| Literature DB >> 25860872 |
Yan-Liang Lin1, Li-Ting Ma1, Yi-Ru Lee1, Shih-Shun Lin2, Sheng-Yang Wang3, Tun-Tschu Chang4, Jei-Fu Shaw5, Wen-Hsiung Li6, Fang-Hua Chu7.
Abstract
Antrodia cinnamomea, a precious, host-specific brown-rot fungus that has been used as a folk medicine in Taiwan for centuries is known to have diverse bioactive compounds with potent pharmaceutical activity. In this study, different fermentation states of A. cinnamomea (wild-type fruiting bodies and liquid cultured mycelium) were sequenced using the next-generation sequencing (NGS) technique. A 45.58 Mb genome encoding 6,522 predicted genes was obtained. High quality reads were assembled into a total of 13,109 unigenes. Using a previously constructed pipeline to search for microRNAs (miRNAs), we then identified 4 predicted conserved miRNA and 63 novel predicted miRNA-like small RNA (milRNA) candidates. Target prediction revealed several interesting proteins involved in tri-terpenoid synthesis, mating type recognition, chemical or physical sensory protein and transporters predicted to be regulated by the miRNAs and milRNAs.Entities:
Mesh:
Substances:
Year: 2015 PMID: 25860872 PMCID: PMC4393119 DOI: 10.1371/journal.pone.0123245
Source DB: PubMed Journal: PLoS One ISSN: 1932-6203 Impact factor: 3.240
General features of RNA-seq library from different states of A. cinnamomea.
| MY | FB | MY+FB | |
|---|---|---|---|
| Number of raw reads | 21,670,612 | 27,691,800 | 49,362,412 |
| Number of clean reads | 19,875,544 | 25,296,502 | 45,172,046 |
| Number of contigs | 14,364 | 14,075 | 14,490 |
| Number of unigenes | - | - | 13,109 |
| Average length (bp) | 1,278 | 1,402 | 1,615 |
| N50 (bp) | 2,166 | 2,460 | 2,770 |
| Total length (bp) | 18,358,638 | 19,737,996 | 21,174,312 |
Fig 1Differentially expressed gene analysis of wild-type fruiting bodies and liquid cultured mycelium of A. cinnamomea.
F: wild-type fruiting bodies; M: liquid cultured mycelium. (a) Scatter plot of unigenes from A. cinnamomea RNA-seq. (b) Pie chart of the DEG distribution in wild-type fruiting bodies and liquid cultured mycelium. FDR <0.05 and fold change ≥2 or ≤0.5 were defined as differential expression.
Fig 2Gene ontology classification and KEGG annotation of DEGs between wild-type fruiting body and liquid cultured mycelium.
MY: unigenes upregulated in liquid cultured mycelium, FB: unigenes upregulated in wild-type fruiting bodies. (a) GO annotation. 2,282 unigenes from DEGs were analyzed with blast2GO to obtain the GO terms. And the GO term were classified with CateGOrizer and separated into three major categories. (b) KEGG annotation. 2,282 unigenes from DEGs were submitted to KAAS to get the KEGG metabolic pathway classification.
General features of small RNA sequencing from different states of A. cinnamomea.
| MY | FB | Both | |
|---|---|---|---|
| Number of raw reads | 14,947,280 | 23,628,123 | - |
| Number of clean reads | 10,879,926 | 18,291,833 | - |
| Average length (nt) | 28.4 | 26.7 | - |
| Number of unique grouped sRNA | 2,140,070 | 3,234,673 | - |
| a) Number of predicted miRNA (precursor number) with conserved miRNA | 58 (1) | 35 (1) | 128 (2) |
| b) Number of predicted novel milRNA (precursor number) | 13 (8) | 46 (16) | 4 (4) |
Fig 3General features of the sRNAs and predicted miRNA in A. cinnamomea.
(a) length distribution of total clean reads of sRNA library from MY and FB, (b) 5′ end nucleotide frequency of sRNAs from MY and FB, (c) length distribution of predicted novel milRNAs, (d) 5′ end nucleotide frequency of predicted novel milRNAs.
Conserved miRNA candidates against the miRBase database.
| Lib. | miR name | Sequence (5′ -3′) | Reads |
|---|---|---|---|
| F | miR-26 | UUCAAGUAAUCCAGGAUAGG | 2 |
| B | miR-27d | UUCACAGUGGCUAAGUUC | 6 |
| M | miR-545 | AUCAACAAACAUUUAUUGUGUG | 4 |
| B | miR-574 | UGAGUGUGUGUGUGUGAGUGUGU | 20 |
M: library from A. cinnamomea WSY-01 mycelium (MY), F: wild-type fruiting body (FB), B: in both library.
Fig 4Secondary hairpin structures of milRNA from A. cinnamomea predicted by RNAfold.
The milRNAs were sorted by the source of the precursors. milRNAs are marked in bold red and the reads are listed below.
Predicted novel milRNA candidates in A. cinnamomea.
| Lib. | milRNA acc. | contig_ID | milR sequence (5′-3′) | reads |
|---|---|---|---|---|
| F | aci-milR-1 | FB_M2436 | UACCCGACUGGAGGACGAGAUU | 79 |
| F | aci-milR-2a-1 | FB_M2455 | CUGCGAUGGAUGACUGCGACGACGAU | 523 |
| F | aci-milR-2a-3 | FB_M2455 | CCGCGAUGGAUGACUGCGACGA | 182 |
| F | aci-milR-2a-4 | FB_M2455 | CUGCGGUGGAUGACUGCGACGA | 260 |
| F | aci-milR-2a-10 | FB_M2455 | CUGCGAUAGAUGACUGCGACGACG | 12 |
| F | aci-milR-2a-13 | FB_M2455 | CUGCGAUGGAUGACUGCGACGACGC | 88 |
| F | aci-milR-2a-15 | FB_M2455 | CGUUGUUGUCAGUUGUACAUCGCACU | 19 |
| F | aci-milR-2b-2 | FB_M2455 | UCGUUGUUGUCAGUUGUACAUCG | 109 |
| F | aci-milR-2b-3 | FB_M2455 | UCGUUGUUGUCAGUUGUACAUCGCA | 61 |
| F | aci-milR-2b-4 | FB_M2455 | UCGUUGUUGUCAGUUGUACAUCGCAC | 34 |
| F | aci-milR-2b-6 | FB_M2455 | GUUGUUGUCAGUUGUACAUCGCACU | 57 |
| F | aci-milR-2b-7 | FB_M2455 | CGUUGUUGUCAGUUGUACAUCGCACU | 30 |
| F | aci-milR-2b-8 | FB_M2455 | GUUGUUGUCAGUUGUACAUCGCACUA | 42 |
| M | aci-milR-3a-1 | FB_M4358 | GAAACGGACGUCAGGACCAG | 20 |
| M | aci-milR-3a-2 | FB_M4358 | GCGAAACGGACGUCAGGACCAGA | 11 |
| M | aci-milR-3a-3 | FB_M4358 | AGCGAAACGGACGUCAGGACCAA | 51 |
| B | aci-milR-3b-1 | FB_M4358 | CGGUCCUGGACGUCCGUUUACGC | 2169 |
| F | aci-milR-3b-5 | FB_M4358 | CGGUCCUGGACGUCCGUUUACG | 900 |
| F | aci-milR-3b-6 | FB_M4358 | GUCCUGGACGUCCGUUUACGCA | 87 |
| F | aci-milR-3b-8 | FB_M4358 | CGGUCCUGGGCGUCCGUUUACGC | 13 |
| M | aci-milR-4 | FB_M4900 | UGCGAUCGGACUUUUUGGAA | 31 |
| F | aci-milR-5 | FB_M7084 | AAGAAUAGCAAAGAGUGAACAG | 53 |
| F | aci-milR-6a-1 | FB_M7816 | AUCGGCAGCGUAUGGGGAUGAUG | 849 |
| F | aci-milR-6a-3 | FB_M7816 | AUCGGCAGCGUAUGGGGAUGAUGC | 39 |
| F | aci-milR-6b-1 | FB_M7816 | CGCGAUCCUCAUGCGCUGUCGA | 592 |
| F | aci-milR-6b-3 | FB_M7816 | CGCGAUCCUCAUGCGCUGUCGAU | 19 |
| F | aci-milR-6b-5 | FB_M7816 | CGAUCCUCAUGCGCUGUCGAUGC | 211 |
| F | aci-milR-6b-7 | FB_M7816 | CGAUCCUCAUGCGCUGUCGAUGCA | 17 |
| F | aci-milR-7-3 | FB_M8066 | CAUCUAUGUUAAGCUAAUUGGCUUUAGUU | 14 |
| M | aci-milR-9 | FB_M9694 | UGGCUUCUCUCUAUCCUCGCAG | 10 |
| M | aci-milR-10-1 | FB_M11279 | UCUGGGUUCUUCCUCUCAUAUGA | 35 |
| M | aci-milR-10-2 | FB_M11279 | UCUGGGUUCUUCCUCUCAUAUGU | 27 |
| F | aci-milR-11 | FB_M13321 | UUCCAUCAGCUUCUUGUAAGGCU | 47 |
| F | aci-milR-12 | FB_M13515 | GGUCUUUCUUUGGUGAUACGAGA | 21 |
| M | aci-milR-13 | FB_M15202 | CAUUAGUUAAUAGGAUCAAGAC | 12 |
| F | aci-milR-14a-2 | FB_M19318 | GUCCAGGGGGCCCCUCAGUAUC | 13 |
| F | aci-milR-14a-3 | FB_M19318 | GGUCCAGGGGGCCCCUCAGUAUC | 25 |
| B | aci-milR-14b-1 | FB_M19318 | UACUGAGGGGUCGUCUAGACAGA | 25 |
| F | aci-milR-14b-2 | FB_M19318 | UACUGAGGGGUCGUCUAGACAGU | 9624 |
| M | aci-milR-15a-1 | FB_M20087 | CCUUUAUCGUCUUUUUACUUAUUCAAUG | 25 |
| F | aci-milR-15a-3 | FB_M20087 | CCUUUAUCGUCUUUUUACUUAUU | 53 |
| M | aci-milR-15b-1 | FB_M20087 | GACAUUGUGAAAAGACAUAGAGGGU | 38 |
| F | aci-milR-15b-2 | FB_M20087 | UUGUGAAAAGACAUAGAGGGUG | 43 |
| F | aci-milR-15b-3 | FB_M20087 | UGACAUUGUGAAAAGACAUAGAGGG | 42 |
| F | aci-milR-15b-4 | FB_M20087 | UUUGACAUUGUGAAAAGACAUAGAGG | 22 |
| B | aci-milR-15c-1 | FB_M20087 | UAUCGAUCCUUUAGUCCCUC | 14 |
| F | aci-milR-16-2 | FB_M24188 | AGGAUGCUUACGAAUACGAUGGA | 12 |
| M | aci-milR-17a-1 | FB_M28577 | UCUGAUUGUCUUCCUUCUCAUGG | 30 |
| M | aci-milR-17a-2 | FB_M28577 | UCUGAUUGUCUUCCUUCUCAUGGAC | 27 |
| F | aci-milR-17a-3 | FB_M28577 | UCUGAUUGUCUUCCUUCUCAUGGA | 16 |
| B | aci-milR-17b-1 | FB_M28577 | UACCAUGAGAAUGGAAGAUGCUCAGA | 53 |
| F | aci-milR-17b-2 | FB_M28577 | UACCAUGAGAAUGGAAGAUGCUCA | 55 |
| F | aci-milR-17b-3 | FB_M28577 | CAUGAGAAUGGAAGAUGCUCAGACC | 26 |
| F | aci-milR-17c-1 | FB_M28577 | AAGUACCAGAGCACAGUCCAUGA | 200 |
| F | aci-milR-17c-2 | FB_M28577 | AAGUACCAGAGCACAGUCCAUGAG | 21 |
| F | aci-milR-18 | FB_M33490 | UUGCGUUCGACUUGUUCUCCC | 105 |
| M | aci-milR-19a-1 | FB_M33646 | ACCUCUAGUGCAGGUCACAUACU | 114 |
| F | aci-milR-19a-2 | FB_M33646 | CACCUCUAGUGCAGGUCACAUACU | 14 |
| F | aci-milR-19b | FB_M33646 | UAUGUGACCUACAAUAGAGGUGC | 13 |
| F | aci-milR-20 | FB_M36986 | CGUUUGGCUCGUCUCUUCGUGCUCU | 311 |
| F | aci-milR-21-1 | FB_M47647 | GUAAAGUUAAGAUGAAUUAAAGC | 13 |
| F | aci-milR-21-2 | FB_M47647 | UGUAAAGUUAAGAUGAAUUAAAGC | 13 |
| F | aci-milR-21-3 | FB_M47647 | AAAGUUAAGAUGAAUUAAAGCUAGA | 13 |
M: A. cinnamomea WSY-01 mycelium (MY) library, F: wild-type fruiting body library (FB), B: in both libraries.
Fig 5milRNAs identified in this study with Northern blot.
Target prediction of conserved miRNA and novel predicted milRNA candidates.
| Lib. | milR_Acc. | Target_Acc. | Target_Annotation | E-value | F_RPKM | M_RPKM | Inhibition |
|---|---|---|---|---|---|---|---|
| M | aci-miR-545 | Contig_255 | EIW57936.1| alpha/beta-hydrolase | 2E-122 | 63.66434 | 9.62542 | Cleavage |
| M | aci-miR-545 | Contig_7265 | no hit | 10.59487 | 0 | Translation | |
| M | aci-milR-4 | Contig_3482 | CCL99720.1| predicted protein | 4E-93 | 45.81264 | 20.67553 | Cleavage |
| M | aci-milR-4 | First_Contig1064 | no hit | 18.17605 | 2.42455 | Cleavage | |
| M | aci-milR-9 | First_Contig840 | EIW59605.1| ERG4/ERG24 ergosterol biosynthesis protein | 2E-45 | 143.57422 | 60.28609 | Cleavage |
| M | aci-milR-9 | Contig_758 | EIM88703.1| Cloroperoxidase | 1E-59 | 237.03534 | 34.76652 | Translation |
| M | aci-milR-9 | Contig_5374 | CCM01456.1| predicted protein | 0 | 32.89911 | 11.19648 | Cleavage |
| M | aci-milR-10-1 | Contig_6667 | EJF59108.1| fungal pheromone STE3G-protein-coupled receptor | 3E-138 | 9.55659 | 0 | Cleavage |
| M | aci-milR-10-1 | Contig_93 | EIW64472.1| DUF726-domain-containing protein | 0 | 58.37772 | 28.47582 | Translation |
| M | aci-milR-10-2 | Contig_6667 | EJF59108.1| fungal pheromone STE3G-protein-coupled receptor | 3E-138 | 9.55659 | 0 | Cleavage |
| M | aci-milR-10-2 | Contig_93 | EIW64472.1| DUF726-domain-containing protein | 0 | 58.37772 | 28.47582 | Translation |
| M | aci-milR-15a-1 | First_Contig654 | no hit | 15.24887 | 1.06614 | Cleavage | |
| M | aci-milR-15a-1 | Contig_705 | CCL98992.1| predicted protein | 2E-134 | 28.36044 | 8.18889 | Cleavage |
| M | aci-milR-17a-1 | Contig_5351 | EIW58650.1| hypothetical protein TRAVEDRAFT_58801 | 5E-128 | 18.40338 | 1.96923 | Cleavage |
| M | aci-milR-17a-1 | Contig_556 | EIW61368.1| cysteine proteinase | 0 | 76.18506 | 31.03941 | Translation |
| M | aci-milR-17a-1 | Contig_6059 | AAC48526.1| gastric mucin | 9E-6 | 21.82072 | 0.65503 | Translation |
| M | aci-milR-17a-2 | Contig_5351 | EIW58650.1| hypothetical protein TRAVEDRAFT_58801 | 5E-128 | 18.40338 | 1.96923 | Cleavage |
| M | aci-milR-17a-2 | Contig_556 | EIW61368.1| cysteine proteinase | 0 | 76.18506 | 31.03941 | Translation |
| F | miR-26 | Contig_1702 | hypothetical protein | 0 | 23.28213 | 52.18297 | Cleavage |
| F | miR-26 | Contig_613 | EIW62060.1| Pkinase-domain-containing protein | 0 | 18.55729 | 56.07599 | Cleavage |
| F | miR-26 | Contig_4641 | XP_001873789.1| glycosyltransferase family 31 protein | 0 | 21.25023 | 52.95106 | Translation |
| F | aci-milR-1 | Contig_7086 | CCM04121.1| predicted protein | 5E-43 | 17.73866 | 36.88036 | Cleavage |
| F | aci-milR-2a-12 | Contig_2620 | CCM04026.1| predicted protein | 7E-173 | 69.71288 | 186.24744 | Cleavage |
| F | aci-milR-2a-14 | First_Contig419 | EJF62899.1| MFS general substrate transporter | 1E-19 | 18.8734 | 54.52335 | Cleavage |
| F | aci-milR-2a-15 | Contig_4981 | EIW62923.1| TRP-domain-containing protein | 0 | 13.42948 | 58.08298 | Translation |
| F | aci-milR-2a-15 | Contig_2620 | CCM04026.1| predicted protein | 7E-173 | 69.71288 | 186.24744 | Cleavage |
| F | aci-milR-2a-16 | Contig_2620 | CCM04026.1| predicted protein | 7E-173 | 69.71288 | 186.24744 | Cleavage |
| F | aci-milR-2b-2 | Contig_4981 | EIW62923.1| TRP-domain-containing protein | 0 | 13.42948 | 58.08298 | Translation |
| F | aci-milR-2b-3 | Contig_4981 | EIW62923.1| TRP-domain-containing protein | 0 | 13.42948 | 58.08298 | Translation |
| F | aci-milR-2b-4 | Contig_4981 | EIW62923.1| TRP-domain-containing protein | 0 | 13.42948 | 58.08298 | Translation |
| F | aci-milR-5 | Contig_9897 | XP_003881743.1| Proteophosphoglycan ppg4, related | 4E-8 | 2.5514 | 17.05794 | Cleavage |
| F | aci-milR-6a-1 | Contig_1134 | EJF66508.1| ATPase V1 complex subunit C | 0 | 33.39784 | 79.05716 | Translation |
| F | aci-milR-6a-3 | Contig_1134 | EJF66508.1| ATPase V1 complex subunit C | 0 | 33.39784 | 79.05716 | Translation |
| F | aci-milR-6b-1 | Contig_2607 | EJF58244.1| MFS sugar transporter | 0 | 62.0854 | 237.81036 | Cleavage |
| F | aci-milR-6b-3 | Contig_2607 | EJF58244.1| MFS sugar transporter | 0 | 62.0854 | 237.81036 | Cleavage |
M: conserved miRNAs and novel predicted milRNAs from mycelium (MY), F: from fruiting bodies (FB).
Fig 6RT-PCR of DCL-2 (Contig_799), QDE-2 (argonaute protein, Contig_2130), DCL-1 (Contig_5359) and 18s rRNA genes in A. cinnamomea.