Literature DB >> 25848744

The asymmetry of female meiosis reduces the frequency of inheritance of unpaired chromosomes.

Daniel B Cortes1, Karen L McNally1, Paul E Mains2, Francis J McNally1.   

Abstract

Trisomy, the presence of a third copy of one chromosome, is deleterious and results in inviable or defective progeny if passed through the germ line. Random segregation of an extra chromosome is predicted to result in a high frequency of trisomic offspring from a trisomic parent. Caenorhabditis elegans with trisomy of the X chromosome, however, have far fewer trisomic offspring than expected. We found that the extra X chromosome was preferentially eliminated during anaphase I of female meiosis. We utilized a mutant with a specific defect in pairing of the X chromosome as a model to investigate the apparent bias against univalent inheritance. First, univalents lagged during anaphase I and their movement was biased toward the cortex and future polar body. Second, late-lagging univalents were frequently captured by the ingressing polar body contractile ring. The asymmetry of female meiosis can thus partially correct pre-existing trisomy.

Entities:  

Keywords:  C. elegans; cell biology; chromosomes; genes; meiosis; polar body; trisomy

Mesh:

Year:  2015        PMID: 25848744      PMCID: PMC4412107          DOI: 10.7554/eLife.06056

Source DB:  PubMed          Journal:  Elife        ISSN: 2050-084X            Impact factor:   8.140


Introduction

During female meiosis, a G2 oocyte containing four genome copies undergoes two asymmetric cell divisions depositing one genome in a single haploid egg, while the other three genomes are segregated into polar bodies. These divisions are mediated by meiotic spindles that are asymmetrically positioned against the oocyte cortex with the pole-to-pole axis of the spindle perpendicular to the cortex. Both the inheritance of only one of the four genome copies and the distinct perpendicular positioning of the meiotic spindle are remarkably conserved among animal phyla suggesting a selective advantage (Maro and Verlhac, 2002; Fabritius et al., 2011a; Maddox et al., 2012). Several advantages of asymmetric meiosis have been suggested previously, yet none are applicable to all animals. Asymmetric meiotic spindle positioning maximizes the volume of a single egg, helps prevent interference with the meiotic spindle by the sperm aster (McNally et al., 2012), and preserves predetermined embryonic polarity gradients. Here, we suggest a previously unrecognized advantage of asymmetric meiosis, the ability of meiotic spindles to correct trisomy by preferentially depositing the extra chromosome copy into a polar body. Accurate segregation of homologous chromosomes to opposite spindle poles depends on a physical attachment, or chiasma, between homologous chromosomes. A chiasma consists of a crossover, which holds the two homologous chromosomes together in a bivalent so that kinetochores can be properly oriented toward opposite poles (Moore and Orr-Weaver, 1998; Miller et al., 2013). When a chiasma does not form, univalent chromosomes may maintain sister cohesion and move to poles independent of their homologs at anaphase I as can occur in Saccharomyces cerevisiae (Buonomo et al., 2000). If a univalent chromosome biorients, loses cohesion, and segregates sister chromatids at anaphase I (e.g., Nicklas and Jones, 1977; Lemaire-Adkins and Hunt, 2000; Kouznetsova et al., 2007), the resulting single chromatid will segregate randomly at anaphase II. Random segregation of homologs at anaphase I or single chromatids at anaphase II should result in equal frequencies of haplo and diplo ova in the case of a trisomy (Figure 1A) and equal frequencies of nullo and diplo ova in the case of a crossover failure.
Figure 1.

Trisomy correction during meiosis I.

(A) Illustration showing expected outcomes of female meiosis in XXX wild-type worms, assuming the extra univalent X (red) does not lose cohesion (yellow) between sister chromatids during anaphase I and assuming random segregation. (B) Illustration of a spindle with chromosomes at the metaphase plate with poles marked ‘P’ (left) and a projection of the cross-sectional view down the pole-to-pole axis at the metaphase plate (right). (C–E) Z projections of fixed meiotic embryos viewed down the pole-to-pole spindle axis. Meiotic embryos from XXX wild-type mothers were stained with DAPI and anti-tubulin antibody. (C) Metaphase I spindles with 7 chromosomes; right images of X-fluorescence in situ hybridization (FISH) show two X chromosomes on the spindle. See also Supplementary file 2. (D) Metaphase II spindles with 6 chromosomes; right images of X-FISH show one X on the spindle and 2–3 foci in the polar body. See also Supplementary file 3. (E) Metaphase II spindle with 7 chromosomes. (F) Frequency of each spindle class among the progeny of XXX wild-type mothers. Insets show polar bodies, marked by asterisks, which were used to identify metaphase II spindles. Bar = 5 μm.

DOI: http://dx.doi.org/10.7554/eLife.06056.003

Trisomy correction during meiosis I.

(A) Illustration showing expected outcomes of female meiosis in XXX wild-type worms, assuming the extra univalent X (red) does not lose cohesion (yellow) between sister chromatids during anaphase I and assuming random segregation. (B) Illustration of a spindle with chromosomes at the metaphase plate with poles marked ‘P’ (left) and a projection of the cross-sectional view down the pole-to-pole axis at the metaphase plate (right). (C–E) Z projections of fixed meiotic embryos viewed down the pole-to-pole spindle axis. Meiotic embryos from XXX wild-type mothers were stained with DAPI and anti-tubulin antibody. (C) Metaphase I spindles with 7 chromosomes; right images of X-fluorescence in situ hybridization (FISH) show two X chromosomes on the spindle. See also Supplementary file 2. (D) Metaphase II spindles with 6 chromosomes; right images of X-FISH show one X on the spindle and 2–3 foci in the polar body. See also Supplementary file 3. (E) Metaphase II spindle with 7 chromosomes. (F) Frequency of each spindle class among the progeny of XXX wild-type mothers. Insets show polar bodies, marked by asterisks, which were used to identify metaphase II spindles. Bar = 5 μm. DOI: http://dx.doi.org/10.7554/eLife.06056.003 Deviations from random segregation are suggested by observations of X chromosomes in Caenorhabditis elegans. In C. elegans, the single unpaired X chromosome from an XXX mother is inherited with unexpectedly low frequency with twice as many haploX ova produced as diploX ova (Hodgkin et al., 1979). HIM-8 is a zinc finger protein that binds to specific DNA sequences that are enriched on the X chromosome. him-8 mutants have a pairing defect that is completely specific for the X chromosome, resulting in two X univalents and five autosomal bivalents in 95% of diakinesis oocytes (Phillips et al., 2005). If the two X univalents segregated randomly, him-8 mutants would be expected to produce equal frequencies of nulloX ova and diploX ova. However, Hodgkin et al. (1979) demonstrated a fivefold preponderance of nulloX ova over diploX ova in him-8. Using sex-reversed him-8 XX males, these authors showed the opposite effect in spermatogenesis. Rather than producing the 50% haploX, 25% diploX, 25% nulloX sperm expected from random segregation, him-8 XX males produced 86% haploX, 3% diploX, 11% nulloX sperm, indicating symmetric distribution of univalents during male meiosis. Thus, achiasmate maternal X chromosomes are inherited with unexpectedly low frequency in worms. Five mechanisms might reduce the frequency of trisomic offspring from trisomic or him-8 mothers. First, trisomic embryos might die during embryonic development resulting in undercounting of XXX offspring. This is unlikely in C. elegans because both XXX and him-8 mutant mothers produce a very low frequency of dead embryos (Hodgkin et al., 1979; Supplementary file 1). A second possibility is that mitotic non-disjunction in the XXX mother results in a mosaic gonad that contains both diploX and triploX oocytes. Selective apoptosis of XXX germ line cells (Bhalla and Dernburg, 2005) would then enrich for XX germ line cells. This does not contribute to the segregation bias in C. elegans, as the most mature diakinesis oocytes in him-8 and wild-type XXX worms have 7 rather than 6 DAPI-staining bodies (Phillips et al., 2005; this study). A third possibility is that a univalent present during metaphase I or a single chromatid present during metaphase II would be broken or otherwise degraded during anaphase. A fourth possibility is that many XXX progeny look normal because of the stochastic nature of dosage compensation and thus are undercounted. A fifth possibility is that univalent chromosomes present at metaphase I are preferentially placed in the first polar body. Here, we demonstrate that indeed biased deposition of univalent X chromosomes into the first polar body reduces the frequency of trisomic zygotes resulting from oocytes with unpaired X chromosomes.

Results

XXX wild-type oocytes preferentially lose the achiasmate X chromosome between metaphase I and metaphase II

Elimination of the extra chromosome from an oocyte starting with a trisomy would result in rescue to a euploid state. It has previously been shown that C. elegans XXX wild-type oocytes have a paired bivalent X and an unpaired univalent X chromosome in pachytene (Goldstein, 1984). We picked wild-type XXX adult hermaphrodites from the progeny of an XXX strain (AV494, Mlynarczyk-Evans et al., 2013) based on their characteristic dumpy morphology as described by Hodgkin et al. (1979). Meiotic embryos from XXX mothers were fixed and stained for microtubules and DNA. Chromosomes are well separated by bundles of microtubules during C. elegans female meiotic metaphase. This unique morphology facilitates counting of individual chromosomes on the metaphase plate when viewed down the pole-to-pole axis of the spindle (Figure 1B). We found that 100% of metaphase I meiotic embryos from XXX wild-type worms had 7 DAPI-staining bodies on the spindle (Figure 1C,F), consistent with 6 bivalents and a single univalent X. Two chromosomes were labeled with an X-specific fluorescence in situ hybridization (FISH) probe in these spindles (Figure 1C, Supplementary file 2). This result shows that a mosaic gonad resulting from mitotic nondisjunction cannot explain the low frequency of XXX offspring from XXX worms. If the univalent segregated randomly during anaphase I, 50% of metaphase II spindles should have 6 DAPI-staining bodies (6 bivalents) and 50% should have 7 DAPI-staining bodies (6 bivalents and 1 univalent). Instead, 71% of metaphase II spindles contained only 6 DAPI-staining bodies and only 29% contained 7 DAPI-staining bodies (Figure 1D–F). These frequencies match the 2:1 ratio of X to XX ova previously interpreted from genetic studies (Hodgkin et al., 1979) and are significantly different than the 50% expected from random segregation (one-tailed p = 0.004, Pearson's chi-squared test). This result eliminates the possibilities that XXX mothers have many XXX offspring that are undercounted due to incomplete penetrance of the XXX dumpy phenotype or that hermaphrodite nulloX sperm contributes significantly to the low frequency of XXX self-progeny. The finding that all assayed metaphase I spindles had 7 chromosomes also indicates that our method of identifying XXX worms as dumpy individuals is accurate and the high frequency of metaphase II spindles with 6 chromosomes is not a result of misidentifying diploid worms as XXX worms. FISH with an X-specific probe revealed that in 6/6 metaphase II embryos with only 6 DAPI-staining bodies, a single hybridization signal was present in the spindle and 2–3 hybridization signals were present in the polar body (Figure 1D; Supplementary file 3). Because only a single X-hybridization signal was observed in the first polar body in 5/5 spindles from diploids, these results demonstrate that single X univalents are deposited in the first polar body with greater than 50% frequency.

X and V univalents are frequently deposited in the first polar body

To further investigate the mechanism leading to preferential loss of univalents during meiosis I, we utilized him-8 worms as a more tractable model. It has previously been shown that diakinesis stage him-8 oocytes have 5 autosomal bivalents and two X univalents (Phillips et al., 2005). If segregation of the two X univalents was random, these worms should produce equal numbers of nulloX and diploX ova. Instead, him-8 mutants produce a fivefold higher frequency of nulloX ova over diploX ova (Hodgkin et al., 1979), indicating that both maternal X univalents are lost at some time after diakinesis in a large fraction of embryos. To determine when maternal X univalents are preferentially lost, we imaged both live embryos within him-8 worms expressing GFP::tubulin and mCherry::histone (Figure 2A–E) and also fixed embryos stained with DAPI and anti-tubulin antibodies (Figure 2F–J). We assayed the number of chromosomes (defined here as DAPI-staining or mCherry:histone-positive bodies that would include univalents and bivalents) present at metaphase of meiosis I and II (Figure 2K). At meiosis I metaphase, 7 chromosomes were present in 96% of him-8 embryos (Figure 2B,K), with the remainder having 6 chromosomes. If the two univalents segregated randomly without losing cohesion, 25% of metaphase II spindles would be expected to have 5 autosomes and no X, 50% would have 5 autosomes and 1 X, and 25% would have 5 autosomes and 2 X chromosomes. Instead, 40% of him-8 metaphase II embryos had 5 chromosomes, 55% had 6 chromosomes, and only 5% had 7 chromosomes (Figure 2K). These frequencies differ significantly from those expected from unbiased segregation (chi-square test, two-tailed p < 0.0001), closely match the ratio of nulloX to diploX ova inferred by Hodgkin et al. (1979) and support the hypothesis that the majority of X univalents are eliminated between metaphase I and metaphase II. These maternal chromosome counts are also unaffected by nulloX or diploX sperm that might contribute to phenotype-based progeny counts.
Figure 2.

X univalents are preferentially lost between metaphase I and metaphase II in him-8 mutants.

Z projections of living (A–E) and fixed (F–J) C. elegans meiotic embryos viewed down the pole-to-pole spindle axis at metaphase I (A, B, F, G) or metaphase II (C, D, E, H, I, J). mCherry::Histone H2B and GFP::tubulin label the chromosomes and spindle, respectively, in live embryos. Fixed embryos were stained with DAPI, anti-tubulin antibody, and a LacO FISH probe that recognizes a LacO array integrated on the X chromosome. Asterisks indicate polar bodies. Insets show polar bodies that did not fit in the image frame. In (E), ‘s’ denotes a sperm outside of the embryo. Percentages are shown for each outcome (K, L). Bar = 5 μm.

DOI: http://dx.doi.org/10.7554/eLife.06056.004

Z projections of fixed meiotic embryos viewed down the pole-to-pole spindle axis. Embryos were stained with DAPI, anti-tubulin antibody, and a LacO FISH probe that recognizes a LacO array integrated on chromosome V. This array is larger than the array inserted on X; thus, the foci are larger than those shown in Figure 2. (A) Metaphase I embryo with 7 DAPI chromosomes and two LacO (V) univalents. (B) Metaphase II embryo with 5 DAPI chromosomes and no LacO (V) chromosome on the spindle and two in the first polar body. (C) Metaphase II embryo with 6 DAPI chromosomes and one LacO (V) chromosome on the spindle and one in the first polar body. (D) Early anaphase II spindle with 2 LacO (V) chromosomes in the spindle and none in the first polar body. In (B) and (C), polar bodies are marked by asterisks. In (D), the polar body is shown as an inset because it was in a distant focal plane. (E) Quantification of the frequencies of each class. (F) Diakinesis chromosome counts from the zim-2 and him-8 strains bearing Lac operator arrays. Left panel shows representative zim-2 diakinesis nucleus with 6 chromosomes, right two panels show two examples of zim-2 diakinesis nuclei with 7 chromosomes. Bar = 5 µm.

DOI: http://dx.doi.org/10.7554/eLife.06056.005

X univalents are preferentially lost between metaphase I and metaphase II in him-8 mutants.

Z projections of living (A–E) and fixed (F–J) C. elegans meiotic embryos viewed down the pole-to-pole spindle axis at metaphase I (A, B, F, G) or metaphase II (C, D, E, H, I, J). mCherry::Histone H2B and GFP::tubulin label the chromosomes and spindle, respectively, in live embryos. Fixed embryos were stained with DAPI, anti-tubulin antibody, and a LacO FISH probe that recognizes a LacO array integrated on the X chromosome. Asterisks indicate polar bodies. Insets show polar bodies that did not fit in the image frame. In (E), ‘s’ denotes a sperm outside of the embryo. Percentages are shown for each outcome (K, L). Bar = 5 μm. DOI: http://dx.doi.org/10.7554/eLife.06056.004

zim-2 embryos also deposit unpaired chromosome V univalents into the first polar body.

Z projections of fixed meiotic embryos viewed down the pole-to-pole spindle axis. Embryos were stained with DAPI, anti-tubulin antibody, and a LacO FISH probe that recognizes a LacO array integrated on chromosome V. This array is larger than the array inserted on X; thus, the foci are larger than those shown in Figure 2. (A) Metaphase I embryo with 7 DAPI chromosomes and two LacO (V) univalents. (B) Metaphase II embryo with 5 DAPI chromosomes and no LacO (V) chromosome on the spindle and two in the first polar body. (C) Metaphase II embryo with 6 DAPI chromosomes and one LacO (V) chromosome on the spindle and one in the first polar body. (D) Early anaphase II spindle with 2 LacO (V) chromosomes in the spindle and none in the first polar body. In (B) and (C), polar bodies are marked by asterisks. In (D), the polar body is shown as an inset because it was in a distant focal plane. (E) Quantification of the frequencies of each class. (F) Diakinesis chromosome counts from the zim-2 and him-8 strains bearing Lac operator arrays. Left panel shows representative zim-2 diakinesis nucleus with 6 chromosomes, right two panels show two examples of zim-2 diakinesis nuclei with 7 chromosomes. Bar = 5 µm. DOI: http://dx.doi.org/10.7554/eLife.06056.005 To confirm that the two chromosomes lost between these stages were indeed the X univalents, we used FISH with a lac operator probe to detect a multi-copy lac operator array integrated on the X chromosomes in a him-8 background (Figure 2F–J). FISH revealed two X univalents and 7 total DAPI-staining bodies on 93% of all the him-8 metaphase I plates (Figure 2G,L). At metaphase II, FISH revealed at least two X hybridization foci in the first polar body and none on the metaphase plate when the spindle had 5 DAPI-staining bodies (Figure 2H). When 6 DAPI-staining bodies were present on the metaphase II plate, we always observed one X hybridization focus each on the metaphase plate and in the first polar body (Figure 2I). Finally, metaphase II embryos containing 7 DAPI-staining bodies had two X hybridization foci on the metaphase plate and none in the first polar body (Figure 2J). Together, these results demonstrate that both achiasmate X univalents are deposited into the first polar body in 40% of him-8 embryos as compared with the 25% expected from random segregation. To test whether achiasmate autosomes are also placed in the first polar body with higher than random frequency, we analyzed a strain with a lac operator array integrated on chromosome V and bearing a loss of function mutation in the him-8 homolog zim-2, which contributes to chromosome V pairing (Phillips and Dernburg, 2006). Unlike the situation with him-8 and pairing of the X, redundancy between ZIM proteins may contribute to chromosome V pairing. Phillips and Dernburg reported only 72% of diakinesis oocytes with 7 rather than 6 DAPI-staining bodies in a zim-2 mutant, and our zim-2 strain with lacO(V) had only 62% of diakinesis oocytes with 7 DAPI-staining bodies (Figure 2—figure supplement 1F). FISH revealed two distinct chromosome V hybridization foci and 7 DAPI-staining bodies on 41% of metaphase I spindles (Figure 2—figure supplement 1A,E). Starting with 41% achiasmate V's, random segregation should yield 10% of metaphase II embryos with both V's in the first polar body (25% of 41%). Instead, FISH revealed 27% of metaphase II embryos had five DAPI-staining bodies on the metaphase plate and chromosome V hybridization foci only in the first polar body (Figure 2—figure supplement 1B,E). Likewise, random segregation of achiasmate V's should yield 10% metaphase II spindles with 7 DAPI-staining bodies on the metaphase II spindle, two distinct chromosome V hybridization foci on the spindle, and none in the first polar body. Only 5% of this embryo class was observed (Figure 2—figure supplement 1D,E). These frequencies are significantly different than those expected from random segregation (chi-square test, two-tailed p < 0.0002). The discrepancy in the fraction of zim-2 oocytes with 7 DAPI-staining bodies at diakinesis vs metaphase I raises the possibility that chromosomes might be systematically undercounted in zim-2 metaphase I spindles (but not in wild-type, him-8, or XXX metaphase I spindles). If this is the case, the two V univalents must be positioned close together on the spindle because 0/57 zim-2 metaphase I plates with 6 DAPI-staining bodies had two widely spaced lacO(V) FISH foci and the deviation between expected and observed nulloV metaphase II spindles would be even greater. Two results strongly indicate that the same mechanisms acting on univalent X's in him-8 mutants also act on V univalents in the zim-2 mutant. First, the fivefold preponderance of metaphase II spindles with 5 DAPI-staining bodies over those with 7 DAPI-staining bodies is similar to him-8. Second, the presence of lacO FISH signal only in the first polar body of metaphase II embryos with 5 DAPI-staining bodies on the spindle is the same in him-8 and zim-2. Thus, achiasmate autosomes, like achiasmate X chromosomes, are preferentially deposited into the first polar body.
Figure 2—figure supplement 1.

zim-2 embryos also deposit unpaired chromosome V univalents into the first polar body.

Z projections of fixed meiotic embryos viewed down the pole-to-pole spindle axis. Embryos were stained with DAPI, anti-tubulin antibody, and a LacO FISH probe that recognizes a LacO array integrated on chromosome V. This array is larger than the array inserted on X; thus, the foci are larger than those shown in Figure 2. (A) Metaphase I embryo with 7 DAPI chromosomes and two LacO (V) univalents. (B) Metaphase II embryo with 5 DAPI chromosomes and no LacO (V) chromosome on the spindle and two in the first polar body. (C) Metaphase II embryo with 6 DAPI chromosomes and one LacO (V) chromosome on the spindle and one in the first polar body. (D) Early anaphase II spindle with 2 LacO (V) chromosomes in the spindle and none in the first polar body. In (B) and (C), polar bodies are marked by asterisks. In (D), the polar body is shown as an inset because it was in a distant focal plane. (E) Quantification of the frequencies of each class. (F) Diakinesis chromosome counts from the zim-2 and him-8 strains bearing Lac operator arrays. Left panel shows representative zim-2 diakinesis nucleus with 6 chromosomes, right two panels show two examples of zim-2 diakinesis nuclei with 7 chromosomes. Bar = 5 µm.

DOI: http://dx.doi.org/10.7554/eLife.06056.005

Univalents biorient at metaphase I and tend to lag during anaphase I

To understand the mechanism by which univalent X chromosomes are preferentially deposited in polar bodies, we examined their orientation and position in the spindle. Antibodies specific for the cohesin subunit, REC-8, label a cruciform on metaphase I bivalents (Figure 3A,B) and a single band on metaphase II chromosomes (Figure 3A,C). The single REC-8 bands on wild-type metaphase II chromosomes and on him-8 metaphase I univalents were both oriented perpendicular to the pole-to-pole axis of the spindle (Figure 3D), indicating that him-8 X univalents biorient at metaphase I. him-8 worms expressing GFP::KNL-2, which labels the C. elegans cup-shaped meiotic kinetochores (Dumont et al., 2010), were also analyzed for biorientation and yielded the same conclusion as analysis by REC-8 antibody (Figure 3—figure supplement 1). We also examined the localization of GFP:AIR-2, the aurora B kinase that is essential for the loss of cohesion at anaphase I and which is loaded between homologs of wild-type bivalents in a chiasma-dependent fashion (Rogers et al., 2002). The fluorescence intensity of GFP::AIR-2 was 2.3 times higher on bivalents than univalents at metaphase I of him-8 embryos (Figure 3—figure supplement 2B,C). AIR-2 is normally re-loaded between sister chromatids at metaphase II. GFP::AIR-2 on metaphase II chromosomes was 1.7 times higher than on him-8 metaphase I univalents (Figure 3—figure supplement 2C), indicating that the reduced amount of AIR-2 on metaphase I univalents was not simply a consequence of the smaller size of a univalent relative to a bivalent. AIR-2 is required for the crossover dependent, prometaphase, partial removal of REC-8 from between homologs in a wild-type bivalent, an event proposed to be essential for loss of cohesion at anaphase I (Severson and Meyer, 2014). Consistent with the low levels of AIR-2, him-8 univalents had 1.7 ± 0.3 times the intensity of REC-8 staining as the inter-homolog region of bivalents in the same spindle (Figure 3B; n = 8 embryos, two-tailed p = 0.04, chi square relative to expected 1.0).
Figure 3.

X univalents biorient at metaphase I in him-8 embryos.

(A) Cartoon diagram of REC-8 staining on bivalents and univalents. (B and C) Anti-REC-8 staining of metaphase I and metaphase II embryos with bivalents (yellow arrow head) and univalents (white arrow head). In him-8 embryos, univalents at metaphase I have a single band of REC-8 with the same orientation seen on normal chromosomes at metaphase II. (D) Quantification of the orientation of univalents by offset angle from the metaphase plate, 0° corresponds to perfect biorientation and 90° corresponds to perfect mono-orientation. Cortical pole is on the left in all images. Bar = 5 μm.

DOI: http://dx.doi.org/10.7554/eLife.06056.006

(A–B) Z-projections through fixed GFP::KNL-2 embryos stained with DAPI and anti-tubulin antibody. (A) Metaphase I wild-type and him-8 embryos showing the distinct KNL-2 cups around bivalents (yellow arrow head) and univalents (white arrow head). (B) Metaphase II wild-type and him-8 embryos showing the characteristic KNL-2 cups around bioriented chromosomes at the metaphase plate. (C) Quantification of the orientation of chromosomes by offset angle from the metaphase plate, 0° corresponds to perfect biorientation and 90° corresponds to perfect mono-orientation. Cortical pole is on the left in all images. Bar = 5 μm.

DOI: http://dx.doi.org/10.7554/eLife.06056.007

(A and B) Z projections of fixed metaphase I, GFP:AIR-2 embryos stained with DAPI and anti-tubulin antibody. AIR-2 is loaded between homologs of both wild-type (A) and him-8 bivalents (B), whereas less AIR-2 was observed on him-8 univalents (arrow heads in B). (C) Relative pixel intensity ratios show that him-8 metaphase II chromosomes load 1.7 times as much AIR-2 as X univalents at metaphase I, and metaphase I bivalents load 2.3 times as much AIR-2 as X univalents at metaphase I. n for both refers to total number of embryos counted, where each metaphase II embryo bore 5–7 chromosomes and each metaphase I embryo bore 2 univalents and 5 bivalents. Bar = 5 μm.

DOI: http://dx.doi.org/10.7554/eLife.06056.008

Figure 3—figure supplement 1.

Imaging of GFP::KNL-2 demonstrates that him-8 univalent chromosomes biorient at metaphase of meiosis I.

(A–B) Z-projections through fixed GFP::KNL-2 embryos stained with DAPI and anti-tubulin antibody. (A) Metaphase I wild-type and him-8 embryos showing the distinct KNL-2 cups around bivalents (yellow arrow head) and univalents (white arrow head). (B) Metaphase II wild-type and him-8 embryos showing the characteristic KNL-2 cups around bioriented chromosomes at the metaphase plate. (C) Quantification of the orientation of chromosomes by offset angle from the metaphase plate, 0° corresponds to perfect biorientation and 90° corresponds to perfect mono-orientation. Cortical pole is on the left in all images. Bar = 5 μm.

DOI: http://dx.doi.org/10.7554/eLife.06056.007

Figure 3—figure supplement 2.

Reduced levels of AIR-2 are loaded on him-8 X univalents at meiosis I.

(A and B) Z projections of fixed metaphase I, GFP:AIR-2 embryos stained with DAPI and anti-tubulin antibody. AIR-2 is loaded between homologs of both wild-type (A) and him-8 bivalents (B), whereas less AIR-2 was observed on him-8 univalents (arrow heads in B). (C) Relative pixel intensity ratios show that him-8 metaphase II chromosomes load 1.7 times as much AIR-2 as X univalents at metaphase I, and metaphase I bivalents load 2.3 times as much AIR-2 as X univalents at metaphase I. n for both refers to total number of embryos counted, where each metaphase II embryo bore 5–7 chromosomes and each metaphase I embryo bore 2 univalents and 5 bivalents. Bar = 5 μm.

DOI: http://dx.doi.org/10.7554/eLife.06056.008

X univalents biorient at metaphase I in him-8 embryos.

(A) Cartoon diagram of REC-8 staining on bivalents and univalents. (B and C) Anti-REC-8 staining of metaphase I and metaphase II embryos with bivalents (yellow arrow head) and univalents (white arrow head). In him-8 embryos, univalents at metaphase I have a single band of REC-8 with the same orientation seen on normal chromosomes at metaphase II. (D) Quantification of the orientation of univalents by offset angle from the metaphase plate, 0° corresponds to perfect biorientation and 90° corresponds to perfect mono-orientation. Cortical pole is on the left in all images. Bar = 5 μm. DOI: http://dx.doi.org/10.7554/eLife.06056.006

Imaging of GFP::KNL-2 demonstrates that him-8 univalent chromosomes biorient at metaphase of meiosis I.

(A–B) Z-projections through fixed GFP::KNL-2 embryos stained with DAPI and anti-tubulin antibody. (A) Metaphase I wild-type and him-8 embryos showing the distinct KNL-2 cups around bivalents (yellow arrow head) and univalents (white arrow head). (B) Metaphase II wild-type and him-8 embryos showing the characteristic KNL-2 cups around bioriented chromosomes at the metaphase plate. (C) Quantification of the orientation of chromosomes by offset angle from the metaphase plate, 0° corresponds to perfect biorientation and 90° corresponds to perfect mono-orientation. Cortical pole is on the left in all images. Bar = 5 μm. DOI: http://dx.doi.org/10.7554/eLife.06056.007

Reduced levels of AIR-2 are loaded on him-8 X univalents at meiosis I.

(A and B) Z projections of fixed metaphase I, GFP:AIR-2 embryos stained with DAPI and anti-tubulin antibody. AIR-2 is loaded between homologs of both wild-type (A) and him-8 bivalents (B), whereas less AIR-2 was observed on him-8 univalents (arrow heads in B). (C) Relative pixel intensity ratios show that him-8 metaphase II chromosomes load 1.7 times as much AIR-2 as X univalents at metaphase I, and metaphase I bivalents load 2.3 times as much AIR-2 as X univalents at metaphase I. n for both refers to total number of embryos counted, where each metaphase II embryo bore 5–7 chromosomes and each metaphase I embryo bore 2 univalents and 5 bivalents. Bar = 5 μm. DOI: http://dx.doi.org/10.7554/eLife.06056.008 Because X univalents biorient at metaphase I but load half as much AIR-2, which is required for loss of cohesion at anaphase I in C. elegans (Kaitna et al., 2002; Rogers et al., 2002), and retain twice as much REC-8, we hypothesized that bioriented univalents might be pulled toward both spindle poles and lag on the anaphase spindle as they fail to lose cohesion. To test this possibility, we did time-lapse imaging of him-8 embryos expressing GFP::tubulin and mCherry::histone, focusing specifically on the events of anaphase I. 90% of him-8 embryos at anaphase I had one or two lagging chromosomes (n = 119) compared to 2% of wild-type embryos (n = 52) (Figure 4A,B). In 51% of living him-8 embryos with lagging chromosomes at anaphase I, two discrete lagging chromosomes could be resolved. Each lagging chromosome eventually moved as a single unit either toward the cortex or into the embryo in 98% of embryos (n = 179) (Figures 4B, 5A), indicating that cohesion between sister chromatids is maintained and that univalents are not broken or destroyed during anaphase. At anaphase II, only 10% of him-8 embryos exhibited lagging chromosomes (n = 60) and 0/22 wild-type embryos had lagging chromosomes, suggesting that lagging chromosomes are caused by the presence of univalents at meiosis I.
Figure 4.

X univalents lag at anaphase I.

(A) Time-lapse images of a living wild-type embryo undergoing anaphase I show chromosomes separating as two distinct masses. (B) Time-lapse images of a living him-8 embryo show a lagging chromosome at anaphase I. (C–E) Z projections of fixed anaphase I embryos. (C) LacO FISH labeling of a wild-type strain with a LacO array integrated on the X chromosome shows normal segregation of two X homologs from one X bivalent. (D) LacO FISH shows that a lagging chromosome in him-8 is the X. (E) LacO FISH labeling of a zim-2 strain with a LacO array integrated on chromosome V showing a univalent V lagging at anaphase I. Cortical pole is to the left in all images. Bar = 5 μm.

DOI: http://dx.doi.org/10.7554/eLife.06056.009

X univalents lag at anaphase I.

(A) Time-lapse images of a living wild-type embryo undergoing anaphase I show chromosomes separating as two distinct masses. (B) Time-lapse images of a living him-8 embryo show a lagging chromosome at anaphase I. (C–E) Z projections of fixed anaphase I embryos. (C) LacO FISH labeling of a wild-type strain with a LacO array integrated on the X chromosome shows normal segregation of two X homologs from one X bivalent. (D) LacO FISH shows that a lagging chromosome in him-8 is the X. (E) LacO FISH labeling of a zim-2 strain with a LacO array integrated on chromosome V showing a univalent V lagging at anaphase I. Cortical pole is to the left in all images. Bar = 5 μm. DOI: http://dx.doi.org/10.7554/eLife.06056.009

The contractile ring moves inward past the lagging chromosomes of him-8 embryos.

(A) Time-lapse sequence of anaphase I in a him-8 strain with GFP::PH, GFP::Tubulin, and mCherry::Histone H2B. The plasma membrane ingresses past the lagging chromosomes to engulf them in the polar body. (B) Fraction of him-8 anaphase I embryos in which a lagging chromosome eventually resolved toward the cortex or eventually resolved into the embryo (interior). Lagging univalents resolved more frequently toward the cortex during both early and late anaphase. Depletion of NMY-2, the myosin required for polar body formation, eliminated only the late anaphase bias. Pairwise two-tailed p values by Fisher's exact test: him-8 late vs him-8 nmy-2(RNAi) late = 0.02, him-8 early vs him-8 nmy-2(RNAi) early = 0.80, him-8 early vs him-8 late = 1.0, him-8 nmy-2(RNAi) early vs him-8 nmy-2(RNAi) late = 0.26. p values from Pearson's chi-squared test: him-8 late vs 50% = 0.003, him-8 nmy-2(RNAi) late vs 50% = 0.32, him-8 early vs 50% = 0.02, him-8 nmy-2(RNAi) early vs 50% = 0.38. (C) Top, diagram illustrating how the position of scission by the contractile ring along the pole-to-pole spindle axis was scored. Bottom, representative images from time-lapse sequences showing scission at different positions along the length of the spindle. (D) Average position of contractile ring scission along the pole-to-pole spindle axis in wild-type embryos and in him-8 embryos with no lagging chromosomes, lagging chromosomes that end up at the cortex (cortical), or lagging chromosomes that end up in the embryo (interior). Bar = 5 μm. DOI: http://dx.doi.org/10.7554/eLife.06056.010 To confirm that the lagging chromosomes are bioriented X univalents, we used LacO(X) FISH. We found that the X-specific FISH probe labeled one or two lagging chromosomes at anaphase I of him-8 embryos, indicating that lagging chromosomes are X univalents (13/14) (Figure 4D). 36% of fixed him-8 anaphase I embryos with lagging chromosomes had two distinct FISH-positive chromosomes lagging. Another 21% had a single FISH-positive lagging body, but no other FISH-positive chromosomes on the spindle indicating that the two X univalents were likely too close to resolve in these embryos. The remaining 36% had one FISH-positive lagging chromosome and one FISH-positive chromosome in one of the main chromosome masses (one embryo had a lagging chromosome that was a bivalent). These results suggest that one or both X univalents lag in up to 90% of him-8 embryos. Similar results were obtained for chromosome V in zim-2 mutants, where 40% of metaphase I embryos have univalent V's (Figure 2—figure supplement 1). 27% (4/15 or over half of anaphase I spindles expected to have V univalents) had a lagging chromosome. 100% (4/4) of these lagging chromosomes were chromosome V as assayed by LacO(V) FISH (Figure 4E). These results indicate that achiasmate autosomes lag at anaphase I, just like achiasmate X chromosomes.

The meiotic contractile ring captures lagging X univalents in the first polar body

After establishing that lagging chromosomes were univalents, we next asked if univalents that lagged were subject to biased segregation at anaphase I. To analyze this, we conducted time-lapse imaging of embryos from him-8 worms expressing GFP::tubulin and mCherry::histone, as well as embryos from him-8 worms expressing these along with GFP::PH (plextrin homology domain) to label the plasma membrane (Figure 5A). Our time-lapse analysis revealed that 65% of lagging chromosomes eventually moved toward the cortex and the forming polar body of him-8 embryos during anaphase I (n = 181) (Figure 5B), indicating that preferential expulsion of lagging univalents into the first polar body could contribute to the higher than random frequency of metaphase II spindles with 5 autosomes and no X. Because the polar body contractile ring ingresses inward toward the midpoint of the late anaphase spindle where it normally scissions, we hypothesized that the preferential resolution of lagging chromosomes toward the cortex might result from inhibition of contractile ring scission until the ring ingresses past lagging chromosomes (Figure 5C). In wild type, ingression of the polar body contractile ring initiates when homologs have separated by 2.3 μm and polar body scission completes when homologs have separated by 5.6 μm (Fabritius et al., 2011b). The bias of univalents that moved toward the cortex before initiation of contractile ring ingression could not be caused by engulfment by the polar body. Therefore, we separated lagging univalents into two categories, early-resolving univalents that moved to one pole while the main chromosome masses were separated by less than 4.0 µm and late-resolving univalents that moved to one pole only after the main chromosome masses were separated by greater than 4.0 µm. If late-resolving univalents were engulfed during polar body formation, elimination of contractile ring activity would reduce the fraction of lagging chromosomes resolving toward the cortex. Indeed, RNAi depletion of the non-muscle myosin, NMY-2, which causes complete loss of cortical furrowing and polar body formation (Fabritius et al., 2011b), in him-8 embryos resulted in a significant (p = 0.02) reduction in the percentage of late-lagging univalents resolving toward the cortex from 64% to 43% (Figure 5B).
Figure 5.

The contractile ring moves inward past the lagging chromosomes of him-8 embryos.

(A) Time-lapse sequence of anaphase I in a him-8 strain with GFP::PH, GFP::Tubulin, and mCherry::Histone H2B. The plasma membrane ingresses past the lagging chromosomes to engulf them in the polar body. (B) Fraction of him-8 anaphase I embryos in which a lagging chromosome eventually resolved toward the cortex or eventually resolved into the embryo (interior). Lagging univalents resolved more frequently toward the cortex during both early and late anaphase. Depletion of NMY-2, the myosin required for polar body formation, eliminated only the late anaphase bias. Pairwise two-tailed p values by Fisher's exact test: him-8 late vs him-8 nmy-2(RNAi) late = 0.02, him-8 early vs him-8 nmy-2(RNAi) early = 0.80, him-8 early vs him-8 late = 1.0, him-8 nmy-2(RNAi) early vs him-8 nmy-2(RNAi) late = 0.26. p values from Pearson's chi-squared test: him-8 late vs 50% = 0.003, him-8 nmy-2(RNAi) late vs 50% = 0.32, him-8 early vs 50% = 0.02, him-8 nmy-2(RNAi) early vs 50% = 0.38. (C) Top, diagram illustrating how the position of scission by the contractile ring along the pole-to-pole spindle axis was scored. Bottom, representative images from time-lapse sequences showing scission at different positions along the length of the spindle. (D) Average position of contractile ring scission along the pole-to-pole spindle axis in wild-type embryos and in him-8 embryos with no lagging chromosomes, lagging chromosomes that end up at the cortex (cortical), or lagging chromosomes that end up in the embryo (interior). Bar = 5 μm.

DOI: http://dx.doi.org/10.7554/eLife.06056.010

As a complementary approach, we asked if more rapid polar body ring ingression would have the opposite effect of NMY-2 depletion. We previously showed that the depletion of the myosin phosphatase, MEL-11, doubled the rate of polar body ring ingression (Fabritius et al., 2011b). Therefore, we hypothesized that the inactivation of MEL-11 might enhance the preferential engulfment of lagging univalents by the first polar body. Unlike NMY-2 depletion, which generates 100% dead embryos, the lethality of mel-11 mutants is rescued by wild-type sperm so the chromosome constitution of progeny from a mel-11 mother can be scored by phenotype. Mating otherwise wild-type males bearing the recessive X-linked marker, lon-2, to him-8 hermaphrodites allows measurement of the frequency of nulloX ova (which give rise to lon male progeny) and diploX ova (which give rise to XXX dumpy progeny) (Hodgkin et al., 1979). Random segregation of univalents should generate a 1:1 ratio of nulloX:diploX ova. We found that mel-11 increased the segregation bias of him-8 by sevenfold from 3:1 to 23:1 (Table 1). This result indicates that more rapid furrow ingression captures more lagging univalents in the first polar body resulting in more nulloX ova.
Table 1.

Enhancement of the segregation bias in him-8 mutants by mutations in the myosin phosphatase, mel-11

DOI: http://dx.doi.org/10.7554/eLife.06056.011

Self-progeny counts
GenotypeTemperature (°C)% XO male% XX hermaphrodite% XXX DpyTotal progeny
mel-11(sb55) unc-4200.299.8NC1763
mel-11(sb55) unc-4; him-82049*51NC374
unc-4; him-8203466NC1442
mel-11(it126) unc-4150.699NC790
mel-11(it126) unc-4; him-81558*38.63.4873

mel-11 increases the frequency of male progeny from him-8 mothers. mel-11(sb55) and mel-11(it26) worms produce high frequencies of dead embryos, which cannot be scored for sex at 25°C (Wissmann et al., 1999). Percent male (XO), hermaphrodite (XX), and dumpy (XXX) progeny from self-fertilizing mel-11, him-8, or him-8 mel-11 double mutant worms were therefore scored at 15°C and 20°C. Only progeny that developed to the L4 or adult stage were counted. *Two-tailed p < 0.0001 by binomial test compared with him-8 alone. 100% of mel-11(it26) self progeny die as embryos at 25°C, but this lethality is rescued by mel-11(+) sperm (Kemphues et al., 1988). The progeny of mel-11(it26) hermaphrodites crossed with lon-2 males could therefore be scored at 25°C. When lon-2(+) hermaphrodites are crossed with lon-2 males (lon-2 is a recessive X-linked marker), 50% of the ova will be fertilized by sperm with a single lon-2 X chromosome. Fertilization of a nulloX ova by a lon-2 X sperm will result in a lon-2 male. Fertilization of a diploX ova by a lon-2 X sperm will result in a XXX dumpy worm. Random segregation of the unpaired X chromosomes in him-8 would result in a ratio of nulloX/diplo X ova of 1.0. The mel-11; him-8 double mutant showed a sevenfold increase in the ratio of nullo/diploX ova relative to him-8 alone, indicating an increased efficiency of eliminating maternal unpaired X chromosomes.

Enhancement of the segregation bias in him-8 mutants by mutations in the myosin phosphatase, mel-11 DOI: http://dx.doi.org/10.7554/eLife.06056.011 mel-11 increases the frequency of male progeny from him-8 mothers. mel-11(sb55) and mel-11(it26) worms produce high frequencies of dead embryos, which cannot be scored for sex at 25°C (Wissmann et al., 1999). Percent male (XO), hermaphrodite (XX), and dumpy (XXX) progeny from self-fertilizing mel-11, him-8, or him-8 mel-11 double mutant worms were therefore scored at 15°C and 20°C. Only progeny that developed to the L4 or adult stage were counted. *Two-tailed p < 0.0001 by binomial test compared with him-8 alone. 100% of mel-11(it26) self progeny die as embryos at 25°C, but this lethality is rescued by mel-11(+) sperm (Kemphues et al., 1988). The progeny of mel-11(it26) hermaphrodites crossed with lon-2 males could therefore be scored at 25°C. When lon-2(+) hermaphrodites are crossed with lon-2 males (lon-2 is a recessive X-linked marker), 50% of the ova will be fertilized by sperm with a single lon-2 X chromosome. Fertilization of a nulloX ova by a lon-2 X sperm will result in a lon-2 male. Fertilization of a diploX ova by a lon-2 X sperm will result in a XXX dumpy worm. Random segregation of the unpaired X chromosomes in him-8 would result in a ratio of nulloX/diplo X ova of 1.0. The mel-11; him-8 double mutant showed a sevenfold increase in the ratio of nullo/diploX ova relative to him-8 alone, indicating an increased efficiency of eliminating maternal unpaired X chromosomes. To test our hypothesis that a lagging chromosome inhibits contractile ring scission to allow univalent capture, we asked whether the presence of late-lagging univalents might cause misplacement of the contractile ring from the 50% spindle length scission point observed in wild-type embryos (Fabritius et al., 2011b) by time-lapse imaging of the plasma membrane marker GFP::PH (Figure 5A). Spindle length was measured between the outside edges of the main chromosome masses and only in frames in which both chromosome masses were in focus (Figure 5C). In him-8 embryos, when there were no lagging univalents, the contractile ring ingressed normally to 50% spindle length as measured from the outside edge of the main chromatin mass in the interior of the embryo. When a lagging univalent was seen segregating into the polar body, the contractile ring was seen ingressing deeper into the embryo to 40% spindle length (Figure 5C,D). Alternatively, when a lagging univalent was seen segregating into the embryo, the contractile ring ingressed inward to a shallower depth at 59% spindle length (Figure 5C,D). To further test the idea that a late-lagging univalent might influence the choice of the scission point, we imaged formation of the first polar body in wild-type or him-8 worms expressing GFP:UNC-59 (septin) and mCherry: histone. Septins are polymerizing GTPases that assemble in the contractile ring with myosin II, F-actin, and anillins (Green et al., 2013). In wild type or him-8 with early-resolving univalents, GFP:UNC-59 labeled a flat washer–shaped contractile ring that moved down to the midpoint of the elongating anaphase spindle as reported previously for GFP:NMY-2 (Fabritius et al., 2011b). The septin ring transformed into a tube (Figure 6A, 255 s) as previously described for myosin and ANI-1 (Dorn et al., 2010). When cortical furrowing relaxed at the end of telophase I, the septin tube moved outward to the embryo surface, then flopped over, and remained as a separate entity next to the chromosomes in the first polar body (Figure 6A, 420 s). In 5/10 him-8 embryos in which the septin-labeled ring reached the lagging univalent, the univalent was trapped in the septin tube and moved with the septin tube outward during cortical relaxation (Figure 6B). In these cases, the univalent remained trapped in the septin tube adjacent to the polar body as shown in Figure 6B,C. In 3/10 cases, the septin ring passed the univalent before the tube was formed, and in these cases, the univalent joined the main mass of chromatin in the polar body. In the 2/10 cases where the univalent did not end up in the polar body, the univalent slipped out of the septin tube into the embryo before the septin tube moved toward the embryo surface. These results are consistent with a model where the septin tube traps late-lagging univalents until scission occurs on the embryo side of the septin tube.
Figure 6.

Lagging chromosomes are captured by the septin tube and expelled with polar bodies.

Time-lapse imaging of embryos expressing GFP::septin and mCherry::histone. (A) Time-lapse images of a living wild-type embryo undergoing anaphase I show the conversion of a flat washer–shaped contractile ring into a tube during formation of the first polar body. (B) Time-lapse images of a living him-8 embryo show two lagging chromosomes at anaphase I (arrows) as one moves into the polar body early on, while the second is trapped in the septin tube and is extruded with the first polar body. (C) 2 time points of a him-8 embryo during telophase I showing the lagging chromosome trapped in the septin tube. Bar = 4 μm. Times are from the onset of homolog separation.

DOI: http://dx.doi.org/10.7554/eLife.06056.012

Lagging chromosomes are captured by the septin tube and expelled with polar bodies.

Time-lapse imaging of embryos expressing GFP::septin and mCherry::histone. (A) Time-lapse images of a living wild-type embryo undergoing anaphase I show the conversion of a flat washer–shaped contractile ring into a tube during formation of the first polar body. (B) Time-lapse images of a living him-8 embryo show two lagging chromosomes at anaphase I (arrows) as one moves into the polar body early on, while the second is trapped in the septin tube and is extruded with the first polar body. (C) 2 time points of a him-8 embryo during telophase I showing the lagging chromosome trapped in the septin tube. Bar = 4 μm. Times are from the onset of homolog separation. DOI: http://dx.doi.org/10.7554/eLife.06056.012 To further test the idea that late-lagging univalents are physically trapped in the septin tube, we tried to influence the integrity of the septin tube without blocking polar body scission. Septins act together with anillins (Green et al., 2013). C. elegans has three anillins: ANI-1 that is required for polar body scission, ANI-2 that is required for gonad development, and ANI-3 that has no known function (Maddox et al., 2005). We hypothesized that ANI-3 might play a non-essential structural role in the polar body septin tube and that ani-3(RNAi) might therefore allow late-lagging univalents to slip out of the tube back into the embryo. Indeed, RNAi of ANI-3 initiated on L4 him-8 hermaphrodites (which have already completed spermatogenesis) significantly (p < 0.001 binomial test) reduced the fraction of XO male progeny from 37% (n = 9 mothers, 1960 progeny) to 27% (n = 11 mothers, 2123 progeny), whereas ani-3 (RNAi) had no significant effect on wild-type worms (wt: 0.04% XO, 1% dead, n = 11 mothers; ani-3 [RNAi]: 0.05% XO, 1% dead, n = 17 mothers). This result suggests that compromising the integrity of the septin tube may reduce the efficiency of trapping lagging univalents in the septin tube. ANI-3 depletion did not significantly increase the frequency of XXX dumpy progeny from him-8 mothers (him-8: 3% XXX, 5% dead; him-8 ani-3[RNAi]: 4% XXX, 6% dead). This apparent inconsistency might be explained if additional ANI-3–independent mechanisms act to reduce the number of XXX progeny (see below).

The early anaphase segregation bias

Lagging chromosomes were resolved prior to contractile ring ingression in 45% of embryos with lagging chromosomes at anaphase I. These were resolved toward the cortex 64% of the time (n = 72), and NMY-2 depletion had no significant effect on this class of embryos (p = 0.8) (Figure 5B). These results suggest that an additional mechanism biasing univalent movement toward the cortex might be at work earlier in the cell cycle. During wild-type meiosis, bivalents congress to the metaphase plate on an 8-µm long spindle that is oriented parallel to the cortex. Upon anaphase promoting complex activation, the meiosis I spindle shortens to 4.8 μm in length (Yang et al., 2003), then one spindle pole moves to the cortex in a dynein-dependent manner, and homolog separation initiates (Ellefson and McNally, 2009, 2011). We found that univalents were misaligned toward the spindle poles in fixed him-8 embryos at late metaphase I, when the meiotic spindle is shortened but not yet rotated (Figure 7A–B). In 46% of these embryos, both univalents were misaligned toward the same pole (Figure 7B), close to the 50% expected from random positioning. In fixed him-8 embryos at the onset of anaphase, when spindles are shortened and rotated but chromosomes are not yet separated, 57% had one or both univalents closer to the cortical pole (38 + 19%; Figure 7F,G). No embryos had both univalents closer to the interior spindle pole. We hypothesized that one of two mechanisms might link spindle rotation with the early anaphase preference for univalent movement toward the cortex. Univalents might stochastically align closer to one spindle pole before rotation and bias the movement of that pole to the cortex. Alternatively, the cortex-proximal pole might acquire distinct biochemical properties after rotation due to cortical contact and subsequently generate more pulling force on the lagging univalents and pull them preferentially toward the cortex.
Figure 7.

Early bias of univalent X chromosomes might occur at the metaphase to anaphase I transition.

Representative cartoon diagrams and Z projections from fixed embryos stained with DAPI, anti-tubulin antibody, and LacO(X) FISH probe. Cortex is at the top. (A–C) Both X univalents on metaphase I spindles that were shortened (5.3–7.2 μm spindle length) but still parallel to the embryo cortex were frequently (46%) aligned closer to the same spindle pole. (D–G) One or both univalents on MI spindles that had rotated but homologs had not yet separated were closer to the cortex and future polar body in 38 + 19% of embryos. Both univalents were never observed closer to the interior spindle pole. Yellow dashed lines indicate the metaphase plate. (H and I) Time-lapse images of two univalents (arrows in H) or one univalent (arrowhead in I) offset from the metaphase plate just before rotation of the univalent-proximal pole to the cortex. Time zero is initiation of spindle rotation. Bar = 5 μm.

DOI: http://dx.doi.org/10.7554/eLife.06056.013

Early bias of univalent X chromosomes might occur at the metaphase to anaphase I transition.

Representative cartoon diagrams and Z projections from fixed embryos stained with DAPI, anti-tubulin antibody, and LacO(X) FISH probe. Cortex is at the top. (A–C) Both X univalents on metaphase I spindles that were shortened (5.3–7.2 μm spindle length) but still parallel to the embryo cortex were frequently (46%) aligned closer to the same spindle pole. (D–G) One or both univalents on MI spindles that had rotated but homologs had not yet separated were closer to the cortex and future polar body in 38 + 19% of embryos. Both univalents were never observed closer to the interior spindle pole. Yellow dashed lines indicate the metaphase plate. (H and I) Time-lapse images of two univalents (arrows in H) or one univalent (arrowhead in I) offset from the metaphase plate just before rotation of the univalent-proximal pole to the cortex. Time zero is initiation of spindle rotation. Bar = 5 μm. DOI: http://dx.doi.org/10.7554/eLife.06056.013 To test whether spindle rotation is involved with the him-8 segregation bias, we utilized mei-2(ct98), a partial loss of function katanin mutant, which causes a failure of meiotic spindle rotation but still allows polar body formation and production of viable progeny (McNally et al., 2006). If offset univalents bias spindle rotation or if the cortex-proximal pole exerts greater pulling on univalents after rotation, then a mei-2(ct98) him-8 double mutant should have a reduced frequency of male progeny relative to him-8 alone. At 20°C, the mei-2(ct98) him-8 double mutant produced only 21% male progeny (n = 1440 progeny from 14 parents), which is significantly less than the 36% male progeny produced by the him-8 single mutant (n = 964 progeny from 8 parents; p < 0.0001 by one-tailed binomial test) and is significantly different than mei-2 (ct98) alone (0% males; n = 925 progeny from 8 parents). The reduction in male progeny is unlikely to be due to effects on spermatogenesis, as sperm is unaffected by katanin-null mutants (Mains et al., 1990). This result is consistent with either spindle rotation-based models for the early anaphase segregation bias. The role of spindle rotation is not conclusive; however, since mei-2(ct98) meiotic spindles have other phenotypes besides spindle rotation failure (McNally et al., 2006). Absolute distinction between the two possible rotation models would require unambiguous tracking of both univalents before, during, and after spindle rotation. This was not possible in any of 201 time-lapse sequences. In 8 particularly clear time-lapse sequences, one or both univalents could be identified unambiguously 10–100 s before initiation of spindle rotation. In 6/8 of these cases, the univalent-proximal pole rotated to the cortex (Figure 7I,H). In 1/8 cases, the univalent-proximal pole rotated away from the cortex. In 1/8 cases, the two univalents were offset to opposite poles both before and during rotation. If the cortical environment conferred a stronger pulling force on the cortical pole after rotation, then lagging univalents crossing the midpoint of the anaphase spindle should be common. Time-lapse imaging of spindles after rotation revealed that among 30 embryos in which one or two lagging chromosomes were already positioned closer to one pole at anaphase I onset and the lagging chromosome resolved early, the lagging chromosome resolved toward the pole that it was already close to in 80% of these embryos (data not shown). Among the 20% of embryos in which the lagging chromosome moved to the opposite pole after spindle rotation, the chromosome moved toward the cortex 3 times, toward the embryo 3 times, and in one instance, the two lagging chromosomes resolved to opposite poles. These observations are not consistent with a cortical pole that generates a stronger pulling force after rotation but instead favor the idea that the offset position of univalents before rotation increases the probability that the univalent-proximal pole will move to the cortex. Two results suggested that additional factors might contribute to the overall inheritance of univalent X chromosomes. Both ani-3(RNAi) and mei-2(ct98) reduced the frequency of male self-progeny from him-8 worms without increasing the frequency of triploX self-progeny. We therefore tested whether aneuploid sperm might influence phenotypic outcomes by LacO(X) FISH on pronuclear stage embryos from self-fertilized him-8 mothers (not shown). Before pronuclear meeting, male pronuclei are distinguished from female pronuclei by the presence of sperm asters. We observed 90% haploX, 8% nulloX, and 2% diploX male pronuclei (n = 52). These values are significantly different than the 50%, 25%, 25% expected from random segregation (two-tailed p < 0.0001 by chi square) and are similar to the frequencies obtained by Hodgkin et al. (1979) using genetic tests with sex-reversed him-8 XX males. 10% nulloX sperm thus make a small contribution to reducing the frequency of XXX self-progeny.

Discussion

Hodgkin et al. (1979) showed that C. elegans that are trisomic for the X chromosome or that fail to form a chiasma between the normal two X homologs have fewer trisomic offspring than expected from random segregation. Our results explain this phenomenon by demonstrating that two cellular pathways preferentially segregate X univalents into the first polar body. Mechanisms reducing the frequency of trisomic offspring have not been investigated in other model organisms because in both mouse and Drosophila, animals with trisomy X are not fertile (Schupbach et al., 1978; Tada et al., 1993), and there are no mutants, like him-8, that specifically block crossover formation on one specific chromosome in females. However, women with trisomy 21 or trisomy X are often fertile and have been reported to have more than 50% euploid offspring (Bovicelli et al., 1982; Neri, 1984; Ratcliffe et al., 1991; Robinson et al., 1991; Stewart et al., 1991). Triploid oysters provide a stronger example of apparent female-specific correction to a diploid state. Eggs produced by triploid females and fertilized with sperm from diploid males result in 57% diploid, 31% triploid, and 12% aneuploid offspring, whereas eggs produced by diploids and fertilized by sperm from triploids result in 15% diploid and 85% aneuploid offspring (Gong et al., 2004). Gaging the likelihood that the phenomenon described here for C. elegans might be relevant to trisomic humans or triploid oysters is complicated by two issues. In contrast with trisomic C. elegans, triploid oysters (Guo and Allen, 1994) and trisomic human oocytes sometimes form trivalent structures rather than a separate bivalent and univalent. Only 42–16% of diplotene oocytes from fetuses with trisomy 21, trisomy 13, or trisomy 18 exhibited a separate bivalent and univalent (Roig et al., 2005; Robles et al., 2007). It is difficult to predict the behavior of trivalents on the spindle. In addition, it is not clear whether a univalent present during anaphase I of a human or oyster oocyte would be more likely to move to one pole intact as in C. elegans or to separate equationally. We speculate that single chromatids resulting from equational separation of univalents at anaphase I could be subjected to asymmetric segregation at anaphase II. Our results suggest that any chromosome that lags during late anaphase might be prefentially expelled simply due to the conserved asymmetric nature of polar body formation. There is one example where a univalent chromosome exhibits the opposite of the segregation bias reported here in C. elegans. In the 44–78% of oocytes from XO mice in which the univalent segregates intact at anaphase I, the univalent is preferentially retained in the embryo (Lemaire-Adkins and Hunt, 2000). This appears to be a difference between worms and mice rather than a difference between a trisomy and a monosomy since sex-reversed XO C. elegans produce an excess of nulloX ova (Hodgkin, 1980). Discerning the overall significance of preferentially placing univalents into the first polar body is a complex problem. In the case of an XXX mother or a mother with a mosaic ovary containing trisomic and diploid oocytes, these pathways would increase the frequency of normal haploid eggs relative to that expected from random distribution of a single univalent (Figure 1). In the case of diploid oocytes with two univalent autosomes, however, 100% efficient expulsion of univalents into the first polar body would increase the frequency of lethal monosomy. Data shown in Figure 2, however, show no significant decrease in haploid eggs (interpreted from the frequency of MII spindles with 6 chromosomes) from him-8 or zim-2 mothers relative to the 50% that would occur by random distribution. Thus, the efficiency of placing univalents in the first polar body has evolved to a point that corrects trisomy without reducing the frequency of haploid eggs produced from oocytes that failed to form a chiasma between one pair of homologs. The conservation of these mechanisms in other species will have to be elucidated by studies focused specifically on the concept of chromosomal errors that are corrected, rather than caused, by female meiotic spindles.

Materials and methods

Worm strains

The genotypes of C. elegans strains used in this work are listed in Supplementary file 1. For LacO(X) FISH, EG7477, which has lac operator arrays integrated on chromosome II and X, was outcrossed to him-8 males or to wild-type males to eliminate the extra LacO array on chromosome II, generating strains FM299 (wild-type LacO(X)) and FM300 (him-8 lacO(X)). The loss of the chromosome II LacO array and homozygosity for the X chromosome array were confirmed by PCR.

RNAi

RNAi was carried out by feeding bacteria (HT115) induced to express double-stranded RNA (Timmons et al., 2001). The clones used were nmy-2 l-3L24, ani-3 V-12J23 (Kamath et al., 2001).

Live imaging

Adult hermaphrodites were anesthetized with tricaine and tetramisole and immobilized between a coverslip and agarose pad on a slide. The time-lapse images shown in Figure 2A–E and Figure 4A–B were captured on an Olympus (Center Valley, PA) IX71 microscope equipped with a 60× PlanApo NA 1.42 oil objective and an ORCA R2 CCD camera (Hamamatsu Photonics, Hamamatsu City, Japan). Hg arc excitation light was shuttered by a Sutter Lambda 10-3 shutter controller (Sutter Instruments, Novato, CA). Images shown in Figure 5A were captured with an Intelligent Imaging Innovations (Denver, CO) Marianas Spinning Disk Confocal equipped with a Photometrics (Tucson, AZ) Cascade QuantEM 512SC EMCCD, and Zeiss 63× 1.4 objective. Image sequences in Figure 6 were captured with a Perkin Elmer-Cetus (Waltham, MA) Ultraview Spinning Disk Confocal equipped with an Orca R2 CCD and an Olympus 60× 1.4 objective.

Immunofluorescence

Meiotic embryos were extruded from hermaphrodites by gentle squishing between coverslip and slide, flash frozen in liquid N2, permeabilized by removing the coverslip, and then fixed in cold methanol before staining with antibodies and DAPI. Antibodies used in this work were mouse monoclonal anti-tubulin (DM1alpha, 1:200; Sigma), mouse monoclonal DM1alpha:FITC conjugated (1:30; Sigma), rabbit anti-REC-8 (from 1:500; Josef Loidl), Alexa 594 anti-rabbit, and Alexa 594 anti-mouse (both from Molecular Probes and used at 1:200). Images in Figure 3 were captured with an Applied Precision Deltavision Deconvolution system equipped with an Olympus PlanApo 60× 1.40 objective and a CoolSnap HQ CCD camera (Photometrics). Deltavision z-stacks were captured at 130-nm intervals. Images in Figures 1, 2F–J, 4C–E, 7 and Figure 2—figure supplement 1 were captured with the Olympus IX71 described above but using an Olympus DSU (disc scanning unit). Z stacks were acquired by taking images every 200 nm (unless otherwise noted) from the top to the bottom of the spindle tubulin signal.

Deconvolution

Deconvolution was performed on most images shown. Deconvolution of time-lapse movies from the IX71 was performed using Huygens Professional X11 (Scientific Volume Imaging, Hilversum, Netherlands), with point spread functions determined from bead images. Deltavision z-stacks were deconvolved using Softworx native deconvolution software, with PSFs calculated from bead images taken on that system.

IF-C-FISH: immunofluorescence with chromosome FISH

A lac operator oligonucleotide CCACATGTGGAATTGTG AGCGGATAACAATTTGTGG and an oligonucleotide corresponding to an X-specific repeat, XC (Phillips et al., 2005) TTTCGCTTAGAGCGATTCCTTACCCTTAAATGGGCGCCGG, were each synthesized with 3′ and 5′ Texas Red and used in hybridization to LacO arrays integrated on X or V or to endogenous X sequences. FISH with immunofluorescence was performed as described by Phillips et al. (2009) with some modifications. Worms were washed in 0.8% egg buffer and then placed on slides pre-coated with poly-L-lysine (Sigma). Worms were then gently crushed between the slide and a 25-mm sq. #1 coverslip to extrude meiotic embryos and immediately submerged in liquid nitrogen for 10–15 min. Coverslips were then flicked off to freeze-crack eggshells, and slides were submerged in −20°C methanol for 20–30 min. Slides were then washed in 1× phosphate buffered saline (PBS) twice for 10 min and then in 1× PBST (PBS with 0.2% Tween-20) for 10 min. Slides were then blocked in 1× PBST with 4% bovine serum albumen (BSA) for 30–45 min at room temperature in a moist chamber. Blocking solution was wicked away being careful not to dry out the samples, and FITC-conjugated DM1a was applied 1:30 in 1× PBST with 4% BSA using 20 μl coverwells (Grace BioLabs). Slides were incubated in this antibody for 4 hr at room temperature or left overnight at 4°C. Slides were then washed sequentially in 1× PBST, 1× PBS, and 2× SSCT (saline sodium citrate buffer with 0.4% Tween-20) for 10 min each. Following the last wash, slides underwent secondary fixation in 7% formaldehyde in 1× egg buffer for 5 min and were immediately dipped in 2× SSCT to wash off fixative. Slides were then washed in 2× SSCT twice for 5 min each and then pre-hybridized. Pre-hybridization was performed by adding 200 μl of 50% formamide in 2× SSCT with a 200 μl coverwell (Grace BioLabs) overnight at 37°C in a moist chamber. After 24 hr, slides were taken out of 37°C incubation and placed at room temperature while the FISH probe was prepared. The FISH probe was prepared by adding 0.6 μl of the stock (900 ng/μl) to 30 μl of hybridization buffer (hybridization buffer was made as described in Phillips et al., 2009) with 300 μl/ml salmon sperm DNA and 0.1% Tween-20 per slide. Slides were then incubated in 30 μl of this solution under a hybridization slip (Grace BioLabs) at 95°C for 3 min on an OmniSlide (Thermo Scientific) and then at 37°C in a moist chamber for 48–72 hr. Following this incubation, slides were washed in 50% formamide in 2× SSCT as before but for two 1-hr incubations. Finally, slides were stained with DAPI by submerging in a Coplin jar filled with 2× SSCT 6 μg/ml DAPI for 10 min and were then washed for 30 min in fresh 2× SSCT. Slides were then wicked dry with a Kimwipe taking care not to dry out the sample and were mounted with 8 μl of DABCO Mowiol and sealed with nail polish. Following 2–3 days for curing, slides were imaged.

Metaphase chromosome counts

Chromosome counts were carried out on live embryos in utero or on fixed embryos extruded from the worm by locating metaphase spindles whose chromosomes were all aligned at the metaphase plate. Z stacks were captured at 200-nm intervals. Spindles that were oriented sideways, with their metaphase plates perpendicular to the imaging plane, were reconstructed using ImageJ 3D stack reconstruction, and chromosomes were counted only if individual masses could be discerned. Metaphase II spindles were distinguished from metaphase I spindles by the presence of polar bodies.

Analysis of lagging chromosome resolution

Time-lapse images of lagging chromosomes in FM125, FM126, and FM232 were acquired at 10-s intervals beginning at late metaphase I when the spindle is shortening and rotating and continuing through polar body extrusion and the formation of the metaphase II spindle. The direction of resolution was determined from the last frame where the lagging chromosome was still discernable from the segregating chromosome masses. At this frame, spindle length was determined by measuring the distance between the outside edges of the main masses of segregating chromosomes. Lagging chromosomes that decided which way to go when the spindle was more than 4 μm long were classified as late resolving because earlier work indicated that myosin-dependent polar body scission occurs when spindles are longer than 4 μm (Fabritius et al., 2011b). We confirmed this assumption by finding that 5/5 FM232 (GFP:PH) spindles longer than 4 μm exhibited deep cortical furrows. For nmy-2(RNAi) time-lapse sequences, only embryos in which polar body extrusion completely failed were analyzed. The fate of lagging chromosomes was scored based on whether they ended up at the cortex or in the interior prior to the formation of the metaphase II spindle. Often, chromosomes at the cortex were picked up by the metaphase II spindle. These were still scored as cortex-fated lagging chromosomes. eLife posts the editorial decision letter and author response on a selection of the published articles (subject to the approval of the authors). An edited version of the letter sent to the authors after peer review is shown, indicating the substantive concerns or comments; minor concerns are not usually shown. Reviewers have the opportunity to discuss the decision before the letter is sent (see review process). Similarly, the author response typically shows only responses to the major concerns raised by the reviewers. Thank you for sending your work entitled “The asymmetry of female meiosis reduces the frequency of inheritance of unpaired chromosomes” for consideration at eLife. Your article has been favorably evaluated by Stylianos Antonarakis (Senior editor) and two reviewers, as well as a member of our Board of Reviewing Editors. Both reviewers were generally positive about your paper, but one of them had some concerns about your interpretation. Your data clearly show that there is increased probability for unpaired chromosomes to be segregated into the polar body compared to the zygote. The FISH analysis leaves no doubt that the unpaired chromosome is the one being asymmetrically distributed during meiosis I. However, the major contributing factor to the asymmetry appears to be the inability of unpaired chromosomes to lose cohesion during meiosis I. This aspect needs to be paid greater attention as it is arguably a prerequisite for any type of asymmetric distribution to occur. Given recent work from the Meyer lab, the most likely explanation for this is that in the absence of recombination the cohesion is largely comprised of complexes containing Rec8 (deposited during pre-meiotic S-phase), which are more difficult to cleave in meiosis I (on bivalents, the axis of cohesion loss during meiosis I that is defined by crossovers has primarily Coh3/4-containing cohesion; Rec8 and Coh3/4 are different kleisin subunits of the cohesion complex that are employed during meiosis). Another explanation is that the lack of chiasma somehow reduces Aurora B loading onto the chromosome axis and prior work has shown that Aurora B is important for segregation. A supplementary figure shows reduced Aurora B on univalents in meiosis I compared to bivalents and also compared to paired sister chromatids in meiosis II. As mutants in Rec8 show equational division and form viable triploids (when mated to a wild-type male), I suspect the former may be the reason that the unpaired X chromosomes do not show equational meiosis I. Thus, it is not the “asymmetry of female meiosis” but the “inability to dissolve meiotic cohesion and the asymmetry of female meiosis” that is at play here. To address this point, we suggest the following experiment: An experimental test would be to make univalents by Rec8 inhibition in the him-8 mutant and confirm by FISH that there is no asymmetry (anticipated from the genetics). One additional issue here is that sperm meiotic defects are not accounted for in the phenotypic outcomes. It would help if the author used FISH to analyze X chromosomes in sperm nuclei and quantitatively relate the combination of their oocyte and sperm analysis to the phenotypic outcome. There may also be some clever genetic way to fertilize with a male that only delivers an X chromosome; this would be even better. You also examine the potential sources of asymmetry. In these cases, we are unsure precisely how spindle length is measured and whether tilting in the Z-axis is accounted for in all of their measurements. The representative images make it unclear precisely how positions (e.g. of the lagging chromosome) were defined. Could you sort this out? An experimental test would be to make univalents by Rec8 inhibition in the him8 mutant and confirm by FISH that there is no asymmetry (anticipated from the genetics). Severson and Meyer (2014) showed that the partial depletion of REC-8 from the short arms of a bivalent requires AIR-2. Because removal of the AIR-2 inhibitors, HTP-1/2, from the short arms requires a crossover (Martinez-Perez et al., 2008), it is expected that him-8 univalents might have both reduced amounts of AIR-2 and increased amounts of REC-8 relative to the short arms of a bivalent. These are not two mutually exclusive possibilities but rather integrally related consequences of a crossover failure. We have added analysis of the fluorescence intensity of REC-8 staining on him-8 univalents relative to the short-arms of bivalents within the same spindle, along with a citation of Severson and Meyer (2014) who showed that this would be expected when there is reduced AIR-2. We have not added FISH analysis of rec-8 him-8 double mutants because this would provide limited new insight. Because rec-8 mutants produce mostly 12 univalents, it is a relatively weak hypothesis that rec-8 him-8 would be different than rec-8 alone. Figure 2D in Severson and Meyer (2009) clearly shows that there is no bias toward eliminating univalents at anaphase I in rec-8 mutants. We agree with the reviewers that univalents that biorient and lose cohesion at anaphase I are likely to show no segregation bias at anaphase I. We believe that equational separation of univalents at anaphase I leaves open the possibility of biased (or random) segregation of single chromatids at anaphase II (this was already stated in our Introduction and is now stated in the Discussion). This cannot be studied in rec-8 because the second polar body is not formed (Severson and Meyer, 2009). One additional issue here is that sperm meiotic defects are not accounted for in the phenotypic outcomes. Sperm meiotic defects caused by him-8 can only influence the “phenotypic outcome” of self progeny. Our analysis of female meiotic spindles cannot be influenced by the sperm karyotype and is related in the text to phenotypic outcomes from crosses with wild-type XO males. For example, the first comparison of our MII chromosome counts with phenotypic outcomes (beginning of the Results section) refers to phenotypic outcomes from crosses with wild-type males. It would help if the author used FISH to analyze X chromosomes in sperm nuclei and quantitatively relate the combination of their oocyte and sperm analysis to the phenotypic outcome. There may also be some clever genetic way to fertilize with a male that only delivers an X chromosome; this would be even better. We have added analysis of X chromosome number in male pronuclei of him-8 self progeny to the last section of the results. This section is focused on looking for additional mechanisms, beyond female meiosis, that might contribute to the low frequency of XXX offspring among self progeny. Our FISH analysis of male pronuclei (distinguishable from female pronuclei by the presence of centrosomes) in the self progeny of him-8 hermaphrodites revealed 90% haploX, 8% nulloX sperm and 2% diplo X sperm (n=52). This agrees with genetic results in Hodgkin et al. (1979) using sex reversed him-8 XX males and demonstrates that nulloX sperm make a small contribution to the low frequency of XXX self progeny. You also examine the potential sources of asymmetry. In these cases, we are unsure precisely how spindle length is measured and whether tilting in the Z-axis is accounted for in all of their measurements. The representative images make it unclear precisely how positions (e.g. of the lagging chromosome) were defined. Could you sort this out? We have added the following sentence in the subsection “The meiotic contractile ring captures lagging X univalents in the first polar body”: “Spindle length was measured between the outside edges of the main chromosome masses and only in frames in which both chromosome masses were in focus (Figure 5C)”. Tilting in the Z-axis occurs in some frames of any time-lapse sequence and is obvious because one chromosome mass goes out of focus.
  45 in total

1.  Polar body formation: new rules for asymmetric divisions.

Authors:  Bernard Maro; Marie-Hélène Verlhac
Journal:  Nat Cell Biol       Date:  2002-12       Impact factor: 28.824

2.  Pseudosynapsis and decreased stringency of meiotic repair pathway choice on the hemizygous sex chromosome of Caenorhabditis elegans males.

Authors:  Paula M Checchi; Katherine S Lawrence; Mike V Van; Braden J Larson; JoAnne Engebrecht
Journal:  Genetics       Date:  2014-06       Impact factor: 4.562

3.  Actomyosin tube formation in polar body cytokinesis requires Anillin in C. elegans.

Authors:  Jonas F Dorn; Li Zhang; Véronique Paradis; Daniel Edoh-Bedi; Sylvester Jusu; Paul S Maddox; Amy Shaub Maddox
Journal:  Curr Biol       Date:  2010-11-04       Impact factor: 10.834

4.  Parental imprinting on the mouse X chromosome: effects on the early development of X0, XXY and XXX embryos.

Authors:  T Tada; N Takagi; I D Adler
Journal:  Genet Res       Date:  1993-10       Impact factor: 1.588

5.  Maternal-effect lethal mutations on linkage group II of Caenorhabditis elegans.

Authors:  K J Kemphues; M Kusch; N Wolf
Journal:  Genetics       Date:  1988-12       Impact factor: 4.562

6.  A family of zinc-finger proteins is required for chromosome-specific pairing and synapsis during meiosis in C. elegans.

Authors:  Carolyn M Phillips; Abby F Dernburg
Journal:  Dev Cell       Date:  2006-12       Impact factor: 12.270

7.  HIM-8 binds to the X chromosome pairing center and mediates chromosome-specific meiotic synapsis.

Authors:  Carolyn M Phillips; Chihunt Wong; Needhi Bhalla; Peter M Carlton; Pinky Weiser; Philip M Meneely; Abby F Dernburg
Journal:  Cell       Date:  2005-12-16       Impact factor: 41.582

8.  The aurora kinase AIR-2 functions in the release of chromosome cohesion in Caenorhabditis elegans meiosis.

Authors:  Eric Rogers; John D Bishop; James A Waddle; Jill M Schumacher; Rueyling Lin
Journal:  J Cell Biol       Date:  2002-04-08       Impact factor: 10.539

9.  Katanin controls mitotic and meiotic spindle length.

Authors:  Karen McNally; Anjon Audhya; Karen Oegema; Francis J McNally
Journal:  J Cell Biol       Date:  2006-12-18       Impact factor: 10.539

10.  Divergent kleisin subunits of cohesin specify mechanisms to tether and release meiotic chromosomes.

Authors:  Aaron F Severson; Barbara J Meyer
Journal:  Elife       Date:  2014-08-29       Impact factor: 8.140

View more
  16 in total

1.  Versatility of multivalent orientation, inverted meiosis, and rescued fitness in holocentric chromosomal hybrids.

Authors:  Vladimir A Lukhtanov; Vlad Dincă; Magne Friberg; Jindra Šíchová; Martin Olofsson; Roger Vila; František Marec; Christer Wiklund
Journal:  Proc Natl Acad Sci U S A       Date:  2018-09-28       Impact factor: 11.205

2.  Analysis of Meiotic Sister Chromatid Cohesion in Caenorhabditis elegans.

Authors:  Aaron F Severson
Journal:  Methods Mol Biol       Date:  2017

3.  Regulation of Crossover Frequency and Distribution during Meiotic Recombination.

Authors:  Takamune T Saito; Monica P Colaiácovo
Journal:  Cold Spring Harb Symp Quant Biol       Date:  2017-12-08

Review 4.  The chromosomal basis of meiotic acentrosomal spindle assembly and function in oocytes.

Authors:  Sarah J Radford; Alexandra L Nguyen; Karen Schindler; Kim S McKim
Journal:  Chromosoma       Date:  2016-11-11       Impact factor: 4.316

Review 5.  Oocyte Meiotic Spindle Assembly and Function.

Authors:  Aaron F Severson; George von Dassow; Bruce Bowerman
Journal:  Curr Top Dev Biol       Date:  2016-01-23       Impact factor: 4.897

6.  Autosomal Trisomy and Triploidy Are Corrected During Female Meiosis in Caenorhabditis elegans.

Authors:  Elizabeth Vargas; Karen McNally; Jacob A Friedman; Daniel B Cortes; David Y Wang; Ian F Korf; Francis J McNally
Journal:  Genetics       Date:  2017-09-07       Impact factor: 4.562

Review 7.  Meiosis.

Authors:  Kenneth J Hillers; Verena Jantsch; Enrique Martinez-Perez; Judith L Yanowitz
Journal:  WormBook       Date:  2017-05-04

8.  A casein kinase 1 prevents expulsion of the oocyte meiotic spindle into a polar body by regulating cortical contractility.

Authors:  Jonathan R Flynn; Francis J McNally
Journal:  Mol Biol Cell       Date:  2017-07-12       Impact factor: 4.138

9.  Condensin I protects meiotic cohesin from WAPL-1 mediated removal.

Authors:  Margarita R Hernandez; Michael B Davis; Jianhao Jiang; Elizabeth A Brouhard; Aaron F Severson; Györgyi Csankovszki
Journal:  PLoS Genet       Date:  2018-05-16       Impact factor: 5.917

10.  Manipulation of Ploidy in Caenorhabditis elegans.

Authors:  Erlyana K Clarke; Katherine A Rivera Gomez; Zaki Mustachi; Mikaela C Murph; Mara Schvarzstein
Journal:  J Vis Exp       Date:  2018-03-15       Impact factor: 1.355

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.