Literature DB >> 25749389

Circular RNA ITCH has inhibitory effect on ESCC by suppressing the Wnt/β-catenin pathway.

Fang Li1, Liyuan Zhang2, Wei Li1, Jieqiong Deng1, Jian Zheng1, Mingxing An1, Jiachun Lu3, Yifeng Zhou1.   

Abstract

Circular RNAs with exonic sequences represent a special form of non-coding RNAs, discovered by analyzing a handful of transcribed genes. It has been observed that circular RNAs function as microRNA sponges. In the present study, we investigated whether the expression of circular RNAs is altered during the development of esophageal squamous cell carcinoma (ESCC). Using a TaqMan-based reverse transcriptase polymerase chain reaction assay, the relationship between cir-ITCH and ESCC was analyzed in a total of 684 ESCC and paired adjacent non-tumor tissue samples from eastern and southern China. We found that cir-ITCH expression was usually low in ESCC compared to the peritumoral tissue. The functional relevance of cir-ITCH was further examined by biochemical assays. As sponge of miR-7, miR-17, and miR-214, cir-ITCH might increase the level of ITCH. ITCH hyper expression promotes ubiquitination and degradation of phosphorylated Dvl2, thereby inhibiting the Wnt/β-catenin pathway. These results indicate that cir-ITCH may have an inhibitory effect on ESCC by regulating the Wnt pathway.

Entities:  

Keywords:  ESCC; Wnt/β-catenin pathway; cir-ITCH

Mesh:

Substances:

Year:  2015        PMID: 25749389      PMCID: PMC4467417          DOI: 10.18632/oncotarget.3469

Source DB:  PubMed          Journal:  Oncotarget        ISSN: 1949-2553


INTRODUCTION

Esophageal cancer is the eighth most common cancer worldwide and sixth most common cause of cancer death [1]. One of the main subtypes is esophageal squamous cell carcinoma (ESCC), which is a malignancy that arises from esophageal epithelial cells [2]. Cancer is widely regarded as a genetic disease, and ESCC is no exception, but the molecular and genetic basis of esophageal carcinogenesis remains largely unknown [3, 4]. High-throughput RNA sequencing (RNA-Seq), an emerging method to study the RNA regulation mechanism in the whole genome, has been able to detect circular RNA [5]. Circular RNA, in general does not encode protein, but can occur in any genomic region; 85% of circular RNAs are aligned in sense orientation to known protein-coding genes, and they span 1–5 exons [6]. The existence of circular RNA was proposed for several years in early research, for example, the circular testis-determining gene, SRY [7]. The most well-known circular RNA is CDR1, coding for cerebellar degeneration-related protein 1, which has been observed in all domains of life, but overall, circular RNAs are considered extremely rare in nature [8]. Recently, circular RNAs were proposed to harbor microRNAs (miRNAs), and were found to be enriched with functional miRNA binding sites [6, 9]. Mature miRNAs always play an important regulatory role in cell growth, proliferation, differentiation, and cell death. Following database analysis of the study by Memczak et al. on circular RNA, we found that cir-ITCH spanned several exons of the E3 ubiquitin (Ub) protein ligase (ITCH). Moreover, both cir-ITCH and the 3′-untranslated region (UTR) of ITCH shared some miRNAs binding sites, which might suggest its role as a miRNA sponge [6, 10]. ITCH belongs to the Nedd4-like E3 family and typically contains 4 WW domains known to associate with PPxY-containing targets [11]. The targets of ITCH are usually associated with tumor formation and chemosensitivity [12]. A study has shown that ITCH degrades the phosphorylated form of disheveled (Dvl) via the proteasome pathway, thus inhibiting the action of the canonical Wnt pathway [13]. The Wnt/β-catenin pathway plays a role in the carcinogenesis of many cancer subtypes including hepatocellular carcinoma, pancreatic cancer, ovarian carcinoma, and ESCC [14-17]. A previous study has demonstrated that circular RNA has anti-cancer effects in malignant melanoma cell lines [18]. However, there are no reported studies on the functional roles of circular RNA in ESCC. In this study, we hypothesized that cir-ITCH might influence the expression level of ITCH and may be involved in ESCC development. To address this hypothesis, we conducted this study to delineate any cir-ITCH transcriptional aberrations between ESCC and paired adjacent non-neoplastic tissues obtained from two distinct eastern and southern Chinese centers.

RESULTS

Identification of cir-ITCH

RT-PCR assays were used in this study to verify the circular form of ITCH. We designed two sets of primers for ITCH: a divergent set that was expected to amplify only the circular form, and an opposite-directed set to amplify the linear forms. Our results showed that the circular form was amplified using the divergent primers (Figure 1A). cDNA and genomic DNA were used as templates, and as expected, no amplification was observed with the divergent primers on genomic DNA. GAPDH was used as a linear control (Figure 1A).
Figure 1

Cir-ITCH expression level is strongly associated with ESCC

(A) Divergent primers amplify circular RNAs in cDNA but not genomic DNA (gDNA). Convergent primers can amplify both circular RNAs and linear RNAs, GAPDH, linear control. (B) The cir-ITCH was expressed at a higher level in approximately 70.1% (251/358patients in the Suzhou cohort) and 71.2% (232/326 patients in the Guangzhou cohort) of the ESCC adjacent tissues compared to matched ESCC tissues. The expression level of cir-ITCH was analyzed by qRT-PCR based on Taq-man and normalized to GAPDH. Data are represented as mean±SEM from three independent experiments. (C) Random primers and oligodT primers were used respectively in the reverse transcription experiments. The predicted circular RNA is absent in poly (A) enriched samples. (D) The predicted circular RNA is resistant to RNase R treatment.

Cir-ITCH expression level is strongly associated with ESCC

(A) Divergent primers amplify circular RNAs in cDNA but not genomic DNA (gDNA). Convergent primers can amplify both circular RNAs and linear RNAs, GAPDH, linear control. (B) The cir-ITCH was expressed at a higher level in approximately 70.1% (251/358patients in the Suzhou cohort) and 71.2% (232/326 patients in the Guangzhou cohort) of the ESCC adjacent tissues compared to matched ESCC tissues. The expression level of cir-ITCH was analyzed by qRT-PCR based on Taq-man and normalized to GAPDH. Data are represented as mean±SEM from three independent experiments. (C) Random primers and oligodT primers were used respectively in the reverse transcription experiments. The predicted circular RNA is absent in poly (A) enriched samples. (D) The predicted circular RNA is resistant to RNase R treatment.

Expression of cir-ITCH in ESCC tissues

A TaqMan-based qRT-PCR assay was used for the divergent primer set to determine the levels of ITCH in 358 and 326 paired ESCC samples and matched non-cancerous tissues from eastern (Suzhou) and southern Chinese centers (Guangzhou), respectively, cir-ITCH was expressed at a higher level in approximately 70.1% (251/358 patients in the Suzhou cohort) and 71.2% (232/326 patients in the Guangzhou cohort) of the ESCC adjacent tissues compared to matched ESCC tissues (Figure 1B).

Characterization of cir-ITCH in ESCC cells

To study circular RNA at the cellular level, and to test the cyclization mechanism of RNA, we constructed a vector-based system expressing cir-ITCH. The constructed plasmids were transiently transfected into Eca-109 and TE-1 cells. Random and oligo-dT primers were used in the reverse transcription experiments. We expected that circular products would be depleted in the poly-(A)-enriched samples, in contrast to the linear products. When the oligo-dT primers were used, the relative expression of linear ITCH was significantly higher than that of circular ITCH (5.8-fold in Eca-109 cells and 10-fold in TE-1 cells; Figure 1C) [18]. To confirm further the circular characteristics of cir-ITCH, we used the enzyme RNase R, a highly processive 3′ to 5′ exoribonuclease that does not act on circular RNAs [19, 20]. As expected, in contrast to the linear control RNAs (10-fold in Eca-109 cells and 11-fold in TE-1 cells), the circular RNA was resistant to RNase R treatment (Figure 1D).

cir-ITCH interacts with miRNAs

miRanda (http://www.microrna.org/) and TargetScan/TargetScanS (http://www.targetscan.org/) software were used to predict the binding sites for human microRNA within cir-ITCH and the 3′-UTR region of ITCH. The results of both showed that miR-216b, miR-17, miR-214, miR-7, and miR-128 could bind to the 3′-UTR of ITCH and cir-ITCH. The sequence of the predicted 5 microRNAs binding sites were presented in Supplementary Table 1. The 5 miRNAs and one of the reporter constructs were transiently co-transfected into ESCC cells, and subsequently, luciferase activity was assessed. The results of the empty vector construct and miR-17 showed that luciferase activity was significantly reduced in a concentration-dependent manner in Eca-109 cells (Figure 2A), and this trend was also present with mimics of miR-7, miR-214, miR-216b, and miR-128 in the control cells (1 pmol miRNA-17: 1.817 ± 0.022 versus 2.187 ± 0.009, P = 0.02; 40 pmol miRNA-17: 1.656 ± 0.02 versus 2.187 ± 0.009, P = 0.005; 1 pmol miRNA-7: 1.019 ± 0.014 versus 1.187 ± 0.009, P = 0.04; 40 pmol miRNA-7: 0.828 ± 0.016 versus 1.187 ± 0.009, P = 0.007; 1 pmol miRNA-214: 1.073 ± 0.014 versus 1.213 ± 0.012, P = 0.02; 40 pmol miRNA-214: 1.015 ± 0.02 versus 1.213 ± 0.012, P = 0.004; 1 pmol miRNA-216b: 0.742 ± 0.014 versus 0.873 ± 0.012, P = 0.005; 40 pmol miRNA-216b: 0.623 ± 0.009 versus 0.873 ± 0.012, P = 0.001; 1 pmol miRNA-128: 0.715 ± 0.01 versus 0.852 ± 0.02, P = 0.02; 40 pmol miRNA-128: 0.610 ± 0.006 versus 0.852 ± 0.02, P = 0.012). However, in cells with cir-ITCH hyperexpression, the results showed that there were no significant differences in luciferase activity when the psiCHECK-2-ITCH-binding-site vector and miRNAs were co-transfected into Eca-109 cells except the miR-216b and miR-128 (1 pmol miRNA-17: 2.196 ± 0.007 versus 2.215 ± 0.02, P = 0.68; 40 pmol miRNA-17: 2.145 ± 0.02 versus 2.215 ± 0.02, P = 0.2; 1 pmol miRNA-7: 1.197 ± 0.006 versus 1.22 ± 0.01, P = 0.41; 40 pmol miRNA-7: 1.190 ± 0.007 versus 1.22 ± 0.01, P = 0.13; 1 pmol miRNA-214: 1.157 ± 0.011 versus 1.191 ± 0.006, P = 0.206; 40 pmol miRNA-214: 1.151 ± 0.008 versus 1.191 ± 0.006, P = 0.264; 1 pmol miRNA-216b: 0.741 ± 0.014 versus 0.897 ± 0.013, P = 0.0005; 40 pmol miRNA-216b: 0.623 ±0.009 versus 0.897 ± 0.013, P = 0.001; 1 pmol miRNA-128:0.717 ± 0.013 versus 0.914 ± 0.013, P = 0.00009; 40 pmol miRNA-128: 0.610 ± 0.008 versus 0.914 ± 0.013, P=0.002). Similar results were obtained in TE-1 cells (Figure 2A).
Figure 2

Cir-ITCH is functioning as microRNA sponges

(A) Relative luciferase activity of the psiCHECK-2-ITCH constructs co-transfected with miR-17, miR-7, miR-214, miR-216b and miR-128 and inhibitor in Eca-109 and TE-1cells. In Cir-ITCH hyper-expression cells, there were no significant differences in luciferase activity when psiCHECK-2-ITCH-binding site with miRNAs were cotransfected into Eca-109 and TE-1cells. Six replicates for each group and the experiment repeated at least three times. Data are mean±SEM. (B) Eca-109 and TE-1 cells after transfected with Cir-ITCH and Control lentiviruses were respectively transfected with miR-17,miR-7,miR-214 and inhibitor for 24 h and were then further exposed to actinomycin D for 1, 2 and 3 h. Cells were harvested and the stability of cir-ITCH mRNA was analyzed by qRT-PCR relative to time 0 after blocking new RNA synthesis with actinomycin D; data are mean±SEM, normalized to GAPDH.

Cir-ITCH is functioning as microRNA sponges

(A) Relative luciferase activity of the psiCHECK-2-ITCH constructs co-transfected with miR-17, miR-7, miR-214, miR-216b and miR-128 and inhibitor in Eca-109 and TE-1cells. In Cir-ITCH hyper-expression cells, there were no significant differences in luciferase activity when psiCHECK-2-ITCH-binding site with miRNAs were cotransfected into Eca-109 and TE-1cells. Six replicates for each group and the experiment repeated at least three times. Data are mean±SEM. (B) Eca-109 and TE-1 cells after transfected with Cir-ITCH and Control lentiviruses were respectively transfected with miR-17,miR-7,miR-214 and inhibitor for 24 h and were then further exposed to actinomycin D for 1, 2 and 3 h. Cells were harvested and the stability of cir-ITCH mRNA was analyzed by qRT-PCR relative to time 0 after blocking new RNA synthesis with actinomycin D; data are mean±SEM, normalized to GAPDH. We next investigated cir-ITCH stability. Eca-109 and TE-1 cells transfected with the plasmid construct were treated with actinomycin D, a transcription inhibitor, in the presence of 1 or 40 pmol of miR-17, miR-7, and miR-214, and total RNA was harvested at indicated time points. There was little change in cir-ITCH levels in Eca-109 cells following incubation with actinomycin D for 1–3 hours, while the associated control remained level at 20–30%; the former cir-ITCH levels were significantly higher than the latter (P < 0.01). We repeated these experiments in TE-1 cells with the same results (Figure 2B).

Correlation analysis of cir-ITCH and ITCH in ESCC

We evaluated the expression of cir-ITCH in a randomly selected cohort of 30 pairs of ESCC adjuvant non-cancerous tissues from Suzhou. The results showed that patients with higher cir-ITCH expression levels in ESCC tissues had a substantial up-regulation of linear ITCH. Furthermore, we tested the mRNA expression levels of linear ITCH in constructed cir- ITCH cells with stable high expression, and the results showed that the linear ITCH positively correlated with levels of cir- ITCH (R2 = 0.32, P < 0.01; Figure 3A).
Figure 3

Cir-ITCH involves in the regulation Wnt Signaling in vivo

(A) The linear correlations between the cir-ITCH expression levels and linear ITCH were observed. The relative expression value was normalized by GAPDH expression level. (B) The protein levels of ITCH, Wnt3a, Dvl2 and β-catenin was assessed in ESCC cells (Eca-109 cells and TE-1 cells) by Western blot after cir-ITCH or Control lentiviruses infection. β -actin was loading control. Data was representative of three independent experiments. (C) A TCF luciferase reporter assay was performed using phRL-TK and TOPFlash (the wild-type TCF reporter). The luciferase activity was normalized to the Renilla luciferase activity. (D) The mRNA level of c-MYC was detected by quantitative RT-PCR after transfected with cir-ITCH or Control lentiviruses in ESCC cells. Data are mean±SEM and representative of three independent experiments.

Cir-ITCH involves in the regulation Wnt Signaling in vivo

(A) The linear correlations between the cir-ITCH expression levels and linear ITCH were observed. The relative expression value was normalized by GAPDH expression level. (B) The protein levels of ITCH, Wnt3a, Dvl2 and β-catenin was assessed in ESCC cells (Eca-109 cells and TE-1 cells) by Western blot after cir-ITCH or Control lentiviruses infection. β -actin was loading control. Data was representative of three independent experiments. (C) A TCF luciferase reporter assay was performed using phRL-TK and TOPFlash (the wild-type TCF reporter). The luciferase activity was normalized to the Renilla luciferase activity. (D) The mRNA level of c-MYC was detected by quantitative RT-PCR after transfected with cir-ITCH or Control lentiviruses in ESCC cells. Data are mean±SEM and representative of three independent experiments.

cir-ITCH is involved in the regulation of Wnt Signaling in vivo

Previous studies using the yeast two-hybrid system and co-immunoprecipitation assays have shown that ITCH is a novel Dvl-interacting protein. The ITCH protein can ubiquitinate the phosphorylated form of Dvl and promote its degradation, thereby inhibiting canonical Wnt signaling [21]. To confirm whether cir-ITCH regulates the Wnt/β-catenin signaling pathway in ESCC cells, we used a β-catenin/T-cell factor (TCF)-responsive luciferase reporter assay. In Eca-109 cells, we used an anti-Dvl2 antibody to test endogenous Dvl2 levels. Transient ITCH hyperexpression reduced the intensity of Dvl2, but the effect was not so obvious in the control cells. A western blot analysis was performed to determine β-catenin levels in cells with ITCH hyperexpression, and as shown in Figure 3B, there was an obvious decrease in β-catenin levels. We overexpressed ITCH in Eca-109 cells and evaluated its effects using the TOP-Flash reporter system. As shown in Figure 3C, overexpression of ITCH significantly suppressed relative TCF transcriptional activity. Then, we investigated the effect of ITCH on the expression of endogenous Wnt target genes like c-Myc, in cells transfected with cir-ITCH, and discovered that the Wnt target genes were further suppressed (Figure 3D).

cir-ITCH regulates the cell cycle of ESCC cells

We investigated the effects of cir-ITCH on cell cycle using fluorescence-activated cell sorting (FACS) analysis of PI-stained ESCC cells. The representative results of the cell cycle distribution in empty vector and cir-ITCH transfected Eca-109, and TE-1 cells in the presence of miR-17 are shown in (Figure 4A). It is evident that overexpression of cir-ITCH resulted in a statistically significant accumulation of ESCC cells in the G1 phase (Eca-109 cells: 14.4% increase, P = 0.007; TE-1 cells: 9.6% increase, P = 0.007) accompanied by a decrease in the S phase (Eca-109 cells: 9.9% decrease, P = 0.002; TE-1 cells: 7.2% decrease, P = 0.026), compared with the controls. The cell cycle results for miR-7 and miR-214 are shown in Supplementary Figure 1A, 1B.
Figure 4

The effects of ectopicCir-ITCH expression on ESCC cell cycle and proliferation

(A) Cell cycle analysis of Eca-109 and TE-1 cells after transfected with Cir-ITCH, or Control lentiviruses. Flow cytometry data are represented as mean±SEM and are based on three independent experiments. (B) Eca-109 and TE-1 cells were seeded in 96-well plates after transfected with Cir-ITCH and Control lentiviruses, and cell proliferation was performed daily for 3 days using the CCK-8 assay. Six replicates for each group and the experiment repeated three times. Data are mean±SEM. *P<0.05 compared with controls. (C) Representative colony formation assay in Eca-109 and TE-1 cells after transfected with Cir-ITCH and Control lentiviruses, the numbers of colonies in vector-transfected controls were set to 100%. Data are present as mean±SEM from three experiments. (D) Representative images of xenografts in each group 2 weeks after subcutaneously implanted ESCC cells stably expressing Cir-ITCH and respective empty vector (left). Mean tumor volumes from eight nude mice of each group are shown at different time points (right). *P<0.05 compared with controls.

The effects of ectopicCir-ITCH expression on ESCC cell cycle and proliferation

(A) Cell cycle analysis of Eca-109 and TE-1 cells after transfected with Cir-ITCH, or Control lentiviruses. Flow cytometry data are represented as mean±SEM and are based on three independent experiments. (B) Eca-109 and TE-1 cells were seeded in 96-well plates after transfected with Cir-ITCH and Control lentiviruses, and cell proliferation was performed daily for 3 days using the CCK-8 assay. Six replicates for each group and the experiment repeated three times. Data are mean±SEM. *P<0.05 compared with controls. (C) Representative colony formation assay in Eca-109 and TE-1 cells after transfected with Cir-ITCH and Control lentiviruses, the numbers of colonies in vector-transfected controls were set to 100%. Data are present as mean±SEM from three experiments. (D) Representative images of xenografts in each group 2 weeks after subcutaneously implanted ESCC cells stably expressing Cir-ITCH and respective empty vector (left). Mean tumor volumes from eight nude mice of each group are shown at different time points (right). *P<0.05 compared with controls.

cir-ITCH modulates cell growth

We performed colony formation and CCK-8 assays to test the effects of cir-ITCH on ESCC cell proliferation. Supporting our overexpression data, CCK-8 assay results revealed that after 3 days of culture in cir-ITCH-overexpressing Eca-109 and TE-1 cells in the presence of miR-17, miR-7, and miR-214, cell proliferation dramatically decreased (Eca-109 cells: 20% decrease; TE-1 cells: 17.4% decrease) compared to the controls (Figure 4B). CCK-8 experiment results with miR-17, miR-7, and miR-214 showed the same trend (Supplementary Figure 1C). Consistently, colony formation assays performed at 2 weeks showed that cells with cir-ITCH-overexpression had reduced colony-forming ability compared to the control groups (Eca-109 cells: 31.25% decrease; TE-1 cells: 32.25% decrease; Figure 4C). Thus, both assays show that cir-ITCH modulates cell proliferation.

cir-ITCH suppresses tumor growth

As shown in (Figure 4D), Eca-109 and TE-1 cells with up-regulated cir-ITCH (Eca-109-cir-ITCH and TE-1-cir-ITCH cells) were subcutaneously injected into the back flank of nude mice. Our results showed that the growth of tumors from up-regulated cir-ITCH xenografts was significantly inhibited compared with that of the control xenografts: 250.6 ± 21.6 mm3 versus 560.7.0 ± 24.5 mm3 for Eca-109 cells (P < 0.001); and 200.4 ± 17.9 mm3 versus 550.2 ± 16.3 mm3 for TE-1 cells (P < 0.001), respectively.

DISCUSSION

Through a series of functional experiments, we identified a cir-ITCH circular RNA whose role had not yet been elucidated. Here, we demonstrated that cir-ITCH acts as a miRNA sponge, increases the level of ITCH, and provokes ubiquitin-mediated Dvl2 degradation, which inhibits canonical Wnt signaling. These results illustrate the basic interaction between circular RNA, miRNA, and protein in cells, and alteration of this fine regulation may contribute to cancer initiation and progression. Cir-ITCH is located on chromosome 20q11.22 on the plus strand, is aligned in a sense orientation to the known protein-coding gene ITCH, and spans exons 6–13. ITCH is a member of the E3 ubiquitin ligases that regulate protein stability and immunological responses, as well as cancer progression [22]. ITCH was initially identified when disruption of the ITCH gene induced a fatal autoimmune inflammatory condition [23]. Latterly, ITCH was found to be crucial in the control of proteasome degradation of several important substrates such as p63, p73, Notch1, and Dvl2 [21, 24-26]; all of which are usually associated with tumor formation and chemosensitivity. The protein-coding function of messenger RNAs can be suppressed by the binding of short miRNA sequences, or miRNAs can guide the effector protein Argonaute to the mRNAs of coding genes to repress their protein production [27-29]. Previous experiments using ectopic expression of miRNA indicated that it could bind to the 3′-UTR of ITCH to decrease its expression [30]. Memczak et al. (2013) and Hansen et al. (2011) proposed that CDR1, a circular RNA, harbored a miR-7 binding site. This striking feature suggested that circular RNA possibly functioned as a miRNA sponge [6, 9, 31]. In our study, we found that the cir-ITCH harbors many miRNA binding sites that could bind to the 3′-UTR of ITCH, including those for miR-7, miR-17, and miR-214. Furthermore, these miRNAs have often been associated with cancer. Elevated miR-7 expression has been described in a variety of tumor types including ESCC and has been implicated in oncogenesis, classification, and cancer progression [32, 33]. miR-214 is aberrantly expressed in several human tumors, for example, it is upregulated in ovarian cancer and gastric cancer [34, 35]. miR-216b is a tumor suppressor in nasopharyngeal cancer [36]. miR-17, which is frequently up-regulated in ESCC, has been widely studied, and it is a potential prognostic biomarker for ESCC [37]. Collectively, cir-ITCH is involved in regulating miRNAs that are associated with cancer. cir-ITCH acts as a miRNA sponge and increases the level of ITCH. ITCH plays an important role in the Wnt/β-catenin pathway and its activation is thought to contribute to the development of some human cancers [38, 39]. Initially, it was reported that activated Wnt/β-catenin signaling was defined by β-catenin nuclear expression and associated with breast cancer [40]. Recent studies have identified that Wnt/β-catenin signaling activation is found in hepatocellular carcinoma [16]. The Wnt/β-catenin pathway has been very well described, as it is important in cancer research. It is mediated by Dvl2, which functions as an essential scaffold protein, bridging the receptors and downstream signaling components [41, 42]. Phosphorylation of Dvl2 is required for Wnt signaling, and is crucial to regulate its stability and activity for proper signal transduction. According to previous research, ITCH could promote the ubiquitination and degradation of phosphorylated Dvl2, and therefore, inhibit canonical Wnt signaling [21]. Our data demonstrated that overexpressed cir-ITCH was able to suppress phosphorylated Dvl2 and inhibit Wnt/β-catenin signaling in ESCC cells. The β-catenin/TCF-responsive luciferase reporter assay was used to examine whether a single gene regulates the Wnt/β-catenin signaling pathway. In our study, overexpression of cir-ITCH significantly suppressed relative TCF transcriptional activity. The oncogene c-Myc is a target gene in canonical Wnt signaling; it is frequently overexpressed in many cancers and has a crucial role in cell growth, reproduction, apoptosis, and differentiation [43]. Knockdown of c-Myc leads to cell-cycle arrest and limits malignant cancer cell growth. Our cell-cycle results showed the same trend and indicated that cir-ITCH affects the expression of c-Myc. Therefore, we suggest that cir-ITCH may have an antitumor function in ESCC and suppress the canonical Wnt pathway. Based on these findings, we are able to conclude that cir-ITCH has an antitumor role by controlling miRNA activity, which increases the concentration of ITCH, and results in suppression of the canonical Wnt pathway by degradation of phosphorylated Dvl2, and inhibition of c-Myc expression, which may prevent oncogenesis (Figure 5).
Figure 5

Schematic representation of the method used for the analysis of Cir-ITCH regulated progress of ESCC

Cir-ITCH is a potential tumor suppressor acting through the control of miRNAs activity such as miR-7, miR-17, miR-214 and increase the concentration of ITCH, resulting in suppression of the canonical Wnt pathway by degradation of phosphorylated Dvl2, and inhibited the oncogene c-myc expression therefore inhibit canonical Wnt signaling.

Schematic representation of the method used for the analysis of Cir-ITCH regulated progress of ESCC

Cir-ITCH is a potential tumor suppressor acting through the control of miRNAs activity such as miR-7, miR-17, miR-214 and increase the concentration of ITCH, resulting in suppression of the canonical Wnt pathway by degradation of phosphorylated Dvl2, and inhibited the oncogene c-myc expression therefore inhibit canonical Wnt signaling. In summary, the current study represents an analysis of 2-stage clinical ESCC samples for the circular RNA, cir-ITCH. The results show that there is low expression of cir-ITCH in ESCC tumor tissues, and that cir-ITCH reduces cell viability, and arrests proliferation in ESCC cells. The inhibition effects of cir-ITCH may be related to its cooperation with Dvl2 to suppress the Wnt/β-catenin pathway. Overall, our data support the assumption that cir-ITCH acts as a miRNA sponge and increases expression of the miRNA target gene ITCH. The availability of circularizing the miRNA sponge in cells is a candidate for new strategies for RNA-based cancer diagnosis and therapy.

MATERIALS AND METHODS

Study subjects

All subjects in this study were homogenous Han Chinese from eastern or southern China. At the eastern Chinese center, 358 ESCC and corresponding paracancerous tissue samples were obtained from patients at affiliate hospitals of Soochow University (Suzhou). At the southern Chinese center, a further 326 ESCC tissues were harvested from patients at the cancer hospitals affiliated with Guangzhou Medical University. There were no restrictions on age, stage of ESCC, sex or histology. This study was approved by the Medical Ethics Committee of Soochow University and Guangzhou Medical University. The clinical characteristics of all patients are listed in Table 1.
Table 1

Baseline demographic and clinical characteristics of study populations

CharacteristicsSuzhou populationGuangzhou populationOverall
N(%)N(%)N(%)
Age(years)
  ≤4041(11.5)42(12.9)83(12.1)
  40-60203(56.6)187(57.3)390(57.0)
  ≥60114(31.9)97(29.8)211(30.9)
Sex
  Male281(78.5)271(83.1)552(80.7)
  Female77(21.5)55(16.9)132(19.3)
Body mass index
  ≤2079(22.1)59(18.1)138(20.2)
  20-28255(71.2)245(75.2)500(73.1)
  ≥2824(6.7)22(6.7)46(6.7)
Family history
  Yes29(8.1)31(9.5)60(8.8)
  No329(91.9)295(90.5)624(91.2)
Smoking
  Never126(35.2)109(33.4)235(34.4)
  Ever232(64.8)217(66.6)449(65.6)
Drinking
  Never187(52.2)169(51.8)356(52.0)
  Ever171(47.8)157(48.2)328(48.0)
Pathological type
  Highly62(17.3)65(19.9)127(18.6)
  Moderately201(56.1)178(54.6)379(55.4)
  Low95(26.5)83(25.5)178(26)
Stage
  I38(10.6)41(12.6)79(11.5)
  II162(45.3)142(43.6)304(44.5)
  III158(44.1)143(43.8)301(44.0)

Cell culture and animals

Human esophageal carcinoma cancer cell lines Eca-109 and TE-1 were purchased from the Cell Bank of Type Culture Collection of the Chinese Academy of Sciences, Shanghai Institute of Cell Biology, and were passaged for less than 6 months. Cells were maintained in RPMI-1640 medium (Gibco BRL, Gaithersburg, MD), and supplemented with 10% heat-inactivated fetal bovine serum (Gibco BRL), 2 mM L-glutamine, 100 U/mL penicillin, and 100 U/mL streptomycin. Culture plates were then incubated at 37°C in an atmosphere of 5% CO2. Female BALB/c nude mice that were 4–5 weeks old were purchased from the Shanghai Laboratory Animal Center at the Chinese Academy of Sciences (Shanghai, China). All mouse experiments were performed according to the Laboratory Animal Center of Soochow University's guidance.

Circular RNA plasmid construction

We constructed the circular RNA plasmid used in this study. Human cir-ITCH cDNA was synthesized by GeneWiz (Suzhou, China) and cloned into pLVX-IRES-neo (Clontech Laboratories Inc., San Francisco, CA, USA). We used a 996 bp DNA fragment corresponding to exons 6–13 of the ITCH gene, and added 1 kb upstream and 200 bp downstream to the nonlinear splice sites. Also, an 800-bp DNA stretch was added upstream of the splice acceptor site and inserted downstream in the reverse orientation [9]. The resulting construct (pLVX-cir-ITCH) was verified by direct sequencing.

Lentiviral production and transduction

The cDNA sequence of cir-ITCH was synthesized by the Genewiz Company (Suzhou, China) and then cloned into the lentiviral expression vector pLVX-IRES-neo (Clontech Laboratories Inc., San Francisco, CA, USA). Lentiviral production and transduction were conducted by following previously published procedures [44].

RNA extraction and real-time quantitative polymerase chain reaction

Total RNA was isolated from cells and tissues using the TRIzol® reagent (Invitrogen) according to the manufacturer's instructions. Esophageal tissue samples from newly diagnosed ESCC patients were immediately placed in liquid nitrogen and then stored at −80°C before analysis. cDNA was synthesized from total RNA using SuperScript III® (Invitrogen) according to the supplied protocol. The relative gene expression of cir-ITCH was determined using the ABI Prism 7500 sequence detection system (Applied Biosystems, Foster City, CA, USA), which is based on the TaqMan method. GAPDH was used as an internal standard control, and all reactions were performed in triplicate [45]. The primers used for polymerase chain reaction (PCR) amplification are listed in Table 2.
Table 2

The sequences of primers, probes, used in this study

Primers for PCRForwardReverseprobe
Cir-ITCHGCAGAGGCCAACACTGGAATCCTTGAAGCTGACTACGCTGAGCCGTCCGGAACTATGAACAACAATGGCA
GAPDHCAATGACCCCTTCATTGACCTTGATTTTGGAGGGATCTCGCTGAGAACGGGAAGCTTGTC
Linear ITCHTAGACCAGAACCTCTACCTCCTGTTAAACTGCTGCATTGCTCCTTG
Circular ITCHACAGAGACAACCGAGAAACAGTGGCCTTGATACTTGTTACCGTCGA
c-MycTTCGGGTAGTGGAAAACCAGCAGCAGCTCGAATTTCTTCC
GAPDHGAAGGTGAAGGTCGGAGTCGAAGATGGTGATGGGATTTC

RNase R digestion

The RNase R digestion reaction was performed following previously published procedures. The digestion and precipitation reactions were repeated twice with a ratio of 3 U enzyme/1 mg RNA [8].

Transient transfections and luciferase assays

Eca-109 and TE-1 cells were seeded in 24-well plates (1 × 105 cells per well) and cultured to 60–70% confluence before transfection; then, cells were transfected with 800 ng of the reporter plasmids described above using Lipofectamine 2000 (Invitrogen, CA, USA). Cells were co-transfected with 0, 1 or 40 pmol of miR-216b, miR-17, miR-214, miR-7, and miR-128 mimics according to the manufacturer's instructions [46]. cir-ITCH hyperexpression in cells was evaluated with the same test. Each group included 6 replicates, and independent triplicate experiments were performed. After transfection for 24 h, the cells were collected using 100 μL passive buffer, and Renilla luciferase activity was detected using the Dual-Luciferase Reporter Assay System (Promega), and a TD-20/20 illuminometer (Turner Biosystems, Sunnyvale, CA); the results were normalized against the activity of the Renilla luciferase gene.

Actinomycin D assay

TE-1 and Eca-109 cells were seeded at 5 × 104 cells per well in 10 mm 24-multiwell plates. Sixteen hours later, the cells were transiently transfected using Lipofectamine 2000 (Invitrogen) and co-transfected with 1 or 40 pmol of miRNA mimics (Ambion) with or without 40 pmol of miRNA inhibitor, as indicated, for 24 h; then the cells were exposed to actinomycin D (Sigma, St Louis, MO) for 1, 2, and 3 h. The cells were harvested and the stability of the cir-ITCH mRNA was analyzed using quantitative reverse transcriptase PCR (qRT-PCR). Actinomycin D was used at concentrations of 2 mg/L.

Western blotting

Protein lysates from ESCC tissues and cells were subjected to western blot analysis according to standard protocols as previously described [47]. Antibodies recognizing ITCH, Dvl2 and β-Actin were from Cell Signaling. Antibodies recognizing β-catenin and Wnt3a were from Abcam.

Cell viability assay

In 96-well, flat-bottomed plates (BD Biosciences, Bedford, MA), 100 μL of Eca-109 and TE-1 cell suspensions (10,000 cells per mL) were aliquoted into each well. After transfection, as described previously for the actinomycin D assay, and 1, 2, and 3 days of cultivation, cell viability was measured by the Cell Counting Kit-8 (CCK-8) system (Dojindo Laboratory, Kumamoto, Japan) according to the manufacturer's instructions. Briefly, 10 μL of CCK-8 solution was added to each well, the plates were incubated at 37°C for 1 h, and the absorbance of each well was read at 450 nm using a microplate reader (MRX; Dynex Technologies, West Sussex, United Kingdom). There were 6 replicates for each group, and the experiments were repeated at least 3 times.

Colony formation assay

ESCC cells with stable cir-ITCH overexpression and controls (80 cells) were seeded into a 60-mm plate. After incubation for 2 weeks at 37°C in a 5% humidified CO2 atmosphere, colonies (>50 cells per colony) were stained with Giemsa, counted, and photographed. Each experiment was performed in triplicate.

Cell cycle analysis

For cell cycle analysis, ESCC cells with stable cir-ITCH overexpression were stained with 0.5 mL propidium iodide (PI) staining solution, and cellular DNA content was analyzed by flow cytometry (FACScalibur; BD Biosciences).

Xenografts in mice

Eca-109-empty vector, Eca-109-cir-ITCH, TE-1-empty vector, and TE-1-cir-ITCH cells were diluted to a concentration of 1 × 106/mL in physiological saline. Mice were injected subcutaneously with 0.1 mL of the suspension into the back flank. When a tumor was palpable, tumor growth was measured every other day with a caliper. Tumor volume (V) was calculated according to the following formula: V = L × W2 × 0.5 (L, length; W, width).

Statistical analyses

One-way analysis of variance and linear regression models were used to identify the effect of altered cir-ITCH expression on the ITCH mRNA levels in ESCC cells, and the correlation between the expression of cir-ITCH and the ITCH gene in ESCC tissues. Differences between groups were assessed by a paired, 2-tailed student's t-test. A P-value of <0.05 was considered statistically significant.
  47 in total

Review 1.  Nedd4-like proteins: an emerging family of ubiquitin-protein ligases implicated in diverse cellular functions.

Authors:  K F Harvey; S Kumar
Journal:  Trends Cell Biol       Date:  1999-05       Impact factor: 20.808

Review 2.  Dishevelled: The hub of Wnt signaling.

Authors:  Chan Gao; Ye-Guang Chen
Journal:  Cell Signal       Date:  2009-12-13       Impact factor: 4.315

3.  The itchy locus encodes a novel ubiquitin protein ligase that is disrupted in a18H mice.

Authors:  W L Perry; C M Hustad; D A Swing; T N O'Sullivan; N A Jenkins; N G Copeland
Journal:  Nat Genet       Date:  1998-02       Impact factor: 38.330

4.  Substrate recognition and catalysis by the exoribonuclease RNase R.

Authors:  Helen A Vincent; Murray P Deutscher
Journal:  J Biol Chem       Date:  2006-08-07       Impact factor: 5.157

5.  Silibinin inhibits Wnt/β-catenin signaling by suppressing Wnt co-receptor LRP6 expression in human prostate and breast cancer cells.

Authors:  Wenyan Lu; Cuihong Lin; Taj D King; Honghong Chen; Robert C Reynolds; Yonghe Li
Journal:  Cell Signal       Date:  2012-07-20       Impact factor: 4.315

6.  A sequence polymorphism in miR-608 predicts recurrence after radiotherapy for nasopharyngeal carcinoma.

Authors:  Jian Zheng; Jieqiong Deng; Mang Xiao; Lei Yang; Liyuan Zhang; Yonghe You; Min Hu; Na Li; Hongchun Wu; Wei Li; Jiachun Lu; Yifeng Zhou
Journal:  Cancer Res       Date:  2013-06-24       Impact factor: 12.701

Review 7.  Proximal events in Wnt signal transduction.

Authors:  Stephane Angers; Randall T Moon
Journal:  Nat Rev Mol Cell Biol       Date:  2009-07       Impact factor: 94.444

8.  Construction of circular miRNA sponges targeting miR-21 or miR-221 and demonstration of their excellent anticancer effects on malignant melanoma cells.

Authors:  Yuchen Liu; Hongzhou Cui; Wenjun Wang; Longnian Li; Zaixing Wang; Sen Yang; Xuejun Zhang
Journal:  Int J Biochem Cell Biol       Date:  2013-09-11       Impact factor: 5.085

9.  The E3 ubiquitin ligase Itch controls the protein stability of p63.

Authors:  Mario Rossi; Rami I Aqeilan; Michael Neale; Eleonora Candi; Paolo Salomoni; Richard A Knight; Carlo M Croce; Gerry Melino
Journal:  Proc Natl Acad Sci U S A       Date:  2006-08-14       Impact factor: 11.205

10.  Transcriptome-wide discovery of circular RNAs in Archaea.

Authors:  Miri Danan; Schraga Schwartz; Sarit Edelheit; Rotem Sorek
Journal:  Nucleic Acids Res       Date:  2011-12-02       Impact factor: 16.971

View more
  313 in total

1.  Circular RNA expression profile and potential function of hsa_circ_0045272 in systemic lupus erythematosus.

Authors:  Lian-Ju Li; Zhi-Wei Zhu; Wei Zhao; Sha-Sha Tao; Bao-Zhu Li; Shu-Zhen Xu; Jie-Bing Wang; Ming-Yue Zhang; Jun Wu; Rui-Xue Leng; Yin-Guang Fan; Hai-Feng Pan; Dong-Qing Ye
Journal:  Immunology       Date:  2018-05-23       Impact factor: 7.397

Review 2.  Functional role of circular RNAs in cancer development and progression.

Authors:  Wei Lun Ng; Taznim Begam Mohd Mohidin; Kirti Shukla
Journal:  RNA Biol       Date:  2018-08-04       Impact factor: 4.652

3.  CircRNA LRP6 promotes the development of osteosarcoma via negatively regulating KLF2 and APC levels.

Authors:  Shengnai Zheng; Zhanyang Qian; Fan Jiang; Dawei Ge; Jian Tang; Hongtao Chen; Jin Yang; Yilun Yao; Junwei Yan; Lei Zhao; Haijun Li; Lei Yang
Journal:  Am J Transl Res       Date:  2019-07-15       Impact factor: 4.060

Review 4.  Circular RNAs: A Novel Class of Functional RNA Molecules with a Therapeutic Perspective.

Authors:  Laura Santer; Christian Bär; Thomas Thum
Journal:  Mol Ther       Date:  2019-07-09       Impact factor: 11.454

5.  Roles of the circular RNA circ-Foxo3 in breast cancer progression.

Authors:  Wei-Yang Lu
Journal:  Cell Cycle       Date:  2017-02-25       Impact factor: 4.534

Review 6.  Circular RNA - New member of noncoding RNA with novel functions.

Authors:  Kuei-Yang Hsiao; H Sunny Sun; Shaw-Jenq Tsai
Journal:  Exp Biol Med (Maywood)       Date:  2017-05-09

7.  Identification of HuR target circular RNAs uncovers suppression of PABPN1 translation by CircPABPN1.

Authors:  Kotb Abdelmohsen; Amaresh C Panda; Rachel Munk; Ioannis Grammatikakis; Dawood B Dudekula; Supriyo De; Jiyoung Kim; Ji Heon Noh; Kyoung Mi Kim; Jennifer L Martindale; Myriam Gorospe
Journal:  RNA Biol       Date:  2017-01-12       Impact factor: 4.652

8.  Circular RNA Vav3 sponges gga-miR-375 to promote epithelial-mesenchymal transition.

Authors:  Xinheng Zhang; Yiming Yan; Wencheng Lin; Aijun Li; Huanmin Zhang; Xiaoya Lei; Zhenkai Dai; Xinjian Li; Hongxin Li; Weiguo Chen; Feng Chen; Jingyun Ma; Qingmei Xie
Journal:  RNA Biol       Date:  2019-01-15       Impact factor: 4.652

9.  Silencing CDR1as inhibits colorectal cancer progression through regulating microRNA-7.

Authors:  Wentao Tang; Meiling Ji; Guodong He; Liangliang Yang; Zhengchuan Niu; Mi Jian; Ye Wei; Li Ren; Jianmin Xu
Journal:  Onco Targets Ther       Date:  2017-04-07       Impact factor: 4.147

Review 10.  Non-coding transcript variants of protein-coding genes - what are they good for?

Authors:  Sonam Dhamija; Manoj B Menon
Journal:  RNA Biol       Date:  2018-09-10       Impact factor: 4.652

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.