Literature DB >> 25815282

Characterization of Carbapenemases in Extensively Drug Resistance Acinetobacter baumannii in a Burn Care Center in Iran.

Leila Azimi1, Malihe Talebi2, Mohammad-Reza Pourshafie3, Parviz Owlia4, Abdolaziz Rastegar Lari1.   

Abstract

The emergence of multidrug resistance (MDR) and extensively drug resistance (XDR) in Acinetobacter baumannii has made an important challenge in the treatment of infections caused by this organism. The ability of carbapenemase production is one of the main mechanisms for the emergence of MDR and/or XDR in A. baumannii. The aim of this study was to detect carbapenemase producer A. baumannii. In this study, 65 imipenem resistant A. baumannii were collected from burned patients. Biochemical identification, antibiotic susceptibility test and multiplex polymerase chain reactions for the detection of carbapenemases genes were performed. The results showed that all strains carried bla OXA-51. 83%, 12.5% and 9.23% strains harbored bla OXA-23, bla VIM and bla KPC genes, respectively. None of the isolates carried bla IMP, bla OXA-48, blaNDM-1 and bla SPM-1 genes. The results of this study indicate the emergence of Klebsiella pneumoniae Carbapenemase (KPC) in A. baumannii causing nosocomial infections in burned patients which can be important for hospital infection prevention systems in Iran.

Entities:  

Keywords:  Acinetobacter baumannii; KPC; carbapenemases

Year:  2015        PMID: 25815282      PMCID: PMC4359705     

Source DB:  PubMed          Journal:  Int J Mol Cell Med        ISSN: 2251-9637


Acinetobacter baumannii has been recognized as one of the important causes of nosocomial infections in hospitalized patients, particularly in burned ones in recent years (1- 3). During the past decade, in some countries, this opportunistic pathogen had high rate of infection in burned patients and was reported to be the second most common cause of nosocomial infections in burned patients (1, 2, 4-7). A. baumannii has been shown to acquire fast antibiotic resistance elements (8, 9). Recently, this Gram negative bacilli has shown resistance to the most available antibiotics followed by the emergence of multiple (MDR) and extensive drug resistance (XDR) strains (2, 8-10). This has partly been due to the extensive use of broad spectrum antibiotics especially in burned patients (9). Carbapenems are generally used for antibiotic therapy in infections due to MDR A. baumannii. However, the emergence of carbapenem resistant isolates has made it difficult to treat such infections (2, 3, 8, 11-14). One of the most common and important mechanisms in carbapenem resistance in A. baumannii is their ability to produce carbapenemase enzymes (2, 3, 6-8). Among the carbapenem hydrolyzing β-lactamases, class D oxacillinases (OXA type) is the most prevalent in A. baumannii strains (3, 9, 14). On the other hand, some studies have reported class B beta lactamases (metallo- beta lactamases) in A. baumannii as the most prevalent carbapenemase after OXA- type (8). The significant importance is the worldwide prevalence of Klebsiella pneumoniae Carbapenemase (KPC) producers (15, 16). Gram negative KPC producers can be resistant to all beta lactam antibiotics except aztreonam (17). Most of these carbapenemases have been located in transferable genetic elements and can spread among A. baumannii and even into other Gram- negative bacilli (2, 8). Therefore, the determination of carbapenemase- producing strains in healthcare systems could help in the eradication of A. baumannii antibiotic resistant strains. Sequence of primers PCR conditions for bla genes amplification

Materials and methods

Bacterial isolates This cross-sectional study was conducted in Motahari Hospital which is the only referral burn center in Tehran, Iran. Sixty-five imipenem resistant A. baumannii isolated from burn wound were collected from admitted patients from April to July 2013. Primary identification of these strains was performed by conventional biochemical tests such as oxidase, TSI, SIM and growing at 44 oC as A. baumannii. The identification of isolates was confirmed by API 20 NE (Bio-Merieux, Lyon, France) strip test. Antimicrobial susceptibility testing The antibiotic susceptibility testing was performed by disc diffusion method on Mueller–Hinton agar using cefotaxime (30 µg), ceftazidime (30 µg), imipenem (10 µg), ticarcillin (75 µg), ticarcillin- clavulanic acid (75/10 µg), piperacillin (100 µg), piperacillin- tazobactam (100/10 µg), ciprofloxacin (5 µg), gentamicin (10 µg), tobramycin (10 µg), amikacin (30 µg), tetracycline (30 µg), trimethoprim (5 μg) and trimethoprim- sulfamethoxazole (1.25/23.75 μg) according to clinical and laboratory standards institute (CLSI) 2011. The standard antibiotic disks used in this study were from MAST Company (Mast Diagnostics, UK). P. aeruginosa ATCC 27853 was used as control strain in the antibiotic susceptibility testing. Detection of extended spectrum beta lactamase (ESBL) has been conducted by combination disc method by using ceftazidime and ceftazidime plus clavulanic acid. Strains with increasing at least 5 mm in the diameter of inhibition zone around ceftazidime plus clavulanic acid in contrast of ceftazidime alone were considered as an ESBL producer. PCR amplification for carbapenemases produ-ction genes Extraction of bacterial DNA was performed with a plasmid Minikit (Qiagen GmbH, Hilden, Germany) according to the manufacturer’s instructions. Three different sets of multiplex PCR for blaVIM, blaIMP and blaOXA-23, blaOXA-48 and blaNDM-1, blaSPM-1 genes and common PCR for blaKPC and blaOXA-51genes were designed. The lists of primers used are shown in Table 1 and amplifivation conditions are represented in Table 2.
Table 1

Sequence of primers

Primer Sequence (5 ' →3 ' ) PCR pdoduct size (bp) References
VIM FTTGACACTCCATTTACDG390 
VIM RGATYGAGAATTAAGCCACYCT  
Imp FGATGGTGTTTGGTCGCATA139
Imp RCGAATGCGCAGCACCAG  
OXA-23 FGATGTGTCATAGTATTCGTCGT1050 
OXA-23 RTCACAACAACTAAAAGCACTGT  9
OXA-48-ike FCCAAGCATTTTTACCCGCATCKACC389 
OXA-48-like RGYT TGA CCA TAC GCT GRC TGC G  
NDM-1 FCCCGGCCACACCAGTGACA129
NDM-1 RGTAGTGCTCAGTGTCGGCAT9
SPM-1 FGGGTGGCTAAGACTATGAAGCC447
SPM-1 RGCCGCCGAGCTGAATCGG
OXA-51-like FTAATGCTTTGATCGGCCTTG353
OXA-51-like RTGGATTGCACTTCATCTTGG  
KPC FGTATCGCCGTCTAGTTCTGC63618
KPC RGGTCGTGTTTCCCTTTAGCC
Table 2

PCR conditions for bla genes amplification

No. Cycles Final extension Temperature (time) Extension Temperature (time) Annealing Temperature (time) Denaturation Temperature (time) Initial denaturation Temperature (time) Gene
3072 oC (7 min)72 oC (1 min)60 oC (40 sec)94 oC (40 sec)94 oC (10 min) bla VIM & blaIM:
3072 oC (7 min)72 oC (1 min)55 oC (1 min)94 oC (30 sec)94 oC (1 min) bla OXA-23 & blaOXA-48
3072 oC (1 min)72 oC (1 min)60 oC (40 sec)94 oC (30 sec)94 oC (1 min) bla NDM-1 & blaSPM-1
3072 oC (5 min)72 oC (1 min)56 oC (1 min)94 oC (1 min)94 oC (5 min) bla KPC
3072 oC (5 min)72 oC (1 min)58 oC (1 min)94 oC (45 sec)94 oC (5 min) bla OXA-51
Antibiotic resistance patterns CTX: cefotaxime, CAZ: ceftazidime, CEF: CEFEPIME, IMI: imipenem, PTZ: piperacillin-Tazobactam, PRL: piperacillin, TC: ticarcillin, TC-c: ticarcillin- clavulanic acid, GM: gentamicin, AK: amikacin, TO: tobramycin, TM: trimethoprim, SXT: trimethoprim- sulfamexazole, CI: ciprofloxacin, T: tetracycline Number and percentages of detected bla genes PCR products were analyzed by electrophoresis on 1.5% agarose gel with SYBR safe staining. Direct sequencing of amplicons was carried out using ABI 3730X capillary sequencer (Genfanavaran, Macrogen, Seoul, Korea).

Results

A total of 65 A. baumannii were isolated from 65 hospitalized burned patients, 15 (23%) females and 50 (77%) males. The age of patients were between 9 months to 72 years and total body burned surface area (TBSA) was more than 6%. Causes of burn were classified as follows: fire 6 (11%), hot water 6 (11%), electricity 10 (17%) gas 10 (17%), 6 (11%) chemical materials and others 19 (33%). Based on antibiotic susceptibility test, 97% of strains were resistant to all tested beta lactam antibiotics and 80% of them showed resistance to all tested aminoglycoside antibiotics. The results of antibiotic susceptibility tests indicated seven antibiotic resistance patterns (Table 3). Pattern one was observed in 55% of isolates. Those strains were resistant to all tested antibiotics except colistin and tetracycline. In pattern two, all strains were resistant to the tested antibiotics which were observed in 25% of strains. In 20% strains, resistance to at least one of aminoglycoside antibiotics were observed according to antibiotic resistance patterns.
Table 3

Antibiotic resistance patterns

patterns Antibiotic Resistance patterns Number Percentage
1 CTX CAZ CEF IMI PTZ PYR TC TC-C GM AK TO TM SXT CI 3655
2 CTX CAZ CEF IMI PTZ PYR TC TC-C GM AK TO TM SXT CI T1625
3 CTX CAZ CEF IMI PTZ PYR TC TC-C AK TM SXT CI T711
4 CTX CAZ CEF IMI PTZ PYR TC TC-C GM TO TM SXT CI 35
5 CTX CAZ CEF IMI PTZ PYR TC TC-C AK TO TM SXT CI T23
7 CTX CAZ CEF IMI PTZ PYR TC TC-C AK TO TM SXT CI 11

CTX: cefotaxime, CAZ: ceftazidime, CEF: CEFEPIME, IMI: imipenem, PTZ: piperacillin-Tazobactam, PRL: piperacillin, TC: ticarcillin, TC-c: ticarcillin- clavulanic acid, GM: gentamicin, AK: amikacin, TO: tobramycin, TM: trimethoprim, SXT: trimethoprim- sulfamexazole, CI: ciprofloxacin, T: tetracycline

The Verona integron-encoded metallo-β-lactamase (VIM) and KPC producing strains were observed just in two antibiotic resistance patterns. OXA-23 and OXA-51 producing strains showed all seven antibiotic resistance patterns. The ability of ESBL production was indicated just in one strain in combination disc method. Sequence analysis showed that blaOXA-51 gene was detected in all isolates, 54 (83%) isolates included blaOXA-23 gene. Eight (12.5%) and 6 (9.23%) strains carried blaVIM and blaKPC genes respectively (Figures 1-4). Six out of eight VIM- producing strains contained both blaOXA-23 and blavim genes (Table 4). All of KPC producer isolates were combined by OXA-23. On the other hand, none of them contained blaIMP, blaOXA-48, blaNDM-1 and blaSPM-1 genes.
Fig. 1

Multiplex PCR amplification fragments for the detection of vim and imp gene among Acinetobacter baumannii isolates. Lane 1: negative control, lanes 2, 3: positive vim strains, lane 4: positive control of vim and imp genes and M: 1kb DNA size marker

Fig 4

PCR amplification fragments for the detection of oxa-51 gene among Acinetobacter baumannii isolates. Lane 1: positive control of oxa-51, lanes 2- 9: positive strains of oxa-51.and M: 1kb DNA size marke

Table 4

Number and percentages of detected bla genes

bla VIM and bla OXA_23 bla KPC and bla OXA_23 bla VIM bla OXA_23 bla OXA-51 genes
6(9.52%)6(9.52%)2(3.1%)42(66.6%)63(100%)NO.(%)
Multiplex PCR amplification fragments for the detection of vim and imp gene among Acinetobacter baumannii isolates. Lane 1: negative control, lanes 2, 3: positive vim strains, lane 4: positive control of vim and imp genes and M: 1kb DNA size marker PCR amplification fragments for the detection of kpc gene among Acinetobacter baumannii isolates. Lane 1: positive control of kpc gene, lane 2: negative control, lanes 3- 6: positive kpc strains and M: 1kb DNA size marker PCR amplification fragments for the detection of oxa-23 and oxa-48 genes among Acinetobacter baumannii isolates. Lane 1- 4 and 7, 8: positive oxa-23 strains, lanes 5, 6: negative control of oxa-23 and oxa-48 genes, lane 9: positive control of oxa-23 and oxa-48 genes and M: 1kb DNA size marker PCR amplification fragments for the detection of oxa-51 gene among Acinetobacter baumannii isolates. Lane 1: positive control of oxa-51, lanes 2- 9: positive strains of oxa-51.and M: 1kb DNA size marke

Discussion

According to many studies, A. baumannii is known as one of the most common Gram negative bacteria that can cause nosocomial infection in health care centers especially in burned hospitalized patients (2, 3, 8). Treatment of infection due to XDR A. baumannii is extremely difficult and causes more morbidity and motility in hospitalized burn patients (13, 19). The results of this study indicated that 98.4% of A. baumannii were resistant to all tested beta lactam antibiotics and 55% of them remained susceptible just to colistin and tetracycline. Generally, carbapenemases producer strains of A. baumannii convert to XDR strains and can be resistant to most antibiotics used for the treatment of A. baumannii infections. Wounds of burned patients generally infected by multiple bacteria harboring antibiotic resistance genes located in transferable genetic elements, can be a disaster in burn care units. Resistance to all tested antibiotics in 50% of isolated KPC- producer A. baumannii and to all tested antibiotics except tetracycline in the remaining isolates is a significant point and creates limitation for treatment choices of this kind of infection. OXA type is the common carbapenemase in A. baumannii and OXA-23 is the common one in Iran (3, 8, 14, 20). Outbreaks of OXA-23 producing A. baumannii have been reported in several Asian countries such as China, Thailand, Taiwan (8, 6, 11). On the other hand, metallo- bata lactamase (MBL) can be considered as a second common carbapenemase in A. baumannii. In the research which was carried out by Szejbach in 2013 in Poland on MBL- producer A. baumannii, it was shown that 10.3% of isolates carried blaIMP-like gene. No blaVIM-4 was detected in the isolates (7). On the contrary, in the same study in India in 2012, 47% of isolated A. baumannii carried the blaVIM and 0.9% of them harbored blaIMP. The variants result may be related to different ecology situation, antibiotic therapy program and variants antibiotype patterns in two different countries (21). In 2013 in China, OXA-51 gene was detected in all isolated A. baumannii and 94% carried oxa-23 gene (22). Also, the results of a study in 2012 on 68 imipenem-resistant A. baumannii in Iran indicated that OXA-51 and OXA-23 types were detected in all strains (20). But in the current study, 83% of isolates were identified as an OXA-23-producer which can be associated to the source of isolated bacteria. In this study, all isolates were collected from wounds of burned patients but in the study carried out in 2012 in Iran (20), the isolates were obtained from different medical specimens. On the other hand, in 2012 in another study in Iran, 88.7% of imipenem resistant A. baumannii carried blaOXA-23-like gene (14) and these results are similar to ours. In Korea in 2013, 97% of Acinetobacter isolates harbored the blaOXA-23-like gene (23). Mutation in OXA type enzymes because of overuse and/or abuses of carbapenem antibiotics in clinic can lead to high carbapenem activity by OXA type carbapenemase enzymes. Because they generally have low activity of carbapenem hydrolyzing activity (9, 24). In addition, we had a report from the prevalence of OXA-48- producer K. pneumonia at the same time and same burn unit and this gene was located in mobile genetic elements. Thus, we have detected specifically oxa-48 gene in isolated A. baumannii (25). Consequently, it can be an alarming threat in health in Iran. Moreover, as the gene of this carbapenemase is located in a mobile genetic element and can be transferred to A. baumannii, it can impose more complications in burn patient's therapy. In the current study, 97% of carbapemase producer strains subsequently were resistant to all beta lactam antibiotics and 80% of them were resistant to aminoglycoside. These results can be a concern for physicians because 78% of the strains were sensitive to colistin and tetracycline only. The results of this study indicated that the ability of carbapenemase production can be one of the most important reasons for the emergence of XDR A. baumannii in nosocomial infections. The infection is important in burned patients because their skin lose a first protective barrier, putting the patients at high risk for multiple infections. Regarding to the mentioned above study and our results, it seems that A. baumannii is becoming one of the important and challengeable Gram-negative microorganism and P. aeruginosa is replaced by A. baumannii in nosocomial infection. The emergence of their XDR type makes significant therapeutic problem especially in burned patients. According to our results and another study (26), colistin remains a more effective antibiotic for the treatment of infection caused by these XDR and/or MDR microorganisms. The spread of carbapene-mase producer A. baumannii, as a second important pathogen that can make nosocomial infection in burned patients can be alarming for public health organization and health care systems.
  26 in total

1.  Development of a set of multiplex PCR assays for the detection of genes encoding important beta-lactamases in Enterobacteriaceae.

Authors:  Caroline Dallenne; Anaelle Da Costa; Dominique Decré; Christine Favier; Guillaume Arlet
Journal:  J Antimicrob Chemother       Date:  2010-01-12       Impact factor: 5.790

2.  A set of multiplex PCRs for genotypic detection of extended-spectrum β-lactamases, carbapenemases, plasmid-mediated AmpC β-lactamases and OXA β-lactamases.

Authors:  Guido M Voets; A C Fluit; Jelle Scharringa; James Cohen Stuart; Maurine A Leverstein-van Hall
Journal:  Int J Antimicrob Agents       Date:  2011-02-25       Impact factor: 5.283

3.  High prevalence of bla(OXA)-23 in oligoclonal carbapenem-resistant Acinetobacter baumannii from Siriraj Hospital, Mahidol University, Bangkok, Thailand.

Authors:  Badri Thapa; Chanwit Tribuddharat; Somporn Srifuengfung; Chertsak Dhiraputra
Journal:  Southeast Asian J Trop Med Public Health       Date:  2010-05       Impact factor: 0.267

4.  Molecular characterization of Klebsiella pneumoniae carbapenemase-producing isolates in southern Brazil.

Authors:  Vanessa Bley Ribeiro; Leonardo Neves Andrade; Adriano Rostirolla Linhares; Juliana Barin; Ana Lúcia da Costa Darini; Alexandre P Zavascki; Afonso Luis Barth
Journal:  J Med Microbiol       Date:  2013-09-02       Impact factor: 2.472

5.  Antibiotic resistance and OXA-type carbapenemases-encoding genes in airborne Acinetobacter baumannii isolated from burn wards.

Authors:  Jing Gao; Xiaonan Zhao; Ying Bao; Ruihua Ma; Yufa Zhou; Xinxian Li; Tongjie Chai; Yumei Cai
Journal:  Burns       Date:  2013-07-22       Impact factor: 2.744

6.  Prevalence of OXA-type β-lactamases among Acinetobacter baumannii isolates from Northwest of Iran.

Authors:  Nasrollah Sohrabi; Safar Farajnia; Mohammad Taghi Akhi; Mohammad Reza Nahaei; Behrooz Naghili; Amir Peymani; Zohreh Amiri; Mohammad Ahangarzadeh Rezaee; Nazli Saeedi
Journal:  Microb Drug Resist       Date:  2012-02-21       Impact factor: 3.431

7.  Surveillance of carbapenem-resistant Pseudomonas aeruginosa isolates from Puerto Rican Medical Center Hospitals: dissemination of KPC and IMP-18 beta-lactamases.

Authors:  Daniel J Wolter; Noha Khalaf; Iraida E Robledo; Guillermo J Vázquez; Maria I Santé; Edna E Aquino; Richard V Goering; Nancy D Hanson
Journal:  Antimicrob Agents Chemother       Date:  2009-02-02       Impact factor: 5.191

8.  Carbapenem and multidrug resistance in Gram-negative bacteria in a single centre in Italy: considerations on in vitro assay of active drugs.

Authors:  Maria Lina Mezzatesta; Carla Caio; Floriana Gona; Roberta Cormaci; Iasmine Salerno; Tiziana Zingali; Carmelo Denaro; Mauro Gennaro; Cristiana Quattrone; Stefania Stefani
Journal:  Int J Antimicrob Agents       Date:  2014-06-02       Impact factor: 5.283

9.  Evolution of carbapenem resistance in Acinetobacter baumannii: an 18-year longitudinal study from a medical center in northern Taiwan.

Authors:  Wen-Wei Ku; Che-Hsuang Kung; Chi-Hung Lee; Chih-Peng Tseng; Ping-Feng Wu; Shu-Chen Kuo; Te-Li Chen; Yi-Tzu Lee; Fu-Der Wang; Chang-Phone Fung
Journal:  J Microbiol Immunol Infect       Date:  2013-09-21       Impact factor: 4.399

10.  Usefulness of phenotypic and genotypic methods for metallo-beta-lactamases detection in carbapenem-resistant Acinetobacter baumannii strains.

Authors:  Aleksandra Szejbach; Agnieszka Mikucka; Tomasz Bogiel; Eugenia Gospodarek
Journal:  Med Sci Monit Basic Res       Date:  2013-01-21
View more
  18 in total

Review 1.  Multidrug Resistant Acinetobacter baumannii: Resistance by Any Other Name Would Still be Hard to Treat.

Authors:  David A Butler; Mark Biagi; Xing Tan; Samah Qasmieh; Zackery P Bulman; Eric Wenzler
Journal:  Curr Infect Dis Rep       Date:  2019-11-16       Impact factor: 3.725

2.  Identification of Klebsiella pneumoniae Carbapenemase-producing Klebsiella oxytoca in Clinical Isolates in Tehran Hospitals, Iran by Chromogenic Medium and Molecular Methods.

Authors:  Majid Validi; Mohammad Mehdi Soltan Dallal; Masoumeh Douraghi; Jalil Fallah Mehrabadi; Abbas Rahimi Foroushani
Journal:  Osong Public Health Res Perspect       Date:  2016-08-31

3.  Extensive colonization with carbapenemase-producing microorganisms in Romanian burn patients: infectious consequences from the Colectiv fire disaster.

Authors:  L E Pirii; A W Friedrich; J W A Rossen; W Vogels; G I J M Beerthuizen; M K Nieuwenhuis; A M D Kooistra-Smid; E Bathoorn
Journal:  Eur J Clin Microbiol Infect Dis       Date:  2017-10-23       Impact factor: 3.267

4.  Prevalence of carbapenemases among high-level aminoglycoside-resistant Acinetobacter baumannii isolates in a university hospital in China.

Authors:  Yanhong Wang; Min Shen; Jingni Yang; Min Dai; Yaowen Chang; Chi Zhang; Guangxin Luan; Baodong Ling; Xu Jia
Journal:  Exp Ther Med       Date:  2016-10-20       Impact factor: 2.447

Review 5.  The threat of carbapenem-resistant gram-negative bacteria in a Middle East region.

Authors:  Effat Davoudi-Monfared; Hossein Khalili
Journal:  Infect Drug Resist       Date:  2018-10-17       Impact factor: 4.003

6.  Role of efflux pumps in reduced susceptibility to tigecycline in Acinetobacter baumannii.

Authors:  S H Ardehali; T Azimi; Fatemeh Fallah; M Owrang; N Aghamohammadi; L Azimi
Journal:  New Microbes New Infect       Date:  2019-04-16

7.  Wide distribution of carbapenem resistant Acinetobacter baumannii in burns patients in Iran.

Authors:  Zahra Farshadzadeh; Farhad B Hashemi; Sara Rahimi; Babak Pourakbari; Davoud Esmaeili; Mohammad A Haghighi; Ali Majidpour; Saeed Shojaa; Maryam Rahmani; Samira Gharesi; Masoud Aziemzadeh; Abbas Bahador
Journal:  Front Microbiol       Date:  2015-10-20       Impact factor: 5.640

8.  Rapid dissemination of colistin and carbapenem resistant Acinetobacter baumannii in Central Greece: mechanisms of resistance, molecular identification and epidemiological data.

Authors:  O Oikonomou; S Sarrou; C C Papagiannitsis; S Georgiadou; K Mantzarlis; E Zakynthinos; G N Dalekos; E Petinaki
Journal:  BMC Infect Dis       Date:  2015-12-09       Impact factor: 3.090

Review 9.  Insights on the Horizontal Gene Transfer of Carbapenemase Determinants in the Opportunistic Pathogen Acinetobacter baumannii.

Authors:  Gabriela Jorge Da Silva; Sara Domingues
Journal:  Microorganisms       Date:  2016-08-23

Review 10.  Antibiotic Resistance Profiles, Molecular Mechanisms and Innovative Treatment Strategies of Acinetobacter baumannii.

Authors:  Corneliu Ovidiu Vrancianu; Irina Gheorghe; Ilda Barbu Czobor; Mariana Carmen Chifiriuc
Journal:  Microorganisms       Date:  2020-06-21
View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.