| Literature DB >> 25789988 |
Des Field1, Noémie Gaudin1, Francy Lyons1, Paula M O'Connor2, Paul D Cotter3, Colin Hill4, R Paul Ross3.
Abstract
Antibiotic resistance and the shortage of novel antimicrobials are among the biggest challenges facing society. One of the major factors contributing to resistance is the use of frontline clinical antibiotics in veterinary practice. In order to properly manage dwindling antibiotic resources, we must identify antimicrobials that are specifically targeted to veterinary applications. Nisin is a member of the lantibiotic family of antimicrobial peptides that exhibit potent antibacterial activity against many gram-positive bacteria, including human and animal pathogens such as Staphylococcus, Bacillus, Listeria, and Clostridium. Although not currently used in human medicine, nisin is already employed commercially as an anti-mastitis product in the veterinary field. Recently we have used bioengineering strategies to enhance the activity of nisin against several high profile targets, including multi-drug resistant clinical pathogens such as methicillin-resistant Staphylococcus aureus (MRSA) and vancomycin-resistant enterococci (VRE) and also against staphylococci and streptococci associated with bovine mastitis. However, newly emerging pathogens such as methicillin resistant Staphylococcus pseudintermedius (MRSP) pose a significant threat in terms of veterinary health and as a reservoir for antibiotic resistance determinants. In this study we created a nisin derivative with enhanced antimicrobial activity against S. pseudintermedius. In addition, the novel nisin derivative exhibits an enhanced ability to impair biofilm formation and to reduce the density of established biofilms. The activities of this peptide represent a significant improvement over that of the wild-type nisin peptide and merit further investigation with a view to their use to treat S. pseudintermedius infections.Entities:
Mesh:
Substances:
Year: 2015 PMID: 25789988 PMCID: PMC4366236 DOI: 10.1371/journal.pone.0119684
Source DB: PubMed Journal: PLoS One ISSN: 1932-6203 Impact factor: 3.240
Fig 1Structure of nisin A and deferred antagonism assays of nisin A and nisin I4V.
(A) Residues are represented in the single letter code. Post translational modifications are indicated as follows, Dha: dehydroalanine, Dhb: dehydrobutyrine, Abu: 2-aminobutyric acid, A-A: lanthionine, Abu-A: 3-methyllanthionine. (B) Growth inhibition of S. intermedius DSM 20373, S. pseudintermedius DK729 and S. pseudintermedius DSM21284 by the nisin A producing strain L. lactis NZ9800 pDF05 (pCI372-nisA) and the nisin derivative I4V producing strain L. lactis NZ9800 pDF12 (nisA-I4V).
Oligonucleotides utilised in this study.
| Primer name | Sequence |
|---|---|
| NisI1degFOR | 5’ ATT ACA AGT |
| NisI1degREV | 5’ ACA TAG CGA |
| NisT2degFOR | 5’ CCA CGC ATT |
| NisT2degREV | 5’ CGA AAT ACT |
| NisI4degFOR | 5’ ATT ACA AGT |
| NisI4degREV | 5’ ACA TAG CGA |
| NisS5degFOR | 5’ ACA AGT ATT |
| NisS5degREV | 5’ TGT ACA TAG |
| NisL6degFOR | 5’ AGT ATT TCG |
| NisL6degREV | 5’ GGG TGT ACA |
| NisP9degFOR | 5’ CTA TGT ACA |
| NisP9degREV | 5’ TTT ACA ACC |
| NisG10degFOR | 5’ TGT ACA CCC |
| NisG10degREV | 5’ TGT TTT ACA |
| NisG14degFOR | 5’ TGT AAA ACA |
| NisG14degREV | 5’ CAT CAG AGC |
| NisA15degFOR | 5’ AAA ACA GGA |
| NisA15degREV | 5’ ACC CAT CAG |
| NisL16degFOR | 5’ ACA GGA GCT |
| NisL16degREV | 5’ ACA ACC CAT |
| NisM17degFOR | 5’ GGA GCT CTG |
| NisM17degREV | 5’ GTT ACA ACC |
| NisG18degFOR | 5’ GCT CTG ATG |
| NisG18degREV | 5’ CAT GTT ACA |
| NisA24degFOR | 5’ ATG AAA ACA |
| NisA24degREV | 5’ ATG ACA AGT |
| NisH27degFOR | 5’ GCA ACT TGT |
| NisH27degREV | 5’AAT ACT ACA |
| NisI30degFOR | 5’ CAT TGT AGT |
| NisI30degREV | 5’ TTT GCT TAC GTG |
| NisH31degFOR | 5’ TGT AGT ATT |
| NisH31degREV | 5’ TTT GCT TAC |
| NisV32degFOR | 5’ AGT ATT CAC |
| NisV32degREV | 5’ TTA TTT GCT |
| NisS33degFOR | 5’ ATT CAC GTA |
| NisS33degREV | 5’ |
| NisK34degFOR | 5’ CAC GTA AGC |
| NisK34degREV | 5’ |
| pCI372FOR | 5’- CGGGAAGCTAGAGTAAGTAG -3' |
| pCI372Rev | 5’- ACCTCTCGGTTATGAGTTAG -3’ |
Emboldened sequences represent degenerate codons (N = A+C+G+T, K = G+T, M = A+C). Underlined sequence corresponds to plasmid (pCI372) DNA.
Deferred antagonism assays of L. lactis NZ9800 strains producing nisin A (wild type control) and the nisin derivative I4V against representative strains of S. pseudintermedius and S. intermedius.
| Strain | Nisin A | Nisin I4V | P-value |
|---|---|---|---|
| mm | mm | ||
|
| 16.90 ± 0.48 |
| 0.009 |
|
| 16.88 ± 0.29 |
| 0.008 |
|
| 16.84 ± 0.27 |
| 0.039 |
Values are the mean of triplicate deferred antagonism assays and represent zone of inhibition (diameter of zone). All values in bold reached statistical significance compared to nisin control (Student’s t-test: P < 0.05).
Specific activity of nisin A and nisin I4V against a range of indicator organisms.
| Strain | Nisin A | Nisin I4V | Fold difference |
|---|---|---|---|
| mg/L (μM) | mg/L (μM) | ||
|
| 2 (0.625) |
| 2 |
|
| 1 (0.313) |
| 4 |
|
| 3.0 (0.936) |
| 2 |
|
| 0.75 (0.234) | 1.50 (0.468) | -2 |
|
| 1.5 (0.468) | 1.5 (0.468) | 0 |
|
| 0.2 (0.062) | 0.2 (0.062) | 0 |
|
| 25 (7.5) |
| 2 |
|
| 6.28 (1.875) | 6.28 (1.875) | 0 |
Results from minimum inhibitory concentration assays of purified nisin A and nisin I4V against various Gram-positive targets. Values given are identical results from three independent determinations. Fold Difference represents the improvement of I4V compared to nisin against the relevant indicator.
Fig 2Growth curve analysis of strains in nisin A and nisin I4V peptides.
(A) S. pseudintermedius DSM21284 in 0.26 mg/L of nisin A (closed square), I4V (closed diamond) and no peptide (open circle), and (B) S. pseudintermedius DK729 in 0.52 mg/L of Nisin A (closed square), I4V (closed diamond) and no peptide (open circle) and (C) S. intermedius DSM20373 in 0.52 mg/L of Nisin A (closed square), I4V (closed diamond) and no peptide (open circle).
Fig 3Inhibition of biofilm formation with nisin A and nisin I4V peptides.
(A) Results of treatment of S. pseudintermedius DK729 with 1, 1/2, 1/4, 1/8 and 1/16X MIC of nisin A and nisin I4V peptides for 24 hrs prior to biofilm formation. The amount of biofilm was quantified by measuring the OD595 of crystal violet dissolved in acetic acid. The means and standard deviations of triplicate determinations are presented. Asterisks indicate statistically significant differences (Student’s t-test) between peptides used at similar concentration (** = p < 0.01) and (B) Growth curve analysis of strain S. pseudintermedius DK729 in 1X MIC peptides of nisin A (closed square), I4V (closed diamond) and no peptide (open circle).
Fig 4Treatment of biofilms with nisin A and nisin I4V peptides.
(A) S. pseudintermedius DK729 and (B) S. pseudintermedius DSM 21284 with 1, 2, 4, 8 and 16X MIC of nisin A and nisin I4V peptides for 24 hrs as evaluated by crystal violet (CV) staining. The amount of biofilm was quantified by measuring the OD595 of CV dissolved in acetic acid. The means and standard deviations of triplicate determinations are presented. Asterisks indicate statistically significant differences (Student’s t-test) between peptides used at similar concentration (* = p < 0.05, ** = p < 0.01, *** = p < 0.001).
Fig 5Colorimetric readings of biofilms.
Viability of S. pseudintermedius DK729 following treatment with 16X MIC of nisin A and nisin I4V peptides and untreated control for 24 hrs as evaluated by the XTT (2,3-bis[2-methyloxy-4-nitro-5-sulfophenyl]-2H-tetrazolium-5-carboxanilide) assay measured using a microtiter plate reader. Asterisks indicate statistically significant differences (Student’s t-test) between peptides used at similar concentration (* = p < 0.05).
Fig 6Morphology of nisin-treated biofilms examined by microscopy.
(A) Examination of S. pseudintermedius DK729 and (B) S. pseudintermedius DSM21284 biofilms (magnification 1000X) after 24 hour treatment with 16X MIC of nisin A (Wt) and nisin I4V peptides.