Literature DB >> 25782154

Microarray analysis on gene regulation by estrogen, progesterone and tamoxifen in human endometrial stromal cells.

Chun-E Ren1, Xueqiong Zhu2, Jinping Li3,4,5, Christian Lyle6, Sean Dowdy7, Karl C Podratz8, David Byck4, Hai-Bin Chen9, Shi-Wen Jiang10,11,12.   

Abstract

Epithelial stromal cells represent a major cellular component of human uterine endometrium that is subject to tight hormonal regulation. Through cell-cell contacts and/or paracrine mechanisms, stromal cells play a significant role in the malignant transformation of epithelial cells. We isolated stromal cells from normal human endometrium and investigated the morphological and transcriptional changes induced by estrogen, progesterone and tamoxifen. We demonstrated that stromal cells express appreciable levels of estrogen and progesterone receptors and undergo different morphological changes upon hormonal stimulation. Microarray analysis indicated that both estrogen and progesterone induced dramatic alterations in a variety of genes associated with cell structure, transcription, cell cycle, and signaling. However, divergent patterns of changes, and in some genes opposite effects, were observed for the two hormones. A large number of genes are identified as novel targets for hormonal regulation. These hormone-responsive genes may be involved in normal uterine function and the development of endometrial malignancies.

Entities:  

Mesh:

Substances:

Year:  2015        PMID: 25782154      PMCID: PMC4394510          DOI: 10.3390/ijms16035864

Source DB:  PubMed          Journal:  Int J Mol Sci        ISSN: 1422-0067            Impact factor:   5.923


1. Introduction

In human endometrium the epithelial glandular cells are surrounded by a rich mesenchymal component that contains fibroblast-like stromal cells. Morphological changes in both epithelial and stromal cells during menstrual cycles have been well documented [1,2,3]. In the proliferative phase, estrogen exerts mitogenic effects on both cell groups, leading to a quick expansion of glandular epithelial and stromal cells [4]. The increased levels of progesterone in the secretory phase suppress cell growth but promote differentiation [5]. At the end of the secretory phase, endometrial gland maturation is accompanied by predecidualization changes of stromal cells around blood vessels. During the decidualization process stromal cells become terminally differentiated upon implantation. In the absence of implantation, withdrawal of ovarian hormones leads to shedding of the endometrium, which marks the completion of a menstrual cycle [6,7]. Thus, steroid hormones serve as a driving force behind the synchronized actions of stromal and epithelial glandular cells. However, most previous studies concentrated on epithelial cells with relatively little attention paid to the hormonal response by stromal cells. The molecular events controlled by ovarian hormones in stromal cells, such as those occurring on the gene transcription level, remain largely unknown. In addition to their function of supporting normal reproductivity, stromal cells and their responses to ovarian steroids are involved in the pathogenesis of endometrial hyperplasia and endometriosis. It has been observed that synthetic progestins such as levonorgestrel and oral medroxyprogesterone acetate significantly affect the expression of estrogen and progesterone receptors in glandular and stromal cells [8]. This indicates the presence of autoregulatory feedback loops that may amplify hormonal responses in these cells. Interestingly, endometrial stromal cells isolated from women with endometriosis exhibited aberrant responses to ovarian hormones in the migratory and invasive behaviors, suggesting the involvement of these cells in the pathogenesis of endometriosis that is characterized by ectopic endometrial overgrowth [9]. Endometrial stromal sarcoma is a rare but life-threatening uterine malignancy with a poor prognosis [10]. Current radiation and chemotherapy regimens are relatively ineffective for treating stromal sarcomas [11]. Malignant mixed mullerian tumor, also referred to as carcinosarcoma, represents a highly aggressive uterine malignancy containing both carcinomatous and sarcomatous components [12]. While most carcinosarcomas are believed to arise from monoclonal endometrial stem cells, some cases may be true collision tumors derived from epithelial and stromal cells independently [12]. It is noteworthy that elevated estrogen levels associated with obesity and nulliparity represent the most recognized risk factor for stromal sarcoma and mixed mullerian tumors [13]. Exposure to exogenous estrogenic compounds, including the use of oral contraceptives, postmenopausal hormone replacement therapy [14], and use of tamoxifen for breast cancer treatment [15], have all been linked to an increased risk for stromal sarcomas. These observations underscore the significance of carcinogenic effects by estrogens in human endometrial stromal cells. An increasing body of evidence supports the involvement of mesenchymal-epithelial interactions in cancer development [16]. In prostate cancers, steroid-induced production of EGF and TGF-α by stromal cells is considered to be a major factor for continued cancer expansion [17]. This paracrine action may contribute to a seemingly androgen-independent growth of epithelial cells, and account for the failure of predicting the response to endocrine therapies merely based on the androgen receptor levels of cancer cells [17]. More interestingly, frequent loss of heterozygosity (LOH) has been found in normal-appearing stromal cells micro-dissected from mammary ductal carcinomas. This finding suggests that abnormal stromal-epithelial interactions may play a significant part in the progression of mammary neoplasia, and alterations in stromal cells may precede the epithelial transformation [18]. In vitro studies have shown that uterine stromal cells are able to promote the growth [19] and invasiveness [20] of endometrial cancer cells when they were co-cultured in a three-dimensional model. In this system, matrix metalloproteinases (MMPs) produced by normal stromal cells were found to translocate to the surface of endometrial adenocarcinoma cells. Interestingly, MMP-2 secretion and translocation in the co-cultures were greatly enhanced by estrogen [20]. It was also reported that stromal cells produce vascular endothelial growth factor and soluble vascular endothelial growth factor receptor, and the expression of these factors are regulated by estrogen and selective estrogen receptor modulators [21]. Taken together, these findings suggested that endometrial stromal cells represent an important regulation target of ovarian hormones, and aberrant hormonal regulation may contribute to the development of endometrial malignancies. In this study, we used primary stromal cell culture as a study model to investigate the morphological as well as transcriptome changes induced by estrogen, progesterone, and tamoxifen. Changes of gene expression in response to these hormones were detected, validated, and compared. Numerous genes governing diversified cell functions were found to be targets for hormonal regulation. A large number of novel genes with unknown functions were also identified. These findings provided useful information for studying the pathophysiological functions of stromal cells in the normal endometrium and the development of uterine hyperplasia and neoplasia.

2. Results

2.1. Expression of Estrogen and Progesterone Receptors in Stromal Cell Cultures

Stromal cell populations represent a large majority of cells in human endometrium. The protocol for stromal cell isolation has long been established and successfully used by many laboratories. Consistent with previous reports, we observed that the isolated stromal cells displayed fibroblastic morphology and a high homogeneity, indicating a high purity of the population. To collect background information we measured ER and PR expression levels in stromal cultures. Real-time PCR results (Figure 1A) indicated that when compared to breast, ovary, and whole endometrium tissues, stromal cell cultures express relatively lower mRNA levels for ER-α, ER-β, total PR and PR-B. The ER and PR mRNA levels in stromal cells were comparable to those in MCF-7, but higher than malignant endometrial and breast cancer cell lines KLE, AN3, and MDA-MB-231 (Figure 1B). Results of Western blotting analyses confirmed the expression of ER and PR proteins in stromal cells. Relatively high levels of ER-α, ER-β, and low levels of PR-A and PR-B were detected in stromal cells. These results indicated that cultured stromal cells express measurable levels of ER and PR and can therefore be used as a model for studying hormonal regulation.
Figure 1

Expression of estrogen and progesterone receptors in human stromal cells. (A) Results of real-time PCR. ER-α, ER-β, total PR, and PR-A mRNA levels were measured in stromal cell primary culture, whole tissues from endometrium, breast, ovary, and cancer cells lines KLE, AN3, MCF-7, and MDA-MB-231. Average levels and standard errors were presented; (B) Western blotting analysis of ER and PR protein expression in stromal cell culture. Western blotting was performed with specific antibodies raised against ER-α, ER-β, and PR (detecting both A and B isoforms).

Expression of estrogen and progesterone receptors in human stromal cells. (A) Results of real-time PCR. ER-α, ER-β, total PR, and PR-A mRNA levels were measured in stromal cell primary culture, whole tissues from endometrium, breast, ovary, and cancer cells lines KLE, AN3, MCF-7, and MDA-MB-231. Average levels and standard errors were presented; (B) Western blotting analysis of ER and PR protein expression in stromal cell culture. Western blotting was performed with specific antibodies raised against ER-α, ER-β, and PR (detecting both A and B isoforms).

2.2. Morphological Changes Following Hormonal Treatment

We observed significant morphological changes in stromal cell cultures following the treatment with ovarian steroids. Estrogen-treated cells became more polymorphic than the control and progesterone treated cells (Figure 2). Clusters of cells with de-differentiated appearance, characterized by a smaller size and round shape, were observed following estrogen treatment. On the other hand, progesterone treated cells became larger with better differentiation. Tamoxifen treated cells became smaller and many cells exhibited a distinctive triangular shape. The divergent morphological changes suggest that these hormones may induce different gene expression patterns in endometrial stromal cells.
Figure 2

Morphological changes in stromal cells following hormonal treatment. Hormonal effects in low density (Panels (A–D)) and high density cultures (Panels (E–H)) were shown; The cells were treated for 48 h with alcohol as solvent control (A,E); 1 × 10−7 M of β-estradiol (B,F); 2 × 10−7 M of progesterone (C,G); or 2 × 10−7 M of tamoxifen (D,H). Estrogen treated cells became smaller and polymorphic compared to control and progesterone treated cells. Progesterone treated cells were characterized by their larger size and spindle-like shape with smooth edges. Tamoxifen treated cells (panels (D) and (H)) were relatively small, many in triangular shape. Scale bar = 25 μM.

Morphological changes in stromal cells following hormonal treatment. Hormonal effects in low density (Panels (A–D)) and high density cultures (Panels (E–H)) were shown; The cells were treated for 48 h with alcohol as solvent control (A,E); 1 × 10−7 M of β-estradiol (B,F); 2 × 10−7 M of progesterone (C,G); or 2 × 10−7 M of tamoxifen (D,H). Estrogen treated cells became smaller and polymorphic compared to control and progesterone treated cells. Progesterone treated cells were characterized by their larger size and spindle-like shape with smooth edges. Tamoxifen treated cells (panels (D) and (H)) were relatively small, many in triangular shape. Scale bar = 25 μM.

2.3. Estrogen and Progesterone Induce Different Gene Expression

Using microarray analysis, we compared the gene expression patterns of stromal cell cultures with or without hormonal treatment. Estrogen, progesterone, and tamoxifen up-regulated 788, 1368, and 1027 genes more than 2-fold, respectively. These genes were classified into six categories including structural, enzymes, transcription factors, signaling, cell cycle and apoptosis, and novel genes with unknown functions. Table 1 and Table 2 present a selected list of the genes significantly regulated by estrogen and progesterone (>3-fold), respectively. It is noteworthy that a literature search indicated that only a few of these genes are known for their responses to hormones. A majority of the genes were identified for the first time as hormonal regulation targets.
Table 1

Genes responding to estrogen treatment. Representative genes with significant alterations (>3-fold) were compiled into six categories. Gene designation, function, and fold-change are presented. Stromal cells were treated with 1 × 10−7 M of β-estradiol for 48 h. Note that decimals indicate down-regulation of gene expression.

Gene NameDescriptionE2/Ctl
Structural
CNTN4contactin 40.08
TRAR1trace amine receptor 10.10
COL14A1collagen, type XIV, α1 (undulin)0.14
SFXN5sideroflexin 50.15
PAPLNpapilin, proteoglycan-like sulfated glycoprotein0.17
CDRT1CMT1A duplicated region transcript 10.29
SHPRHSNF2 histone linker PHD RING helicase3.10
OR2W1olfactory receptor, family 2, subfamily W, member 13.49
CANPcancer-associated nucleoprotein3.66
COL9A1collagen, type IX, α16.06
HIST2H4histone 2, H46.28
SESN3sestrin 36.34
TUBB1tubulin, β19.88
CLECSF12C-type (calcium dependent, carbohydrate-recognition domain) lectin, superfamily member 1223.48
Enzymes
SMA4SMA40.16
TLL1tolloid-like 10.21
ANGangiogenin, ribonuclease, RNase A family, 50.22
B3GALT4UDP-Gal:β GlcNAc β 1,3-galactosyltransferase, polypeptide 40.24
PDE11Aphosphodiesterase 11A0.25
ABCG4ATP-binding cassette, sub-family G (WHITE), member 40.26
PFKFB26-phosphofructo-2-kinase/fructose-2,6-biphosphatase 20.26
CYP7B1cytochrome P450, family 7, subfamily B, polypeptide 10.29
ENPP1ectonucleotide pyrophosphatase/phosphodiesterase 13.21
TIGD6tigger transposable element derived 63.54
MMRN1multimerin 15.24
RTN4IP1reticulon 4 interacting protein 19.90
PTPRZ1protein tyrosine phosphatase, receptor-type, Z polypeptide 114.49
Transcription Factors
ZNF608zinc finger protein 6080.13
TSPAN-2tetraspan 20.21
ZNF75zinc finger protein 75 (D8C6)0.24
ZIC4Zic family member 40.27
ZNF423zinc finger protein 4230.31
POGZpogo transposable element with ZNF domain0.33
MXI1MAX interactor 10.33
CLDN23claudin 233.12
ZNF197zinc finger protein 1973.65
TTTY15testis-specific transcript, Y-linked 155.84
Signaling
IL12Binterleukin 12B (natural killer cell stimulatory factor 2, cytotoxic lymphocyte maturation factor 2, p40)0.07
STARSstriated muscle activator of Rho-dependent signaling0.13
CFC1cripto, FRL-1, cryptic family 10.16
GPR133G protein-coupled receptor 1330.28
OLFML2Aolfactomedin-like 2A0.30
PTTG2pituitary tumor-transforming 23.04
EDG7endothelial differentiation, lysophosphatidic acid G-protein-coupled receptor, 73.06
BAGEB melanoma antigen3.08
MKLN1muskelin 1, intracellular mediator containing kelch motifs3.24
Cell cycle and Apoptosis
ID1inhibitor of DNA binding 1, dominant negative helix-loop-helix protein3.82
CHAF1Bchromatin assembly factor 1, subunit B (p60)4.09
IL8interleukin 85.18
ID3inhibitor of DNA binding 3, dominant negative helix-loop-helix protein6.51
Novel Genes
FLJ31842hypothetical protein FLJ318420.06
FLJ13544hypothetical protein FLJ135440.18
LOC338773hypothetical protein LOC3387730.24
LOC200169hypothetical protein LOC2001697.28
MGC39830hypothetical protein MGC398308.20
Table 2

Genes responding to progesterone treatment. Representative genes with significant alterations (>3-fold) from different categories were compiled. Gene designation, function, and fold-change are presented. Stromal cells were treated with 2 × 10−7 M of progesterone for 48 h.

Gene NameDescriptionProg/Ctl
Structural
LMNB1lamin B10.18
JUPjunction plakoglobin0.18
SYNPOsynaptopodin0.20
ACTG2actin, γ2, smooth muscle, enteric0.23
ARHGDIBRho GDP dissociation inhibitor (GDI) β0.27
COL11A1collagen, type XI, α10.28
ANLNanillin, actin binding protein (scraps homolog, Drosophila)0.32
ITGA2integrin, α2 (CD49B, α2 subunit of VLA-2 receptor)3.19
STCHstress 70 protein chaperone, microsome-associated, 60 kDa3.42
ADFPadipose differentiation-related protein3.71
TUBE1tubulin, epsilon 14.44
NPC1Niemann-Pick disease, type C15.63
Enzymes
SMA4SMA40.06
CYP1B1cytochrome P450, family 1, subfamily B, polypeptide 10.13
MESTmesoderm specific transcript homolog (mouse)0.13
PLK4polo-like kinase 4 (Drosophila)0.22
BRIP1BRCA1 interacting protein C-terminal helicase 10.24
RNASELribonuclease L (2',5'-oligoisoadenylate synthetase-dependent)0.31
ASNSasparagine synthetase3.01
NNMTnicotinamide N-methyltransferase3.43
HS3ST3A1heparan sulfate (glucosamine) 3-O-sulfotransferase 3A13.72
LIASlipoic acid synthetase7.07
PRKYprotein kinase, Y-linked9.49
JAK2Janus kinase 2 (a protein tyrosine kinase)10.82
Transcription Factors
SOX4SRY (sex determining region Y)-box 40.15
ZNF323zinc finger protein 3230.17
FOXL2forkhead box L20.33
TBX2T-box 23.01
E2F7E2F transcription factor 73.04
DDIT4DNA-damage-inducible transcript 43.31
TGIFTGFB-induced factor (TALE family homeobox)3.44
FOXD1forkhead box D13.78
ZNF197zinc finger protein 1973.84
DSCR1Down syndrome critical region gene 13.88
ID3inhibitor of DNA binding 3, dominant negative helix-loop-helix protein5.25
DDIT3DNA-damage-inducible transcript 38.18
TCF21transcription factor 2113.97
Signaling
TACSTD1tumor-associated calcium signal transducer 10.21
PIR51RAD51 associated protein 10.26
FGF9fibroblast growth factor 9 (glia-activating factor)0.29
RHOBras homolog gene family, member B0.31
IL6interleukin 6 (interferon, β2)3.28
VEGFvascular endothelial growth factor3.39
HSPBAP1HSPB (heat shock 27 kDa) associated protein 13.47
AREGamphiregulin (schwannoma-derived growth factor)3.67
GDF15growth differentiation factor 154.49
GADD45Agrowth arrest and DNA-damage-inducible, α5.02
RIS1Ras-induced senescence 16.32
Cell cycle and Apoptosis
CDC25Acell division cycle 25A0.13
SKP2S-phase kinase-associated protein 2 (p45)0.24
CCNE2cyclin E20.29
CDKN2Bcyclin-dependent kinase inhibitor 2B (p15, inhibits CDK4)3.12
SH3MD2SH3 multiple domains 23.29
BTG1B-cell translocation gene 1, anti-proliferative3.50
Novel Genes
FLJ11795hypothetical protein FLJ117950.04
LOC283112hypothetical protein LOC2831120.05
LOC145741hypothetical LOC1457417.70
FLJ11011hypothetical protein FLJ110117.95
MGC39830hypothetical protein MGC398308.94
Genes responding to estrogen treatment. Representative genes with significant alterations (>3-fold) were compiled into six categories. Gene designation, function, and fold-change are presented. Stromal cells were treated with 1 × 10−7 M of β-estradiol for 48 h. Note that decimals indicate down-regulation of gene expression. Genes responding to progesterone treatment. Representative genes with significant alterations (>3-fold) from different categories were compiled. Gene designation, function, and fold-change are presented. Stromal cells were treated with 2 × 10−7 M of progesterone for 48 h. Further data analysis focused on comparing the expression patterns induced by different hormones. Estrogen and progesterone treatment caused dramatic, but different alterations in gene expression. Among the 2156 genes with more than 2-fold expression alterations, 325 of them (15.1%) were regulated by both hormones; furthermore, one third (109, 33.5%) of the genes from this group were regulated differentially by the two hormones, with regulation by one hormone for more than 2-fold, but not by another. Table 3 lists some of the genes whose mRNA levels were differentially affected by estrogen and progesterone. Interestingly, 16 genes were found to be regulated in opposite directions by β-estradiol and progesterone, that is, up-regulated by one hormone for more than 2-fold, and down-regulated by another for more than 2-fold. As discussed later, these genes may be part of the regulatory network responsible for the opposing effects of estrogen and progesterone in the uterus.
Table 3

Genes differentially regulated by estrogen and progesterone. Genes regulated in opposite directions by the two hormones (more than 2-fold) were marked with asterisks. The rest of the genes were significantly regulated by one, but not another hormone. The cells were treated for 48 h with either 1 × 10−7 M of β-estradiol or 2 × 10−7 M of progesterone.

Gene NameDescriptionE2/CtlProg/Ctl
Structural
COL4A3BPcollagen, type IV, α3 (Goodpasture antigen) binding protein0.622.05
MYLIPmyosin regulatory light chain interacting protein0.632.56
LAMA1laminin, α10.692.17
TUBE1tubulin, epsilon 10.714.44
HIST1H2AChistone 1, H2ac0.842.71
CHS1Chediak-Higashi syndrome 11.092.14
H2AFXH2A histone family, member X1.690.47
KIF20Akinesin family member 20A2.230.44
TMPOthymopoietin2.240.61
OIP5Opa-interacting protein 52.260.52
HCAP-Gchromosome condensation protein G2.410.65
NEK2NIMA (never in mitosis gene a)-related kinase 22.450.58
MAD2L1 *MAD2 mitotic arrest deficient-like 1 (yeast)2.560.47
Enzymes
SCDstearoyl-CoA desaturase (δ-9-desaturase)0.431.96
HMGCR3-hydroxy-3-methylglutaryl-Coenzyme A reductase0.441.97
ASNSasparagine synthetase0.663.01
EIF2AK3eukaryotic translation initiation factor 2-α kinase 30.812.58
PRIM2Aprimase, polypeptide 2A, 58 kDa1.540.47
FEN1flap structure-specific endonuclease 11.930.44
POLA2polymerase (DNA-directed), α (70 kD)2.170.84
TOP2A *topoisomerase (DNA) II α 170 kDa2.260.41
DNA2L *DNA2 DNA replication helicase 2-like (yeast)2.430.37
POLE2 *polymerase (DNA directed), epsilon 2 (p59 subunit)2.520.48
PLK4 *polo-like kinase 4 (Drosophila)2.560.22
TOPKT-LAK cell-originated protein kinase2.770.51
Transcription Factors
DDIT4 *DNA-damage-inducible transcript 40.353.31
DDIT4LDNA-damage-inducible transcript 4-like0.692.01
ATF4activating transcription factor 4 (tax-responsive enhancer element B67)0.692.26
DSCR3Down syndrome critical region gene 30.822.10
ATF3activating transcription factor 30.853.65
MAFFv-maf musculoaponeurotic fibrosarcoma oncogene homolog F (avian)0.872.45
NFIL3nuclear factor, interleukin 3 regulated0.883.74
TGIFTGFB-induced factor (TALE family homeobox)0.903.44
OLIG1oligodendrocyte transcription factor 12.160.85
TCF19transcription factor 19 (SC1)2.430.83
PTTG1pituitary tumor-transforming 12.480.67
FOXM1forkhead box M12.530.82
MYBL1v-myb myeloblastosis viral oncogene homolog (avian)-like 12.600.66
Signaling
STARS *striated muscle activator of Rho-dependent signaling0.132.25
RAB33A *RAB33A, member RAS oncogene family0.423.00
NGFBnerve growth factor, β polypeptide0.582.69
GDF15growth differentiation factor 150.674.49
MAP4K3mitogen-activated protein kinase kinase kinase kinase 30.752.04
VEGFvascular endothelial growth factor0.853.39
MTSS1metastasis suppressor 10.903.72
GADD45Agrowth arrest and DNA-damage-inducible, α0.925.02
DNAJB9DnaJ (Hsp40) homolog, subfamily B, member 90.956.25
SHCBP1SHC SH2-domain binding protein 12.050.41
MYCBPc-myc binding protein2.060.73
ECT2epithelial cell transforming sequence 2 oncogene2.350.65
PIR51RAD51 associated protein 12.450.26
Cell cycle and Apoptosis
KLF4Kruppel-like factor 4 (gut)0.512.93
CDKN2Bcyclin-dependent kinase inhibitor 2B (p15, inhibits CDK4)0.522.92
CCNE2 *cyclin E22.000.29
FANCGFanconi anemia, complementation group G2.140.70
CDC2cell division cycle 2, G1 to S and G2 to M2.150.53
CDCA2 *cell division cycle associated 22.170.48
MTB *more than blood homolog2.230.49
CCNA2cyclin A22.310.53
CCNB1 *cyclin B12.320.48
CDCA3 *cell division cycle associated 32.340.45
CDKN3cyclin-dependent kinase inhibitor 3 (CDK2-associated dual specificity phosphatase)2.400.69
CCNB2cyclin B22.450.55
CDC20CDC20 cell division cycle 20 homolog (S. cerevisiae)3.290.58
Novel Genes
FLJ20366 *hypothetical protein FLJ203660.382.73
LOC153346 *hypothetical protein LOC1533460.462.71
FLJ20105 *hypothetical protein FLJ201052.770.33
FLJ10719hypothetical protein FLJ107193.220.52
FLJ13273hypothetical protein FLJ132734.820.67
In contrast to the divergent effects of estrogen and progesterone, the expression pattern induced by estrogen and tamoxifen appeared to be more similar. 23.4% (425 out of 1815) of genes were common targets for both hormones. Further analysis indicated that more than half (214 out of the 425) of these common genes were regulated in the same direction by estrogen and tamoxifen for more than 2-fold. Representative genes are listed in Table 4. Despite their similarity, the expression patterns induced by tamoxifen and estrogen were not identical. Table 5 listed representative genes with differential responses to the two hormones. Thus, tamoxifen displays similar, but distinct effects on stromal cells compared to estrogen.
Table 4

Genes responded in a similar way to estrogen and tamoxifen treatment. Information on representative genes that were up- or down-regulated by both estrogen and tamoxifen were listed. The cells were either treated for 48 h with 1 × 10−7 M of β-estradiol or 2 × 10−7 M of tamoxifen.

Gene NameDescriptionE2/CtlTam/Ctl
Structural
CRABP2cellular retinoic acid binding protein 20.330.49
KCTD7potassium channel tetramerisation domain containing 70.380.39
FLRT2fibronectin leucine rich transmembrane protein 20.390.47
DAAM2dishevelled associated activator of morphogenesis 20.460.48
CHAF1Achromatin assembly factor 1, subunit A (p150)2.002.44
CNAP1chromosome condensation-related SMC-associated protein 12.012.45
KNTC2kinetochore associated 22.022.92
ITGA2integrin, α2 (CD49B, α2 subunit of VLA-2 receptor)2.162.86
OIP5Opa-interacting protein 52.262.47
RAMPRA-regulated nuclear matrix-associated protein2.403.09
HCAP-Gchromosome condensation protein G2.412.96
NEK2NIMA (never in mitosis gene a)-related kinase 22.452.46
MAD2L1MAD2 mitotic arrest deficient-like 1 (yeast)2.562.22
PODXLpodocalyxin-like2.693.95
Enzymes
SMA4SMA40.160.42
MMP11matrix metalloproteinase 11 (stromelysin 3)0.480.41
RRM2ribonucleotide reductase M2 polypeptide2.092.35
RNASEH2Aribonuclease H2, large subunit2.122.60
POLA2polymerase (DNA-directed), α (70 kD)2.173.08
TOP2Atopoisomerase (DNA) II α 170 kDa2.312.60
POLE2polymerase (DNA directed), epsilon 2 (p59 subunit)2.523.01
CDKN3cyclin-dependent kinase inhibitor 3 (CDK2-associated dual specificity phosphatase)2.622.64
HAS2hyaluronan synthase 22.724.27
MMP1matrix metalloproteinase 1 (interstitial collagenase)2.738.91
PLK1polo-like kinase 1 (Drosophila)2.753.86
BUB1BUB1 budding uninhibited by benzimidazoles 1 homolog (yeast)2.812.48
Transcription Factors
POGZpogo transposable element with ZNF domain0.330.39
KLF4Kruppel-like factor 4 (gut)0.420.48
PBXIP1pre-B-cell leukemia transcription factor interacting protein 10.440.49
RFC4replication factor C (activator 1) 4, 37 kDa2.032.69
TCF19transcription factor 19 (SC1)2.432.16
PTTG1pituitary tumor-transforming 12.482.95
FOXM1forkhead box M12.533.39
MYBL1v-myb myeloblastosis viral oncogene homolog (avian)-like 12.602.60
ID1inhibitor of DNA binding 1, dominant negative helix-loop-helix protein3.824.37
Signaling
DDIT4DNA-damage-inducible transcript 40.350.26
RASSF2Ras association (RalGDS/AF-6) domain family 20.440.38
RASGRP1RAS guanyl releasing protein 1 (calcium and DAG-regulated)0.500.37
FBXO5F-box protein 52.202.16
RANBP1RAN binding protein 12.212.11
ECT2epithelial cell transforming sequence 2 oncogene2.352.09
PIR51RAD51 associated protein 12.452.34
RGS4regulator of G-protein signalling 42.943.81
IL8interleukin 85.182.00
Cell cycle and Apoptosis
TRIB3tribbles homolog 3 (Drosophila)0.470.35
GTSE1G-2 and S-phase expressed 12.072.42
FANCGFanconi anemia, complementation group G2.142.23
CDC2cell division cycle 2, G1 to S and G2 to M2.202.12
MTBmore than blood homolog2.232.20
CCNA2cyclin A22.312.70
CCNB1cyclin B12.322.71
CCNB2cyclin B22.452.83
CDCA1cell division cycle associated 12.613.56
FANCEFanconi anemia, complementation group E2.952.62
Novel Genes
LOC338773hypothetical protein LOC3387730.240.43
KIAA1164hypothetical protein KIAA11640.310.34
DKFZP434L142hypothetical protein DKFZp434L1420.390.34
FLJ10719hypothetical protein FLJ107193.224.02
FLJ13273hypothetical protein FLJ132734.823.96
Table 5

Genes differentially regulated by estrogen and tamoxifen. Representative genes that were differentially regulated by estrogen and tamoxifen were listed. The cells were treated for 48 h with 1 × 10−7 M of β-estradiol or 2 × 10−7 M of tamoxifen.

Gene NameDescriptionE2/CtlTam/Ctl
Structural
ARRDC2arrestin domain containing 20.582.34
SLC16A6solute carrier family 16 (monocarboxylic acid transporters), member 60.772.33
SYCP2synaptonemal complex protein 22.480.84
Enzymes
PIN1protein (peptidyl-prolyl cis/trans isomerase) NIMA-interacting 10.722.21
Transcription Factors
OLIG1oligodendrocyte transcription factor 12.160.86
Signaling
NOVnephroblastoma overexpressed gene0.832.00
Novel Genes
FLJ38993hypothetical protein FLJ389930.772.01
Genes differentially regulated by estrogen and progesterone. Genes regulated in opposite directions by the two hormones (more than 2-fold) were marked with asterisks. The rest of the genes were significantly regulated by one, but not another hormone. The cells were treated for 48 h with either 1 × 10−7 M of β-estradiol or 2 × 10−7 M of progesterone. Genes responded in a similar way to estrogen and tamoxifen treatment. Information on representative genes that were up- or down-regulated by both estrogen and tamoxifen were listed. The cells were either treated for 48 h with 1 × 10−7 M of β-estradiol or 2 × 10−7 M of tamoxifen. Genes differentially regulated by estrogen and tamoxifen. Representative genes that were differentially regulated by estrogen and tamoxifen were listed. The cells were treated for 48 h with 1 × 10−7 M of β-estradiol or 2 × 10−7 M of tamoxifen.

2.4. Validation of Microarray Results

To verify the reliability of the microarray results, 19 sample genes were selected for real-time PCR analysis. These genes were chosen by their novelty and significant responses to different hormones. We replicated the same experimental conditions as those applied for microarray analysis, and measured mRNA levels of these genes. Each real-time PCR result was standardized by the correspondent GAPDH mRNA level (Figure 3B) and compared to the microarray results (Figure 3A). High PCR specificity was confirmed by agarose gel electrophoresis of the amplification products from the 40th cycle of real-time PCR (Figure 3C). The real-time PCR and microarray results were consistent in most of the genes tested, providing strong support for the overall reliability of the microarray data.
Figure 3

Validation of microarray results. 19 genes were chosen as example genes for confirmation by real-time PCR. For each gene, relative mRNA levels in control, estrogen, progesterone and tamoxifen groups measured by microarray (A) and real-time PCR (B) were shown. The real-time PCR results represented average values from four parallel reactions; (C) Agarose gel electrophoresis of the end products (40 cycles) from real-time PCR. The single band patterns with predicted sizes indicated the high specificity of PCR.

Validation of microarray results. 19 genes were chosen as example genes for confirmation by real-time PCR. For each gene, relative mRNA levels in control, estrogen, progesterone and tamoxifen groups measured by microarray (A) and real-time PCR (B) were shown. The real-time PCR results represented average values from four parallel reactions; (C) Agarose gel electrophoresis of the end products (40 cycles) from real-time PCR. The single band patterns with predicted sizes indicated the high specificity of PCR.

3. Discussion

The expression of estrogen and progesterone receptors in human endometrial stromal cells has been reported by several groups [22,23,24,25]. These previous observations, however, were mostly based on immunohistochemistry studies [24,25], and the receptors’ expression levels relative to other tissues were not compared. In this study, we performed real-time PCR and Western blotting analysis to compare mRNA and protein levels between endometrial stromal cells and several reproductive tissues. In general, stromal cells appeared to express substantial amounts of estrogen and progesterone receptors, a result consistent with most previous reports [22]. In accordance with their estrogen and progesterone receptor expression status, primary stromal cultures underwent significant morphological changes following treatment by steroid hormones. The counteraction of estrogen and progesterone appeared to be reminiscent of their opposing functions observed during the menstrual cycle where estrogen is responsible for cell proliferation [26,27] and progesterone for cell differentiation [28,29,30]. Accompanying the morphological changes were dramatic and divergent alterations in mRNA expression by the two hormones. The opposite effects of estrogen and progesterone are best illustrated by the results from a number of cyclins. As shown in Table 4 under cell cycle and apoptosis genes, cyclin A2, B1 and B2 were all up-regulated by estrogen for more than 2-fold, but down-regulated by progesterone. These mitogens are known to promote cell proliferation and stimulate malignant transformation. Cyclin A2 activation is considered a prerequisite for G1/S and G2/M transition [31]. Elevated expression of cyclin A2 and their catalytic partners CDK1 and CDK2 have been detected in male germ cell tumors, and their levels are quantitatively associated with tumor invasiveness [32]. Over-expression of a non-degradable form of cyclin A2 (δ 152) affected the cell cycle and promoted aneuploidy as well as transformation of rat fibroblasts [33]. On the other hand, decreased levels of cyclin A2 and B1 were associated with P53-dependent G2 arrest in human squamous carcinoma cells [34]. Therefore, estrogen-induced up-regulation of cyclins may be partially responsible for the carcinogenic effects observed on human endometrium and stroma. Their down-regulation by progesterone may contribute to this hormone’s cytostatic effect in the uterine cells. Since both stromal sarcomas and endometrial cancers respond to progestational treatment [35,36,37], further exploration on the regulation and function of these genes may potentially lead to the improvement of hormonal prevention and/or treatment of uterine malignancies. DNA synthesis represents a critical step in cell proliferation. A series of enzymes required for DNA replication such as DNA helicase, topoisomerase, and polymerase, were significantly affected by estrogen and progesterone. The DNA helicase complex functions as a replication licensing system that ensures precise chromosomal DNA replication before cell division [38]. DNA topoisomerase II is required for chromosome segregation following DNA replication [39]. DNA polymerase α and epsilon are the two major eukaryotic processing polymerases that are recruited to replication origins during the late G1 phase [40]. Drug inhibition of DNA polymerase α and epsilon led to suppression of cancer cell growth [41]. Lee et al. reported that a human trophoblast cell line transfected with SV40 T antigen displayed increased proliferation and invasiveness, but was unable to form colonies on soft agar or tumors in nude mice. Interestingly, in these premalignant cells, DNA polymerase epsilon was identified as one of the genes up-regulated compared to the untransfected control. In this study, DNA helicase-2, DNA polymerase α and epsilon, and DNA topoisomerase II were all up-regulated by estrogen, but down-regulated by progesterone (Table 3, Enzymes), suggesting that these enzymes may play important role(s) in the estrogen-dependent neoplastic diseases of the uterus [42]. The estrogenic and carcinogenic effects of tamoxifen in stromal and endometrial cells have been well documented [15,27]. Since tamoxifen has been used to prevent breast cancer recurrence in high-risk women, investigating its effects on stromal cells bears strong clinical significance. Characterization of gene expression signatures represents the first step to better understand tamoxifen-mediated tumorigenic effects in the endometrium. Our data indicate that gene expression patterns induced by tamoxifen share some similarity with those of estrogen. In fact, all the genes discussed above, including those of cyclin A2, B1 and B2, DNA polymerase α and epsilon, and DNA topoisomerase II were found to be up-regulated by both estrogen and tamoxifen (Table 4, enzymes, cell cycle and apoptosis genes). It was reported that the subtle structural differences of estrogen and tamoxifen cause distinct conformational changes in the ER upon binding by these hormones [43,44], leading to the recruitment of alternative co-activators into the transcription initiation complex [45,46]. The few genes differentially regulated by estrogen and tamoxifen may provide an ideal model to study the distinct transactivation mechanisms by estrogen and tamoxifen. Estrogen and progesterone concentrations undergo dynamic changes under different physio-pathological conditions. In addition, stromal cells were exposed simultaneously to both estrogen and progesterone, the combined effects by the two hormones added another dimension to the complexity of hormonal regulation. In this study, one hormone a time at a single concentration was examined for each hormone. In addition, stromal-epithelial interactions were not considered when purified stromal cells were used. Results from experiments applying these much-simplified conditions could not accurately reflect the in vivo situation. Thus, the observations needs to be further verified under physiological conditions. Nevertheless, the microarray analysis led to the identification of numerous candidate target genes, which provided useful information for future mechanistic and functional studies concerning the hormonal regulation in the endometrial stromal cell population.

4. Material and Methods

4.1. Tissue, Cell Lines, and Reagents

Normal breast, ovarian and endometrium tissues were collected from patients with benign conditions. Endometrial stromal cells were isolated by collagenase/DNase I digestion following established protocols [47,48]. Endometrial adenocarcinoma cell lines KLE and AN3, and breast cancer cell lines MCF-7 and MDA-MB-231 were obtained from American Type Culture Collection (Rockville, MD, USA). Stromal KLE and cells were grown in F12 medium. AN3, MCF-7, and MDA-MB-231 cells were maintained in MEM medium. All the media were supplemented with 10% FCS (BioWhittaker, Walkersville, MD, USA), 100 µg/mL streptomycin, 100 units/mL penicillin, and 2 mM glutamine. Cell cultures were maintained at 37 °C in an atmosphere containing 5% CO2 and 100% humidity. β-estradiol, progesterone, tamoxifen, and monoclonal antibody for ER-β (SAB4500814) and goat anti-rabbit secondary antibody (A4062) were purchased from Sigma (St. Louis, MO, USA). Antibodies against ER-α (MC-20), PR-A or PR-B (C-20) were products of Santa Cruz Biotechnology (Santa Cruz, CA, USA). Rabbit anti-β-actin antibody (TA306308) was purchased from Oncogene (Boston, MA, USA).

4.2. Cell Treatment, RNA Isolation, and Quantitative Real-Time PCR

Stromal cell cultures were grown in 10 cm diameter dishes. Cells were de-induced in medium containing 10% charcoal-stripped serum for two days before treated with 1 × 10−7 M of β-estradiol, 2 × 10−7 M of tamoxifen, or 2 × 10−7 M of progesterone for 48 h. Total RNA was isolated using Trizol reagents (Invitrogen, Carlsbad, CA, USA). The RNA samples were treated with DNA Free™ (Ambion, Austib, TX, USA) to eliminate contaminated genomic DNA. cDNA was synthesized from 1 µg of RNA with random primers using SuperScript kit (Invitrogen, Carlsbad, CA, USA). The 20 µL of reverse transcription products were diluted to 100 and 2 µL was used for each real-time PCR. PCR reactions were carried out in 25 µL containing 140 ng of primers and 12.5 µL SYBR Green Master Mix (Stratagene, Cedar Creek, TX, USA). The designations and sequences of PCR primers are described in Table 6. Real-time PCR was performed under the following conditions: initial denature, 95 °C for 10 min, followed by 40 cycles of denaturation at 95 °C for 30 s, annealing at 56 °C for 40 s, and extension at 72 °C for 30 s. The threshold cycle number (Ct) values were standardized against GAPDH controls, converted to fold (2t) relative to GAPDH, and compared between experimental and control groups. All data groups were analyzed by ANOVA to determine if there was significance (p < 0.05) among the groups. For all experimental groups that satisfied the initial ANOVA criterion, individual comparisons were performed with the use of post hoc Bonferroni t tests based on assumptions of two-tailed distribution and two samples with equal variance. Statistical significance (p ≤ 0.05) is indicated by asterisks in the figures.
Table 6

Primers and sizes of amplicons in real-time PCR.

Gene NameDescription5' Primer3' PrimerSize (bp)
ER-αEstrogen receptor αaattcagataatcgacgccaggtgtttcaacattctccctcctc344
ER-βEstrogen receptor βtgcggaacctcaaaagagtccttcacacgaccagactcca206
PR-ABProgesterone receptor A and Batgagccggtccgggtgcaaggccacccagagcccgaggttt243
PR-BProgesterone receptor Bgactgagagcttcacagtattctcctaactcggggagttct187
ATAD2ATPase family, AAA domain containing 2gattatcttccgcaggaccagttgcattggatcaacatcg255
C10ORF48chromosome 10 open reading frame 48gggtcaatagtgcagccagttgcgcttactgttactgcaaa247
C18ORF25chromosome 18 open reading frame 25gtaggggccagactgaatgaagtgtccccagctttttcaa250
C6ORF32chromosome 6 open reading frame 32aggagaaaatgccactgtcgtcctctgggtcttcctcctt250
CAMK-acalcium/calmodulin-dependent protein kinase IIacgagaagctgagcccctacttgggggagttagacaccag221
CDKN2Bcyclin-dependent kinase inhibitor 2B (p15, inhibits CDK4)tcgtttgcttttcagggtttcctcctccactttgtcctca248
CKS2CDC28 protein kinase regulatory subunit 2ggagtggaggagacttggtgcagctcatgcacaggtatgg236
DK434CDKFZP434C245 proteintaagctgtgggacaagagcattgagtcactggaggctgtg248
FOXM1forkhead box M1cgtggattgaggaccactttgattcggtcgtttctgctgt249
HAS2hyaluronan synthase 2agagcactgggacgaagtgtatgcactgaacacacccaaa245
HNLFputative NFkB activating protein HNLFagaagcgctgtttcatcgaggccatcctggtagaattgga253
ID1inhibitor of DNA binding 1, dominant negative helix-loop-helix proteincccattctgtttcagccagtagccgttcatgtcgtagagc245
KIAA0924KIAA0924 proteinatcgctcattttgaggttgcgcagaggacagggcagtaaa246
MTBmore than blood homologtgcgggaggttctgagttacggaccatcgggtaaggatct261
MYBL1v-myb myeloblastosis viral oncogene homolog (avian)-like 1gtccgaaacgttggtctgttgaccttccgacgcattgtag248
PIN1protein (peptidyl-prolyl cis/trans isomerase) NIMA-interacting 1tgccaccgtcacacagtattgagtctgcctccagcacct253
PIR51RAD51 associated protein 1ttctggaaggcagtgatggtgagcagagtccaccgaagtc243
PLK4polo-like kinase 4 (Drosophila)gccaaggaccttattcaccattatttgggagtggctgacc251
RASEFRAS and EF hand domain containingatcaaccttgtggagccaagctgaggtcactgagggcttc245
Primers and sizes of amplicons in real-time PCR.

4.3. Western Blot Analysis

Cell extracts (20 µg) were resolved in SDS polyacrylamide gels (Ready Gel, 4%–15% gradient, Bio-Rad Laboratories, Hercules, CA, USA) and electrically transferred onto an Immun-Blot polyvinylidene difluoride membrane (Bio-Rad Laboratories, Hercules, CA, USA). The membranes were blocked for 2 h in PBS buffer containing 0.1% Tween-20 and 10% nonfat dried milk. Specific antibodies against ER-α, ER-β, PR-A and PR-B, or β-actin were applied following the manufacturer’s recommendations. Primary antibody binding was performed at 4 °C overnight with constant rotation. The secondary antibody binding was carried out at room temperature for 1 h at 1:5000 dilutions. Immunobloting signals were detected using the Chemiluminescence Plus Western Blotting Detection System (Amersham Corp., Arlington Heights, IL, USA). The blots were re-probed with β-actin antibody and the results provided controls for protein loading.

4.4. Microarray Hybridization

Affymetrix GeneChip™ Human Genome U133 Plus 2.0 microarrays were used for mRNA profiling. Microarray analysis was performed at Mayo Microarray Core facilities by technologists following standard procedures. Briefly, RNA samples were subject to Agilent analysis for quality controls. cDNA was prepared from 10 μg of RNA, quantified by spectrometry, and used as a template for the synthesis of biotinylated cRNA using RNA transcript labeling reagent (Affymetrix, Santa Clara, CA, USA). The quality of the cRNA probes was verified by gel electrophoresis and pilot hybridization with the Test-3 array. Hybridization solution containing fragmented cRNA probes and control cRNA (BioB, BioC, and BioD) was supplemented with herring sperm DNA and bovine serum albumin. The probe solution was heated at 99 °C for 5 min followed by incubation at 45 °C for 5 min before use. Hybridization was carried out at 45 °C for 16 h with constant rotation at 60 rpm. The arrays were washed and stained with streptavidin-phycoerythrin (Molecular Probes, Eugene, OR, USA). After washes, arrays were scanned using the GeneChip system confocal scanner (Hewlett Packard, Palo Alto, CA, USA).

4.5. Microarray Data Analysis

Gene expression profiles were analyzed at the Mayo General Clinical Research Center Genomics, Proteomics, and Metabolic Core Facility using established protocols [49,50]. The GeneChip 5.0 (Affymetrix) program was used to scan and quantitatively document the hybridization signals. Compilation of candidate genes and calculation of changes were performed on SpotFire and Microsoft Excel programs. To minimize the false-positive conclusion, only genes with hybridization signal reached an absolute level that was significantly higher than that of the background (p < 0.05) entered analyses. Ingenuity Pathway Analysis (Ingenuity Systems), and the Entrez Search Engine website, from the NCBI (http://www.ncbi.nlm.nih.gov/) were applied to selected genes for analysis on their biological interactions.
  50 in total

1.  Gene expression profile in skeletal muscle of type 2 diabetes and the effect of insulin treatment.

Authors:  Raghavakaimal Sreekumar; Panagiotis Halvatsiotis; Jill Coenen Schimke; K Sreekumaran Nair
Journal:  Diabetes       Date:  2002-06       Impact factor: 9.461

2.  Differential gene expression in premalignant human trophoblast: role of IGFBP-5.

Authors:  B P Lee; W J Rushlow; C Chakraborty; P K Lala
Journal:  Int J Cancer       Date:  2001-12-01       Impact factor: 7.396

Review 3.  Malignant biphasic uterine tumours: carcinosarcomas or metaplastic carcinomas?

Authors:  W G McCluggage
Journal:  J Clin Pathol       Date:  2002-05       Impact factor: 3.411

4.  Effect of normal endometrial stroma on growth and differentiation in Ishikawa endometrial adenocarcinoma cells.

Authors:  Julia T Arnold; Bruce A Lessey; Markku Seppälä; David G Kaufman
Journal:  Cancer Res       Date:  2002-01-01       Impact factor: 12.701

5.  Localization of matrix metalloproteinases on endometrial cancer cell invasion in vitro.

Authors:  D W Park; H S Ryu; D S Choi; Y H Park; K H Chang; C K Min
Journal:  Gynecol Oncol       Date:  2001-09       Impact factor: 5.482

6.  Impact of high-fat diet and antioxidant supplement on mitochondrial functions and gene transcripts in rat muscle.

Authors:  R Sreekumar; J Unnikrishnan; A Fu; J Nygren; K R Short; J Schimke; R Barazzoni; K Sreekumaran Nair
Journal:  Am J Physiol Endocrinol Metab       Date:  2002-05       Impact factor: 4.310

Review 7.  Adjuvant chemotherapy in early stage uterine sarcomas: an open question.

Authors:  A Gadducci; A Romanini
Journal:  Eur J Gynaecol Oncol       Date:  2001       Impact factor: 0.196

8.  Centrosome overduplication, increased ploidy and transformation in cells expressing endoplasmic reticulum-associated cyclin A2.

Authors:  Jamila Faivre; Marie Frank-Vaillant; Robert Poulhe; Hélène Mouly; Catherine Jessus; Christian Bréchot; Joëlle Sobczak-Thépot
Journal:  Oncogene       Date:  2002-02-28       Impact factor: 9.867

Review 9.  Steroid receptors in prostate cancer tissues and cells: pathophysiology, problems in methodology, clinical value and controversial questions.

Authors:  M Pavone-Macaluso; G Carruba; L Castagnetta
Journal:  Arch Esp Urol       Date:  1994-03       Impact factor: 0.436

10.  p53-dependent G2 arrest associated with a decrease in cyclins A2 and B1 levels in a human carcinoma cell line.

Authors:  C Badie; J Bourhis; J Sobczak-Thépot; H Haddada; M Chiron; M Janicot; F Janot; T Tursz; G Vassal
Journal:  Br J Cancer       Date:  2000-02       Impact factor: 7.640

View more
  7 in total

1.  Transcriptomic profile of VEGF-regulated genes in human cervical epithelia.

Authors:  MacKinsey Johnson; Chishimba Nathan Mowa
Journal:  Cell Tissue Res       Date:  2021-01-29       Impact factor: 5.249

2.  A childhood acute lymphoblastic leukemia genome-wide association study identifies novel sex-specific risk variants.

Authors:  Sandeep K Singh; Philip J Lupo; Michael E Scheurer; Anshul Saxena; Amy E Kennedy; Boubakari Ibrahimou; Manuel Alejandro Barbieri; Ken I Mills; Jacob L McCauley; Mehmet Fatih Okcu; Mehmet Tevfik Dorak
Journal:  Medicine (Baltimore)       Date:  2016-11       Impact factor: 1.889

3.  MiR-449a regulates caprine endometrial stromal cell apoptosis and endometrial receptivity.

Authors:  Xiaopeng An; Xiaorui Liu; Lei Zhang; Junze Liu; Xinyan Zhao; Kaiwen Chen; Haidong Ma; Guang Li; Binyun Cao; Yuxuan Song
Journal:  Sci Rep       Date:  2017-09-25       Impact factor: 4.379

4.  Association of body mass index with ER, PR and 14-3-3σ expression in tumor and stroma of type I and type II endometrial carcinoma.

Authors:  Joseph F Peevey; Brandon-Luke L Seagle; Kruti P Maniar; J Julie Kim
Journal:  Oncotarget       Date:  2017-06-27

Review 5.  Multimerin-1 and cancer: a review.

Authors:  Mareike G Posner
Journal:  Biosci Rep       Date:  2022-02-25       Impact factor: 3.840

6.  Induction of the Estrogenic Marker Calbindn-D₉k by Octamethylcyclotetrasiloxane.

Authors:  Dongoh Lee; Changhwan Ahn; Beum-Soo An; Eui-Bae Jeung
Journal:  Int J Environ Res Public Health       Date:  2015-11-17       Impact factor: 3.390

7.  Angiogenesis and evading immune destruction are the main related transcriptomic characteristics to the invasive process of oral tongue cancer.

Authors:  Juan Alberto Pérez-Valencia; Francisco Prosdocimi; Italo M Cesari; Igor Rodrigues da Costa; Carolina Furtado; Michelle Agostini; Franklin David Rumjanek
Journal:  Sci Rep       Date:  2018-01-31       Impact factor: 4.379

  7 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.