 M NaCl and 1% Triton X-100, 1 mM ethylene glycol tetraacetic acid (EGTA), 50 mM NaF, 2 mM sodium orthovanadate, 10 mM sodium pyruvate, and protease inhibitor cocktail (Sigma-Aldrich)) and centrifuged at 800 × g for 10 min at 4°C, and the supernatant was collected. Protein concentration in the samples was determined using the BCA protein assay kit (Thermo Fisher Scientific).The homogenate was mixed with an equal volume of pre-warmed 50 mM Tris-HCl, pH 7.5 containing 10 mM MnCl2 and incubated for 15 min at 55°C for activation. The mixture was then incubated in 0.25 M L-arginine for 60 min at 37°C to hydrolyze urea from L-arginine, and the reactions were stopped by adding Stop solution (H2SO4/H3PO4/H2O, 1:3:7). A 1% (final concentration) solution 1-phenyl-1,2-propanedione-2-oxime (ISPF, Wako, Tokyo, Japan) in ethanol was then added to the solution, which was heated at 100°C for 45 min. The reaction between urea and ISPF produced a pink color, and absorption was measured at 540 nm. Data are presented as specific activity (nmol/min/mg of protein).
Stimulation of hMSCs with IFNγ
hMSCs were plated at 2 × 105 cells/well in 6-well plates. The next day, the cells were washed twice with PBS (−) and incubated in an experimental medium (α-MEM supplemented with 1% FBS, 100 units/mL penicillin, 100 μg/mL streptomycin, and 2 mM L-glutamine). Then the cells (n = 3 plates for each phenotype) were exposed to a recombinant mouse IFNγ (10 ng/mL, PeproTech, Rocky Hill, NJ) or vehicle. Forty-eight hours later, the cells were collected and stored at −30°C until analysis.
Stimulation of MΦ-differentiated U937 with LPS and RNA isolation
Human monocyte-like cell line U937 was obtained from the RIKEN Cell Bank (Tsukuba, Japan). For routine maintenance, cells were cultured in RPMI 1640 medium (Invitrogen) supplemented with 10% FBS and 1.0% penicillin/streptomycin in 5% CO2 at 37°C in a humidified chamber. Cell concentrations were maintained between 2 × 105 and 2 × 106 cells/mL. For differentiation into MΦ, 5 × 105 cells were placed into the wells of a 12-well plate and treated with 20 nM phorbol myristate acetate (PMA, Sigma-Aldrich) for 24 h to induce the MΦ-like adherent phenotype. Subsequently, the medium was replaced with fresh RPMI 1640 medium and cells cultured for a further 48 h. PMA-induced U937 cells were stimulated with 0.1 μg/mL of lipopolysaccharide (LPS, Sigma-Aldrich) for 24 hours as a positive control.
RT-PCR for human PACAP and PAC1R
RT-PCR was performed as reported previously [30]. Briefly, the total RNA was extracted from cell pellets (hMSCs, hMSCs stimulated with IFNγ, MΦ-like differentiated U937, MΦ-like differentiated U937 stimulated with LPS) by TRIZOL reagent (Invitrogen) according to the manufacturer’s instructions. The purity and concentration of extracted RNA were determined spectrophotometrically (NanoDrop, Wilmington, DE). The cDNA was then synthesized with an AffinifyScript QPCR cDNA Synthesis Kit (Stratagene, Agilent Technologies, La Jolla, CA), using 1 μg of the total RNA. The synthesized cDNA was made up to a volume of 50 μL with sterile water supplied with the kit. The reaction mixture contained 0.6 μL of the first-strand cDNA, 7 pmols of each primer set and 6.0 μL of the Emerald Amp PCR Master Mix (2X premix) (TaKaRa) in a total volume of 12 μL. The primers were as follows: hPACAP forward, 5′-GAAACAAATGGCTGTCAAGAAA-3′; hPACAP reverse, 5′- TCTGTGCATTCTCTAGTGCTTTG-3′; hPACAPR1forward, 5′-GTTACTTCGCTGTGGACTTCAA-3′; hPACAPR1 reverse, 5′-GGACCAGTACCAAAACAAGGAG-3′; hGAPDH forward, 5′-GGTGGTCTCCTCTGACTTCAAC-3′; hGAPDH reverse, 5′-GTCTACATGGCAACTGTGAGGA-3′. Thermal-cycling parameters were set as follows: 97°C for 5 min for an initial denaturation, then a cycling regime of 40 cycles at 95°C for 45 s, 60°C for 45 s, and 72°C for 1 min. At the end of the final cycle, an additional extension step was carried out for 10 min at 72°C. Three microliters of each reaction mixture were loaded for 1.6% agarose gel electrophoresis and bands were visualized with ethidium bromide.
Statistical analysis
Each mouse was assigned a random number, and all data were collected and analyzed without investigator knowledge of group identities. Data are expressed as mean ± SEM for in vivo experiments and as mean ± SD for in vitro experiments. Statistical comparisons were made by Student’s t-test for two groups and by one-way ANOVA following non-parametric multiple comparison as indicated in each figure legend. A value of P < 0.05 was considered to indicate statistical significance.
Results
Injection of hMSCs improved locomotor activity and suppressed SCI-related damage
We first determined locomotor activity and lesion size after injecting hMSCs into the spinal cord. This intervention induced severe locomotor deficits (BMS of around 1.5 points; see the ‘Methods’ section) [26] within a few hours. On p.o. day 1, hMSCs (5 × 105 cells/0.5 μL) were injected into the intervertebral spinal cord one vertebra rostral to the injury site in WT or Adcyap1+/− mice. Another set of mice were injected with repeat freeze-thawed unviable hMSCs. WT mice implanted with viable hMSCs (hMSC/WT mice) exhibited significantly improved BMS on p.o. days 3 and 7 compared with vehicle-treated WT one (HBSS/WT mice). However, WT mice implanted with unviable hMSCs (unviable hMSC/WT mice) and Adcyap1+/− mice implanted with viable cells (hMSC/Adcyap1+/− mice) had significantly lower BMS scores than the hMSC/WT mice (Figure 1A).
Figure 1
Injection of viable hMSCs suppresses SCI symptoms in wild-type (WT) mice. (A) Motor function determined by BMS improved significantly after injection of viable hMSCs (filled circles, n = 67) compared with that of HBSS (open circles with solid line, n = 47) in WT mice. This improvement was diminished when unviable hMSCs were injected into WT mice (open circles with dashed line, n = 18) or when viable hMSCs were injected into Adcyap1
mice (filled triangles, n = 17). Data are expressed as mean ± SEM. **P < 0.01 (Tukey post hoc t-test). (B) Typical images of lesion site after SCI. Injection of viable hMSCs (right upper) into WT mice decreased the lesion area compared with that in HBSS-treated control (left upper). Unviable hMSCs injected into WT mice (left bottom) and viable hMSCs injected into Adcyap1
+/− mice (right bottom) did not reduce the lesion size. R: rostral, C: caudal, D: dorsal, V: ventral. Scale bar is 500 μm. (C) Quantification of GFAP-unstained injury volume at 7 days. Data are expressed as mean ± SEM. *P < 0.05, **P < 0.01 (Tukey post hoc t-test). BMS Basso Mouse Scale, HBSS Hank’s balanced salt solution, MSC mesenchymal stem/stromal cell, n.s. no significant, PA
Adcyap1 (PACAP gene) heterozygous mice, SCI spinal cord injury, wt wild-type.
Injection of viable hMSCs suppresses SCI symptoms in wild-type (WT) mice. (A) Motor function determined by BMS improved significantly after injection of viable hMSCs (filled circles, n = 67) compared with that of HBSS (open circles with solid line, n = 47) in WT mice. This improvement was diminished when unviable hMSCs were injected into WT mice (open circles with dashed line, n = 18) or when viable hMSCs were injected into Adcyap1mice (filled triangles, n = 17). Data are expressed as mean ± SEM. **P < 0.01 (Tukey post hoc t-test). (B) Typical images of lesion site after SCI. Injection of viable hMSCs (right upper) into WT mice decreased the lesion area compared with that in HBSS-treated control (left upper). Unviable hMSCs injected into WT mice (left bottom) and viable hMSCs injected into Adcyap1
+/− mice (right bottom) did not reduce the lesion size. R: rostral, C: caudal, D: dorsal, V: ventral. Scale bar is 500 μm. (C) Quantification of GFAP-unstained injury volume at 7 days. Data are expressed as mean ± SEM. *P < 0.05, **P < 0.01 (Tukey post hoc t-test). BMS Basso Mouse Scale, HBSS Hank’s balanced salt solution, MSC mesenchymal stem/stromal cell, n.s. no significant, PA
Adcyap1 (PACAP gene) heterozygous mice, SCI spinal cord injury, wt wild-type.We next compared lesion areas on p.o. day 7. hMSC/WT mice exhibited significantly reduced lesion area compared with HBSS/WT mice, whereas unviable hMSC/WT and hMSC/Adcyap1+/− mice did not show any improvement (Figure 1B, C).
Fate of hMSCs in the spinal cord
We next observed the fate of hMSCs with human hAlu quantitative real-time PCR and estimated number of hMSCs after implantation. Within 10 min of injection of hMSCs, 326,058 ± 62,153 hMSCs cells (>65%) were counted from the injection site, 424 ± 173 cells were measured from the rostral site, and 12,322 ± 9,126 cells from the caudal site (Figure 2A). The number of hMSCs decreased rapidly to 3,879 ± 2,704 and 250 ± 169 (1/100 and 1/10,000 immediately after implantation) on p.o. day 7 and 14, respectively. The estimate numbers of hMSCs in the spinal cord from the non-injured WT and injuredAdcyap1+/− mice on p.o. day 7 after hMSCs treatment were not different from that in the injured WT mice (Figure 2B).
Figure 2
Distribution of implanted hMSCs in the spinal cord and distribution of PKH26-labeled hMSCs after hMSC injection, with higher magnification images. Distribution of implanted hMSCs in the spinal cord (A, B). (A) Real-time PCR assays for hAlu after injection of hMSCs (5 × 105 cells) into spinal cord (n = 4). Data are expressed as mean ± SEM. **P < 0.001 (Dunnet post hoc t-test vs injection site). (B) Temporal profile of hMSC survival after injection in animals with or without SCI. The survival of hMSCs in wild-type (WT) mice with SCI decreased drastically with time. Data are expressed as mean ± SEM. **P < 0.01 (Dunnet post hoc t-test). (C) Distribution of PKH26-labeled hMSCs (red) after hMSC injection. Within 10 min of injection (day 1), the cells were observed as a cluster in the injection site (injection). At 7 days after SCI, the cells are seen to have migrated along the spinal cord toward the injury site (injury) and detected the PKH26 signals in peri-injury site (arrowhead). Blue: DAPI counterstaining. R: rostral, C: caudal, D: dorsal, V: ventral. (D) Higher magnification images of (C) with human B2M staining (green) shows co-labeling with PKH26-stained cells. One day after SCI and immediately after hMSC injection, no PKH26 signals can be observed in the peri-injury site. However, PKH26-red signals merged with B2M-positive reactions (green) can be observed on the peri-injury site on post-operative day 7. B2M β2-microglobulin, DAPI 4,6-Diamidine-2-phenylindole dihydrochloride, hMSC human MSC, n.s. no significant, PA
Adcyap1 (PACAP gene) heterozygous mice, SCI spinal cord injury, wt wild-type.
Distribution of implanted hMSCs in the spinal cord and distribution of PKH26-labeled hMSCs after hMSC injection, with higher magnification images. Distribution of implanted hMSCs in the spinal cord (A, B). (A) Real-time PCR assays for hAlu after injection of hMSCs (5 × 105 cells) into spinal cord (n = 4). Data are expressed as mean ± SEM. **P < 0.001 (Dunnet post hoc t-test vs injection site). (B) Temporal profile of hMSC survival after injection in animals with or without SCI. The survival of hMSCs in wild-type (WT) mice with SCI decreased drastically with time. Data are expressed as mean ± SEM. **P < 0.01 (Dunnet post hoc t-test). (C) Distribution of PKH26-labeled hMSCs (red) after hMSC injection. Within 10 min of injection (day 1), the cells were observed as a cluster in the injection site (injection). At 7 days after SCI, the cells are seen to have migrated along the spinal cord toward the injury site (injury) and detected the PKH26 signals in peri-injury site (arrowhead). Blue: DAPI counterstaining. R: rostral, C: caudal, D: dorsal, V: ventral. (D) Higher magnification images of (C) with humanB2M staining (green) shows co-labeling with PKH26-stained cells. One day after SCI and immediately after hMSC injection, no PKH26 signals can be observed in the peri-injury site. However, PKH26-red signals merged with B2M-positive reactions (green) can be observed on the peri-injury site on post-operative day 7. B2M β2-microglobulin, DAPI4,6-Diamidine-2-phenylindole dihydrochloride, hMSChumanMSC, n.s. no significant, PA
Adcyap1 (PACAP gene) heterozygous mice, SCI spinal cord injury, wt wild-type.Migration of hMSCs toward the injection site was confirmed by PKH26-fluorescence labeling. On the day of cell injection (p.o. day 1), red fluorescence was clustered around the injective site and merged with humanB2M immunoreactivity, but was not observed at the injury site. The fluorescence migrated toward the injury site and merged with the B2M immunoreactivity in both of the injection and peri-injury sites by p.o. day 7 (Figure 2C, D).
Adcyap1 and Adcyap1r1 expression were induced by hMSCs
We reported previously that Adcyap1+/− mice increased lesion size to compare with the WT mice after brain ischemia [15] and contusion-induced SCI [19]. Therefore, failure of hMSCs to induce tissue protection in Adcyap1+/− mice could have been due to the deletion of Adcyap1. For this reason, we next examined mouseAdcyap1 and Adcyap1r1 induction after the injection of hMSCs (Figure 3A, B). In HBSS/WT, Adcyap1 expression in the spinal cord was temporarily increased on p.o. day 1 and then decreased. Adcyap1 expression in hMSC/WT mice was significantly greater than that in HBSS/WT and hMSC/Adcyap1+/− mice. Adcyap1r1 expression levels in the spinal cord did not differ among any of the experimental groups. PACAP and PAC1R immunoreactivities were mainly observed in neuron-like cells (Figure 3C).
Figure 3
Implanted hMSCs induced increased mouse
expression after SCI. Mouse Adcyap1
(A) and Adcyap1r1
(B) expression levels in spinal cord after injury and in the presence and absence of injected hMSCs. (A) Although Adcyap1 expression in HBSS-treated animals decreases after SCI, in hMSC-treated animals it increases significantly. Gene expression levels are similar between HBSS-treated WT mice and hMSC-treated Adcyap1
+/− mice at 7 days. (B) Adcyap1r1 expression is similar for all experimental groups. Rplp1 is the large ribosomal protein P1 as a house keeping gene. Data are expressed as mean ± SEM. **P < 0.01 (Tukey post hoc test). (C) Multiple-immunostaining of PACAP or PAC1R (green) and nuclei (blue; DAPI). DAPI 4,6-Diamidine-2-phenylindole dihydrochloride, HBSS Hank’s balanced salt solution, MSC mesenchymal stem/stromal cell, PA
Adcyap1 (PACAP gene) heterozygous mice, PACAP pituitary adenylate cyclase-activating polypeptide, PAC1R pituitary adenylate cyclase-activating polypeptide specific receptor, wt wild-type.
Implanted hMSCs induced increased mouse
expression after SCI. MouseAdcyap1
(A) and Adcyap1r1
(B) expression levels in spinal cord after injury and in the presence and absence of injected hMSCs. (A) Although Adcyap1 expression in HBSS-treated animals decreases after SCI, in hMSC-treated animals it increases significantly. Gene expression levels are similar between HBSS-treated WT mice and hMSC-treated Adcyap1
+/− mice at 7 days. (B) Adcyap1r1 expression is similar for all experimental groups. Rplp1 is the large ribosomal protein P1 as a house keeping gene. Data are expressed as mean ± SEM. **P < 0.01 (Tukey post hoc test). (C) Multiple-immunostaining of PACAP or PAC1R (green) and nuclei (blue; DAPI). DAPI4,6-Diamidine-2-phenylindole dihydrochloride, HBSS Hank’s balanced salt solution, MSC mesenchymal stem/stromal cell, PA
Adcyap1 (PACAP gene) heterozygous mice, PACAPpituitary adenylate cyclase-activating polypeptide, PAC1Rpituitary adenylate cyclase-activating polypeptide specific receptor, wt wild-type.
Alteration of mouse cytokine profiles in spinal cords injected with hMSCs
Several factors have been reported concerning hMSCs’ capacity to decrease inflammation via MΦ; hMSCs increase AAM via the induction of IL-4 [11], they suppress classical activating MΦ (CAM) which are induced by IFNγ [25,29], and they increase deactivating MΦ (DAM) which are induced by interleukin-10 (IL-10) [10].We then assayed expression levels of mouse inflammatory cytokines in the spinal cord. The mouse interleukin-1β (IL-1β) gene (Il1b) and TNFα gene (Tnf) in HBSS/WT mice showed greater expression after SCI. hMSC/WT mice suppressed significantly the expression levels. However, in hMSCs/Adcyap1+/− mice, the level of Il1b expressed was similar to that in the HBSS/WT. (Figure 4A, B). Expression levels for the IL-10 (Il10) and TGFβ1 (Tgfb1) genes increased in the HBSS/WT mice after SCI and decreased significantly in the hMSC/WT mice. hMSC/Adcyap1mice exhibited a similar level of expression of Tgfb1 as that seen in HBSS/WT, while Il10 expression was not modified (Figure 4C, D). Low expression levels of the IL-4 gene (Il4) were seen in HBSS/WT on p.o. day 7; in contrast, drastically increased levels were seen in the hMSC/WT mice, while no expression was seen in the hMSC/Adcyap1mice (Figure 4E). We then assayed for arginase activity, an AAM marker, in WT mice with or without injected hMSCs and demonstrated that the activity was significantly increased in the hMSC/WT mice compared with the HBSS/WT mice (Figure 4F).
Figure 4
Implantation of hMSCs reduced mouse pro-inflammatory gene profiles and favored the M2-type alternative activating microglial/Mϕ (AAM) environment. Mouse cytokine gene expressions were determined in spinal cords after injury. hMSC-treated wild-type (wild) mice (black) manifested suppressed levels of mouse proinflammatory cytokines gene expression such as IL-1β (Il1b; (A)) and TNFα (Tnf; (B)) compared with HBSS-treated mice (white). The cell treatment also decreased IL-10 (Il10; (C)) and TGFβ (Tgfb1; (D)) levels. However, hMSC-treated wild-type mice exhibited increased levels of gene expression for anti-inflammatory cytokine such as IL-4 (Il4; (E)). For Il1b, Tnf, Tgfb1, and Il4, these were diminished in hMSC-treated Adcyap1
+/− (PA+/−) mice (gray) 7 days after SCI. Cont means intact spinal cord in wild-type mice. Data show mean ± SE (n = 8). *P < 0.05, **P < 0.01, ***P < 0.001 (Tukey post hoc test). Injection of hMSCs significantly increased arginase activity 7 days after SCI (F). Data show mean ± SE (n = 7). *P < 0.05 (Student’s t-test). HBSS Hank’s balanced salt solution, MSC mesenchymal stem/stromal cell, n.s. no significant, PA
Adcyap1 (PACAP gene) heterozygous mice.
Implantation of hMSCs reduced mouse pro-inflammatory gene profiles and favored the M2-type alternative activating microglial/Mϕ (AAM) environment. Mouse cytokine gene expressions were determined in spinal cords after injury. hMSC-treated wild-type (wild) mice (black) manifested suppressed levels of mouse proinflammatory cytokines gene expression such as IL-1β (Il1b; (A)) and TNFα (Tnf; (B)) compared with HBSS-treated mice (white). The cell treatment also decreased IL-10 (Il10; (C)) and TGFβ (Tgfb1; (D)) levels. However, hMSC-treated wild-type mice exhibited increased levels of gene expression for anti-inflammatory cytokine such as IL-4 (Il4; (E)). For Il1b, Tnf, Tgfb1, and Il4, these were diminished in hMSC-treated Adcyap1
+/− (PA+/−) mice (gray) 7 days after SCI. Cont means intact spinal cord in wild-type mice. Data show mean ± SE (n = 8). *P < 0.05, **P < 0.01, ***P < 0.001 (Tukey post hoc test). Injection of hMSCs significantly increased arginase activity 7 days after SCI (F). Data show mean ± SE (n = 7). *P < 0.05 (Student’s t-test). HBSS Hank’s balanced salt solution, MSC mesenchymal stem/stromal cell, n.s. no significant, PA
Adcyap1 (PACAP gene) heterozygous mice.
Genetic profile of hMSCs in the spinal cord
PACAP has been reported to induce the gene expression of some growth factors and Th2-type cytokines. We next determined selected human gene expression levels according to previous studies [22,31,32].Gene expression levels of growth factors such as the nerve growth factor (NGF), brain-derived neurotrophic factor (BDNF), and neurotrophin 3 (NTF3) were temporarily but significantly increased in the hMSC/WT mice compared with culturedhMSCs on p.o. days 3 or 7 (Figure 5A, B, C). The expression of genes for Th2-type cytokines such as IL4, IL10, and TGFB1 was also significantly increased on p.o. day 7 (Figure 5E, F, G). Moreover, we assayed TSG-6 (TNFAIP6) as well. TSG-6 from hMSCs has been reported to decrease inflammatory responses in peritoneal and traumatic brain injury [29,33] and was found here to be significantly increased in the spinal cord of hMSC/WT on p.o. day 7 compared to that in HBSS/WT (Figure 5D).
Figure 5
Human gene profiles after injection of hMSCs into injured spinal cord. Real-time RT-PCR assays with human-specific primers of naive hMSCs and injured spinal cord after injection of hMSCs into wild-type (wild) and Adcyap1
+/− (PA+/−) mice. Human BDNF (BDNF; (B)) and NT3 (NTF3; (C)) increased 3 days after SCI. Human NGF (NGF; (A)), TSG-6 (TNFAIP6; (D)), IL-4 (IL4; (E)), IL-10 (IL10; (F)), and TGFβ (TGFB1; (G)) increased 7 days after SCI. Injection of hMSCs into Adcyap1
+/− mice with SCI resulted in a decrease of human IL4 and TGFB1 expression. Naive means aliquot of cultured hMSCs before transplantation. Data are expressed as mean ± SE (n = 8). *P < 0.05, **P < 0.01 (Tukey post hoc test). Human ADCYAP1 and ADCYAP1R1 expression in hMSCs stimulated with IFNγ (in vitro) (H). hMSCs exposed to IFNγ for 48 h showed increased ADCYAP1 and ADCYAP1R1 expression. MΦ-like differentiated U937 was used as a positive control for the gene expression. BDNF brain-derived neurotrophic factor, B2M β2-microglobulin, NGF nerve growth factor, n.s. no significant, PA
Adcyap1 (PACAP gene) heterozygous mice.
Human gene profiles after injection of hMSCs into injured spinal cord. Real-time RT-PCR assays with human-specific primers of naive hMSCs and injured spinal cord after injection of hMSCs into wild-type (wild) and Adcyap1
+/− (PA+/−) mice. HumanBDNF (BDNF; (B)) and NT3 (NTF3; (C)) increased 3 days after SCI. HumanNGF (NGF; (A)), TSG-6 (TNFAIP6; (D)), IL-4 (IL4; (E)), IL-10 (IL10; (F)), and TGFβ (TGFB1; (G)) increased 7 days after SCI. Injection of hMSCs into Adcyap1
+/− mice with SCI resulted in a decrease of humanIL4 and TGFB1 expression. Naive means aliquot of culturedhMSCs before transplantation. Data are expressed as mean ± SE (n = 8). *P < 0.05, **P < 0.01 (Tukey post hoc test). HumanADCYAP1 and ADCYAP1R1 expression in hMSCs stimulated with IFNγ (in vitro) (H). hMSCs exposed to IFNγ for 48 h showed increased ADCYAP1 and ADCYAP1R1 expression. MΦ-like differentiated U937 was used as a positive control for the gene expression. BDNFbrain-derived neurotrophic factor, B2M β2-microglobulin, NGFnerve growth factor, n.s. no significant, PA
Adcyap1 (PACAP gene) heterozygous mice.In the hMSCs/Adcyap1mice, while gene expressions for growth factors and IL10 tended to decrease in Adcyap1mice, no significant differences were found to compare with the WT mice (Figure 5A, B, C, F). TNFAIP6 was not altered in the Adcyap1mice (Figure 5D); however, the IL4 and TGFB1 expressions were significantly down-regulated (Figure 5E, G).The possibility exists that PACAP acts directly on hMSCs, most likely via PAC1R. Although we initially assayed the ADCYAP1 and ADCYAP1R1 gene expressions in the spinal cord of hMSC/WT, these were not detected (data not shown). Expression of these genes was then examined in vitro on hMSC cultures where we added 10 ng/mL IFNγ (or vehicle alone for control) to mimic inflammatory conditions (Figure 5H). IFNγ-treated hMSCs exhibited increased ADCYAP1 and ADCYAP1R1 at 24 h, whereas the vehicle alone did not express the genes.
Discussions
We demonstrated here that when hMSCs were injected on p.o. day 1 into the spinal cord of WT mice, subsequent improvements were seen in various parameters which suggested to reduce SCI, but inviable hMSCs did not exert these effects. We observed also that these findings could not be reproduced in Adcyap1+/− mice. Because the retention of hMSCs was no different between the hMSC/WT and hMSC/Adcyap1+/− mice, we considered that the beneficial effect of hMSCs was due to cross-talk between the hMSCs and recipient tissues involving the action of PACAP. PACAP is a well-documented neuropeptide that suppresses cell death in ischemia, SCI, and other CNS disorders [15-17,19-21]. We previously demonstrated the exacerbation of cell death in Adcyap1+/− mice to compare with a WT mouse after ischemia and SCI [15,19]. In the present study, we however could not see significant difference in the neural damage in the HBSS-injected animals both for the WT and Adcyap1+/− mice. Therefore, it was considered that it may be only competing between an increase of the cell death in Adcyap1 and suppression of the cell death by hMSCs. Then, we examined the expression of recipient mouseAdcyap1 and Adcyap1r1 in the spinal cord after implanted hMSCs and demonstrated clearly that hMSC transplantation exhibited an increase of mouseAdcyap1. These findings strongly suggest that hMSCs may contribute to neuroprotection with PACAP induction.To determine how hMSCs induced Adcyap1 expression, we studied recipient mouse and donorhMSC gene expressions. So far, it is reported that PACAP has been induced by cyclic AMP, amyloid β-protein, CREB, progesterone, growth factors such as BDNF and NGF, and PACAP itself in vitro and in vivo experiments [31,32,34]. The expression of Adcyap1 might be also influenced by immune/inflammatory stimuli, in particular IL-4-related stimuli, given the decreased expression seen in SCIDmice after nerve injury [22]. In the present study, we observed that the hMSCs after transplantation increased growth factors such as NGF, BDNF, and NTF3. These have been suggested to increase Adcyap1 expression [31,32,34] and are released from hMSCs after implantation [35]. hMSCs increased an expression of anti-inflammatory cytokines such as IL4 and IL10, and TGFB1 as well. Indeed, mouseIl4 and an AAM marker, arginase activity, were greater in the hMSC/WT of the spinal cord. It also suggests that microenvironment PACAP expressions are produced in the spinal cord after hMSCs implantation.We next investigated how hMSCs suppressed SCI and how PACAP associated the effect. Several studies including ours suggested that hMSCs modulated the inflammatory response in recipient tissues, in particular that of microglia/MΦ activation. Microglia/MΦ show different types of activation - CAM, AAM, and DAM - depending on the cytokine stimuli involved [12,24]. After hMSCs implantation, a mouse proinflammatory cytokine gene such as Il1b and Tnf is significantly suppressed, suggesting that hMSCs modulated CAM in the spinal cord. We have reported that a hMSC-mixed culture with mouse microglial cells under IFNγ stimuli decreased the level of nitric oxide in a hMSC-number-dependent fashion [25]. We reported also that hMSCs increased the expression of TNFAIP6 in the present study and the traumatic brain injury model [33]. TNFAIP6 (also known as TSG-6) is a candidate factor to be involved in hMSCs’ anti-inflammation. TNFAIP6 increased from hMSCs after the implantation in the cardiac infarction, global ischemia, and peritoneal inflammation [11,29,36] and suppressed TNFα [29,36,37]. Conversely, hMSC implantation increased both human and mouseIL-4 gene expression and arginase activity in the recipient tissue, suggesting that hMSCs increased AAM [12,38,39] which consisted with global ischemia [11]. It has been reported that hMSCs increased CAM mediated by IL-10 and transforming growth factor β (TGFβ) [12] in a hippocampal organotypic culture [40] and sepsismouse [10].However, our observation showed a decrease in the Il10 and Tgfb1 expression, probably due to a decrease of proinflammatory cytokine. Like these, we suggest that hMSCs decreased CAM and inflammation and induced a resolution by AAM. Our results interestingly suggested that hMSCs modulated mouse cytokine profile at least via two different pathways: PACAP-dependent and PACAP-independent pathways. Il1b, Il4, and Tgfb1, and part of Tnf, were abolished in Adcyap1+/− mice, suggesting PACAP worked as a mediator between recipient tissue and donorhMSCs. On the other hand, Il10 and most of Tnf were independent with endogenous PACAP. We reported previously that Il4 and AAM decreased in Il1a- and Il1b-deficient mice after SCI although the injury area was suppressed in the deficient mice. Like these, the cytokines form a complicated network during the disease [24].We hypothesized first that PACAP acts downstream of hMSCs and that it does not influence the human gene profile. However, our results indicated that the endogenous mousePACAP might modulate the hMSCs’ function because hMSC/Adcyap1+/− mice influenced human gene expression. For example, IL4 and TGFB1 were influenced by PACAP, whereas TNFAIP6 and IL10 were not the same as mice gene profiles. These indicated that recipient tissue communicated between hMSCs and PACAP or a factor mediated by PACAP. To the present time, no studies have reported that hMSCs express PAC1R. We firstly examined humanADCYAP1 or ADCYAP1R1 in the implanted spinal cord. However, we failed to detect the gene expression. Then, we examined the in vitro study and observed slight increases of them after IFNγ stimulation in vitro. This result suggests that hMSCs could express PAC1R in response to inflammatory conditions, thus enabling hMSCs to communicate with recipient tissues via autocrine and paracrine processes partially mediated by PAC1R. The contribution of humanADCYAP1 in vivo is still unclear because we could not detect humanADCYAP1 in the spinal cord. Using RNA interference or other techniques, we need to clarify how much humanPACAP contributed to the communication. This synergistic cross-talk may enhance anti-inflammatory processes and give rise to an AAM environment. Further studies are needed to clarify the central player(s) in this communication and the complicated cytokine network.
Conclusions
A summarized putative schematic diagram of how hMSCs suppressed the effects of SCI is given in Figure 6. (a) Injected hMSCs migrate toward the peri-injury site. (b) There, the hMSCs might be activated or stimulated by inflammatory and/or injury stress-related factors including INFγ. (c) Stimulated hMSCs produce and release human anti-inflammatory factors such as TSG-6, IL-10, TGFβ, and growth factors. (d) Simultaneously, hMSCs and recipient tissues might co-produce IL-4 and induce an AAM environment. (e) Together with reinforcing the anti-inflammatory response, the environment and growth factors from hMSCs induce the production of recipient PACAP, which may then feed back to PAC1R on hMSCs and could further enhance the hMSCs’ rescue signals in a positive manner. (f) Finally, by cross-talk processes, these signals both in the donorhMSCs and in the recipient induce neural rescue and repair at the injury site.
Figure 6
Schematic illustration of the putative neuroprotective mechanism underlying the effect of cross-talk between hMSCs and PACAP in animals subjected to SCI (see the ‘Discussions’ section)
AAM alternatively activated (activating) macrophage, GFs growth factors, hMSCs human MSCs, IFNγ interferron-γ, IL interleikin, MG/MΦ microglia and/or macrophage, PACAP pituitary adenylate cyclase-activating polypeptide, PAC1R pituitary adenylate cyclase-activating polypeptide specific receptor, TGFβ transforming growth factor β, TNFα tumor necrosis factor α, TSG-6 tumor necrosis factor α-induced protein 6.
Schematic illustration of the putative neuroprotective mechanism underlying the effect of cross-talk between hMSCs and PACAP in animals subjected to SCI (see the ‘Discussions’ section)
AAM alternatively activated (activating) macrophage, GFs growth factors, hMSCs humanMSCs, IFNγ interferron-γ, IL interleikin, MG/MΦ microglia and/or macrophage, PACAPpituitary adenylate cyclase-activating polypeptide, PAC1Rpituitary adenylate cyclase-activating polypeptide specific receptor, TGFβ transforming growth factor β, TNFα tumor necrosis factor α, TSG-6tumor necrosis factor α-induced protein 6.
Authors: H Hashimoto; N Hagihara; K Koga; K Yamamoto; N Shintani; S Tomimoto; W Mori; Y Koyama; T Matsuda; A Baba Journal: J Neurochem Date: 2000-02 Impact factor: 5.372
Authors: H Hashimoto; N Shintani; K Tanaka; W Mori; M Hirose; T Matsuda; M Sakaue; J Miyazaki; H Niwa; F Tashiro; K Yamamoto; K Koga; S Tomimoto; A Kunugi; S Suetake; A Baba Journal: Proc Natl Acad Sci U S A Date: 2001-10-30 Impact factor: 11.205