Literature DB >> 25732533

Loss of floral repressor function adapts rice to higher latitudes in Europe.

Jorge Gómez-Ariza1, Francesca Galbiati2, Daniela Goretti1, Vittoria Brambilla1, Roshi Shrestha1, Andrea Pappolla3, Brigitte Courtois4, Fabio Fornara5.   

Abstract

The capacity to discriminate variations in day length allows plants to align flowering with the most favourable season of the year. This capacity has been altered by artificial selection when cultivated varieties became adapted to environments different from those of initial domestication. Rice flowering is promoted by short days when HEADING DATE 1 (Hd1) and EARLY HEADING DATE 1 (Ehd1) induce the expression of florigenic proteins encoded by HEADING DATE 3a (Hd3a) and RICE FLOWERING LOCUS T 1 (RFT1). Repressors of flowering antagonize such induction under long days, maintaining vegetative growth and delaying flowering. To what extent artificial selection of long day repressor loci has contributed to expand rice cultivation to Europe is currently unclear. This study demonstrates that European varieties activate both Hd3a and RFT1 expression regardless of day length and their induction is caused by loss-of-function mutations at major long day floral repressors. However, their contribution to flowering time control varies between locations. Pyramiding of mutations is frequently observed in European germplasm, but single mutations are sufficient to adapt rice to flower at higher latitudes. Expression of Ehd1 is increased in varieties showing reduced or null Hd1 expression under natural long days, as well as in single hd1 mutants in isogenic backgrounds. These data indicate that loss of repressor genes has been a key strategy to expand rice cultivation to Europe, and that Ehd1 is a central node integrating floral repressive signals.
© The Author 2015. Published by Oxford University Press on behalf of the Society for Experimental Biology.

Entities:  

Keywords:  Adaptation; Ehd1; Hd1; Hd3a; RFT1.; heading date; photoperiodic flowering; rice

Mesh:

Substances:

Year:  2015        PMID: 25732533      PMCID: PMC4378634          DOI: 10.1093/jxb/erv004

Source DB:  PubMed          Journal:  J Exp Bot        ISSN: 0022-0957            Impact factor:   6.992


Introduction

Photoperiod (or day length) and temperature are crucial cues that plants use to monitor diurnal and seasonal time (Amasino, 2010). Complex molecular networks have evolved in distinct plant lineages to translate environmental signals into molecular signals that drive reproductive development (Andrés and Coupland, 2012). Rice (Oryza sativa) is a facultative short day (SD) plant in which flowering is accelerated upon exposure to photoperiods falling below a critical threshold, and has been extensively used as model system to understand the genetic and molecular basis of flowering time (Brambilla and Fornara, 2013). Besides its prominent role as a plant model system, amenable to genetic studies, rice is a staple food for large parts of the world population, particularly in Asian countries, where rice was originally domesticated and cultivated. Recent molecular data based on re-sequencing of several hundred accessions of cultivated and wild rice, indicate that the centre of rice domestication can be traced to the middle area of the Pearl River Basin, in southern China (Wei ; Huang ). From these tropical regions, rice cultivation has enormously expanded, reaching temperate areas in Asia, up to 55°N (Shrestha ). During the 15th century, rice cultivation became established in Europe and Italy is currently the major rice producer. As opposed to tropical Asia, cultivation of rice in temperate regions is constrained by low winter temperatures that restrict the cropping season to late spring and summer, when the photoperiod is long and not inductive. Artificial selection has allowed breeding of rice varieties adapted to higher latitudes, improving germinability and tolerance to low temperatures (Fujino ; Suh ), and reducing sensitivity to photoperiod (Xue ; Fujino ; Koo ). The genetic architecture of flowering in rice depends on a regulatory network controlling expression of two proteins, encoded by HEADING DATE 3a (Hd3a) and RICE FLOWERING LOCUS T 1 (RFT1), orthologs of FLOWERING LOCUS T (FT) of Arabidopsis (Kojima ; Turck ; Tsuji ). Upon perception of favourable photoperiods, Hd3a and RFT1 are expressed in the vasculature of leaves and move to the shoot apical meristem to promote the switch from vegetative to reproductive development (Tamaki ; Komiya ; Komiya ). Expression of Hd3a and RFT1 is induced by HEADING DATE 1 (Hd1), a zinc-finger CCT domain transcription factor, and EARLY HEADING DATE 1 (Ehd1), a B-type response regulator (Yano ; Izawa ; Doi ; Itoh ). Mutations in either Hd1 or Ehd1 cause delayed flowering under SD (Doi ). Conversely, when plants carrying hd1 mutant alleles are grown under long day (LD) conditions flowering is induced earlier compared to the wild type, indicating that Hd1 can either promote or repress flowering, depending on the photoperiod (Yano ; Izawa ; Ishikawa ). The repressive activity of Hd1 can be enhanced by Hd6, which encodes the α subunit of CASEIN KINASE II (CKIIα) (Takahashi ). Defective Hd6 alleles are present in some japonica rice cultivars and reduce the capacity of Hd1 to repress flowering under LD (Takahashi ; Ogiso ; Ebana ; Shrestha ). Several factors play prominent roles as regulators of flowering under LD, primarily acting upstream of Ehd1, to regulate its expression. Among them, GRAIN YIELD, PLANT HEIGHT AND HEADING DATE 7 (Ghd7) and Ghd8/DAYS TO HEADING 8 (DTH8) are potent repressors of Ehd1 expression and strongly contribute to delay flowering (Xue ; Wei ; Yan ). Ghd7 encodes a CCT domain protein that, when mutated, allows rapid flowering also under LD (Xue ). Phosphorylation of Ghd7 is necessary for its repressive activity and is mediated by Hd16/EARLY FLOWERING 1 (EL1), encoding a casein kinase I (CKI) protein (Hori ). Loss-of-function alleles of Hd16 have been isolated from Asian varieties capable of flowering early under LD conditions (Hori ; Kwon ). Ghd8 encodes a homolog of the HEME ACTIVATOR PROTEIN 3 (HAP3) of Arabidopsis. Loss-of-function alleles at this locus also cause early flowering under LD, and have been artificially selected in several varieties to expand rice cultivation to northern areas (Wei ; Fujino ). CONSTANS-LIKE 4 (OsCOL4) encodes a repressor of Ehd1, active under both SD and LD conditions, and no natural genetic variation at this locus has been reported yet (Lee ). Cloning of Hd2 showed that it encodes PSEUDO RESPONSE REGULATOR 37 (PRR37), a repressor of Hd3a expression under LD (Koo ). Loss-of-function alleles at PRR37 promote early flowering at northern latitudes by de-repressing Ehd1 and the florigens (Gao ). These data indicate that the floral activation pathway is strongly repressed under long photoperiods and short day lengths activate flowering in part by relieving such repression. Mining of allelic variants of flowering time regulators in rice cultivars adapted to LD conditions has identified extensive natural genetic variation that has been selected by ancient farmers or breeders, as it conferred a selective advantage over the wild type alleles in temperate areas. The levels of genetic diversity among some flowering time genes in rice varieties that can flower in Europe have been partly explored (Naranjo ). However, it is not clear which level of genetic diversity exists among LD repressors in European varieties, or how it impacts on phenotypic variation across northern latitudes. This study demonstrates that in several European varieties, expression of both Hd3a and RFT1 is de-repressed regardless of photoperiod and causes a strong decrease of sensitivity to day length. Natural genetic variation at LD repressor loci largely explains such behaviour but the impact of loss-of-function alleles varies with latitude. These results indicate that fine tuning of photoperiod sensitivity has been a key strategy allowing expansion of rice cultivation to higher latitudes and provide useful data to geneticists willing to breed novel fast-cycling varieties for temperate environments.

Materials and methods

Plant material

Sixteen temperate japonica varieties cultivated in Italy (referred as the mini-panel in the text) were chosen for detailed genotyping and expression analyses. A set of 247 varieties extracted from the European Rice Germplasm Collection (http://eurigendb.cirad.fr), resulting from the pooling of the working collections of breeders from European public breeding institutions, was used for targeted association mapping (Supplementary Table S1). Two Hd1 mutant lines in the Nipponbare background (NG6019 and NG0430) were obtained from the National Institute of Agrobiological Sciences of Japan (https://tos.nias.affrc.go.jp/; Miyao ). The insertions of Tos17 in NG6019 (hd1-1) and NG0430 (hd1-2) were confirmed to be 577 and 1478bp after the transcription start site, respectively. Genotyping was performed using primers Tos17-For GAGAGCATCATCGGTTACATCTTCTC and hd1-1-Rev CACAGATTCCATCAGCAACAG, or hd1-2-Rev GCCAAATTCCAGAATCCTGA.

Heading dates and PS index measurements

Heading dates were determined under SD (10L/14D) and LD (16L/8D) conditions in Conviron PGR15 growth chambers or in a walk-in growth chamber. Temperature and relative humidity were set at 28ºC/80% during the day and 24ºC/90% during the night, respectively. Seedlings used to measure heading dates under natural LD (NLD) were sown in a cold greenhouse under natural day length conditions on 5 April 2012 and 11 April 2013, and transplanted on 7 May 2012 and 14 May 2013, respectively, in an irrigated field at the University of Milan. About 20 to 30 seedlings per variety were transplanted and heading dates were scored from each individual. Heading dates of the mini-panel under different day lengths were scored at emergence of the first panicle, just after opening of the leaf sheath. The Photoperiod Sensitivity index (PS) was calculated according to the formula: [(heading date under LD − heading date under SD) / heading date under LD]. For the 247 varieties listed in Supplementary Table S1, the phenotypic data of the CT95-37 RESGEN project ‘Constitution, description and dynamic management of rice genetic resources of European vocation’ supported by the European Community, DG VI, were used (Feyt ). The data were collected from experiments conducted between 1996 and 1998 in Arles (France), Alcala del Rio, in Andalusia (Spain), Thessaloniki (Greece) and Salvaterra de Magos in Estremadura (Portugal). Plants were grown under similar conditions in irrigated fields. The tested cultivars were arbitrarily divided into three groups in order to spread the work load over three years as described in Feyt . The experimental design was an augmented design with a common set of seven control varieties present all years in all trials. The control varieties (Ariete, Baldo, Cigalon, Loto, Koral, Senia and Thaibonnet) represented a broad range of flowering date variation from early to late. Dates of 50% flowering were recorded for all accessions and time to 50% flowering computed based on the trial sowing dates. Data were adjusted for the year effect. The Italy_2012 and Italy_2013 datasets were collected at the northernmost European location (Vercelli, Italy) in 2012 and 2013, respectively. The final data used in association mapping analyses are presented in Supplementary Table S1.

DNA extraction, PCR and sequencing

Young leaf pieces were pooled in 2ml tubes containing two clean steel balls. Tubes were rapidly frozen in liquid nitrogen and grinded using a tissue-lyser (Retsch). Genomic DNA from varieties of the mini-panel was extracted using a modified CTAB and chloroform:isoamyl alcohol method (Doyle and Doyle, 1987). The DNA pellet was resuspended in ddH2O and quantified using a NanoPhotometer Pearl (Implen). About 50–150ng of gDNA was used in each PCR reaction in a final volume of 13 µl. Primers were designed in order to sequence the coding regions (CDS) of Hd1, PRR37, Ghd7, Ghd8 and COL4. The components were as follows: 1.3 µl of 10X PCR buffer, 2 µl of 5M Betaine or 1 µl of 30% DMSO, 0.2 µl of 10mM dNTPs, 0.25 µl of each primer (1 μg/μl, diluted 1:10), 0.2 µl Taq polymerase, and ddH2O to volume. For the amplification of fragments with high GC content, LA Taq and GC Buffers (Takara) were used following manufacturer’s instructions. Amplification reactions were run for 40 cycles. The PCR products were incubated with Exonuclease I (Thermo Scientific) and Fast Alkaline Phosphatase (Thermo Scientific) for 15min at 37°C. Enzymes were heat-deactivated for 15min at 85°C. Purified fragments were sequenced using specific primers.

Candidate gene genotyping

Seedlings were grown in a greenhouse for two weeks. The aerial part was collected and grinded using steel balls in 2ml tubes after freezing with liquid nitrogen. Genomic DNA from all varieties was extracted using the Edwards method (Edwards ). A total of 17 different non-functional alleles in five different genes were genotyped using markers listed in Supplementary Table S2: six for hd1, three for prr37, three for ghd7, three for ghd8 and two for el1 (Supplementary Table S1). Primers for dCAPS design were obtained using dCAPS Finder 2.0 (http://helix.wustl.edu/dcaps/dcaps.html) allowing up to two mismatches. PCRs were conducted as described before, and digestions with restriction enzymes were carried out at 37°C overnight. The PCR products were separated by agarose gel electrophoresis, and visualized using a Fluorchem imaging system (Alpha Innotech) with Alpha Ease FC software. In association analyses, all loss-of-function alleles of a given gene were grouped into a single non-functional type (NF) (Supplementary Table S1).

Quantification of gene expression and correlation between gene expression and heading dates

To quantify gene expression from developmental time courses, leaves were sampled at the indicated day, two hours after lights-on (ZT2). For diurnal time courses, leaves were sampled every three hours from three-week-old plants grown under under SD and six-week-old plants grown under LD. Leaf samples from plants grown under field conditions were collected during floral induction (from the middle of May until the end of July) every two weeks, two hours after dawn. Gene expression data from field-grown plants were collected in 2012 and 2013 with similar results. Data from 2012 are presented. Leaves were collected from at least three independent plants for each RNA preparation. Total RNA was isolated using either TRI reagent (Sigma-Aldrich) or the Spectrum Plant Total RNA Kit (Sigma-Aldrich) following manufacturer’s instructions. Total RNA was treated with DNase I using the TURBO DNase kit (Life Technologies), and precipitated with 0.1 volumes of sodium acetate and 2.5 volumes of 100% ethanol. The RNA pellet was washed with 75% ethanol and resuspended in ddH2O. RNA was quantified using a NanoPhotometer Pearl (Implen). 2 µg of total RNA were retrotranscribed using SuperScript II Reverse Transcriptase (Invitrogen) with oligo-dT and resuspended in a final volume of 140 μl of cDNA. Quantification of gene expression was carried out in a final volume of 10 µl using a Mastercycler Realplex2 (Eppendorf). qPCR reactions were carried out using 5 μl of 2X Maxima SYBR Green qPCR Master Mix (Thermo Scientific), 0.25 μl of each primer (1 μg/μl, diluted 1:10), 1.5 μl of ddH2O, and 3 μl of cDNA template. Primers used to quantify the mRNA levels of Ubiquitin, Hd3a, RFT1, Hd1, Ehd1, Ghd7 and PRR37 are listed in Supplementary Table S5. Correlations between heading date (days) and gene expression values of Hd3a/Ubq and RFT1/Ubq (log of relative gene expression) were determined by calculating the Pearson’s correlation coefficient (R2) using Microsoft Office Excel 2010.

Association mapping

All accessions had been previously genotyped with SNPs spaced of at least 0.4Mb in the genome (Courtois ). A set of 85 SNPs polymorphic in the studied accession set, hereafter called ‘neutral SNP set’, was retained for further analysis. All analyses were conducted using Tassel v.4.0 (Bradbury ). A Principal Component Analysis was conducted on the neutral SNP set using a correlation matrix. Three axes together explaining 40% of the variation were retained. The matrix constituted of the loadings of the accessions on these three axes was used to control population structure. A kinship matrix was computed using the same dataset to capture more complex familial relationships. Several models were compared to test the significance of each SNP × trait association: a simple linear model without any control of population structure (GLM0), a linear model with control of structure (GLM1), a mixed model with control of kinship (MLM1) and a mixed model involving structure and kinship (MLM2). Only alleles with a frequency above 5% were used in the analyses. Taking into account the number of genes and polymorphisms within genes tested, a threshold of 0.005 was used to declare a test significant.

Results

Rice varieties adapted to Europe show reduced sensitivity to photoperiod

Artificial selection has expanded rice cultivation from tropical Asia to higher latitudes in Europe, partly by influencing the capacity of plants to flower under long days. To address the molecular mechanisms involved, a working panel composed of 16 temperate japonica varieties cultivated in Italy (mini-panel) was selected to be representative of the diversity of heading dates observed under natural field conditions (Fig. 1). The mini-panel and Nipponbare were grown under constant LD (16 hours light) and SD (10 hours light) in growth chambers, and under natural long day conditions (NLD) in Milan (~45°N). All varieties flowered earlier under SD conditions compared to LD conditions, and the response to distinct photoperiods showed large variation (Fig. 1A). Most varieties flowered at similar times under NLD and LD, indicating that photoperiodic flowering was similarly promoted both under constant and varying day lengths. Flowering of Thaibonnet, Balilla and Nipponbare was delayed under LD compared to NLD, indicating that these varieties could discriminate between different long photoperiods and that continuous LD of 16h caused stronger floral repression. Based on heading dates under LD and SD, we calculated a photoperiod sensitivity index (PS). All varieties tested showed reduced PS compared to Nipponbare (Fig. 1B), and some varieties, including Augusto and Sant’Andrea, were almost completely insensitive and flowered at the same time regardless of day length (Fig. 1A). These data indicate that flowering of mini-panel varieties can be promoted by SD but not repressed under LD and NLD compared to Nipponbare. Their capacity to discriminate between different day lengths is therefore impaired.
Fig. 1.

Heading dates and photoperiod sensitivity of 16 temperate japonica varieties cultivated in Italy and Nipponbare. (A) Days from germination to heading were scored under natural long days (NLD) in Milan, artificial long days (LD) and artificial short days (SD). (B) Photoperiod sensitivity index of the same varieties as in (A).

Heading dates and photoperiod sensitivity of 16 temperate japonica varieties cultivated in Italy and Nipponbare. (A) Days from germination to heading were scored under natural long days (NLD) in Milan, artificial long days (LD) and artificial short days (SD). (B) Photoperiod sensitivity index of the same varieties as in (A).

Accessions belonging to the mini-panel carry non-functional alleles of long day floral repressor genes

Mutations in floral repressors have been associated to northern expansion of rice cultivation (Xue ; Fujino ; Hori ; Koo ; Kwon ; Shrestha ). The type and frequency of loss-of-function mutations was assessed at seven loci, encoding genes repressing flowering most effectively under LD and including Hd1, PRR37, Ghd7, Ghd8, OsCOL4, Hd16/EL1 and Hd6/CKIIα (Yano ; Takahashi ; Xue ; Lee ; Yan ; Hori ; Koo ). The DNA sequence of all repressors was determined, including the CDS and some introns. However, the upstream regulatory regions were not sequenced, as polymorphisms in the promoters would be difficult to associate to loss-of-function alleles. Sequence data were compared to Nipponbare that bears functional alleles at all repressor loci with the exception of Hd6 that bears a premature stop codon, resulting in a truncated non-functional protein (Takahashi ). Several allelic variants were identified (Table 1, Supplementary Fig. S1). Ten out of 16 varieties carry at least one loss-of-function allele at Hd1, Ghd7 or Ghd8. Seven different alleles at the Hd1 locus were detected. The 2 bp-deletion observed in Fragrance, Eolo, Thaibonnet, Gladio, Panda and Augusto (Hd1-V, Hd1-VI), and the 43bp-deletion observed in Lido and Selenio (Hd1-II) were previously isolated from the cultivars Kasalath and HS66 respectively, and were associated to loss-of-function alleles (Yano ). Balilla bears the same Hd1 allele of Ginbouzu which was suggested to encode a stronger LD repressor allele than Nipponbare (Yano ). Four PRR37 alleles were detected but none of them could be clearly associated to a loss-of-function variant (Supplementary Fig. S1). Four Ghd7 alleles were identified, one of which showed a deletion of the locus and was previously described as Ghd7-0 in early flowering rice varieties (Xue ) (Supplementary Fig. S1). The SNP at position 618 converts tyrosine into a Stop codon (Ghd7-I, Supplementary Fig. S1) and is reported here for the first time. The mutation is located in the CCT motif that is a critical functional domain for this class of transcription factors. The Ghd8 locus was represented by four different alleles (Supplementary Fig. S1), two of which (Ghd8-II and III) were described as loss-of-function and associated to loss of photoperiod sensitivity (Wei ). Three genotypes were detected sequencing the CDS of COL4 (Lee ), none of which was likely to alter the function of the gene. Genotyping of Hd16 for two loss-of-function mutations previously identified in Japanese varieties (Type 2 and Type 3) (Kwon ) showed that no such variants were present within the mini-panel. Mutations in Hd16 seem to have arisen locally and are not widely spread (Kwon ). Similarly, no mutations in Hd6 were identified and all varieties carried a functional allele identical to that of Kasalath (Takahashi ).
Table 1.

Genotypes of repressor genes in Italian cultivars comprised in the mini-panel

Variety Hd1 a PRR37 Ghd7 Ghd8 COL4 Hd6 EL1b
Sant’AndreaIIIINipIINipKaswt
AugustoVINip0IINipKaswt
CarnaroliVIIINipNipNipKaswt
PandaVIII0IIKaswt
VolanoIVINipNipNipKaswt
GladioVIIINipIIIIKaswt
FragranceVIIIIIIIIIIIKaswt
LidoIIINipNipNipKaswt
RomaIVINipNipNipKaswt
NemboVIIINipNipNipKaswt
Vialone NanoVIIINipNipNipKaswt
EoloVIIINipIIKaswt
SelenioIIINipNipNipKaswt
LotoIVINipNipNipKaswt
ThaibonnetVIINipNipIIKaswt
BalillaIINipIIIKaswt
NipponbareNipNipNipNipNipNipwt

a Shaded boxes indicate loss-of-function alleles. Roman numbers and 0 indicate allelic variants according to Supplementary Fig. S1. Nip and Kas indicate the alleles of Nipponbare and Kasalath, respectively.

b The absence of type 2 and type 3 mutations in EL1 is indicated as wt.

Genotypes of repressor genes in Italian cultivars comprised in the mini-panel a Shaded boxes indicate loss-of-function alleles. Roman numbers and 0 indicate allelic variants according to Supplementary Fig. S1. Nip and Kas indicate the alleles of Nipponbare and Kasalath, respectively. b The absence of type 2 and type 3 mutations in EL1 is indicated as wt.

Expression of Hd3a and RFT1 is not repressed under long or short days in Italian varieties

Induction of Hd3a and RFT1 is correlated to heading dates under controlled SD and NLD (Takahashi ; Naranjo ; Ogiso-Tanaka ). However, their seasonal expression dynamics have not been extensively determined for varieties bearing non-functional allelic variants of LD floral repressors, nor it is clear how accumulation of such mutations influences the flowering behaviour of varieties adapted to northern latitudes. The expression levels of Hd3a and RFT1 were quantified in plants grown under field conditions in Milan, between May and July, when flowering is induced. Expression of Hd3a and RFT1 rapidly decreased in Nipponbare as day length became longer (Fig. 2). Conversely, most Italian varieties showed induction of Hd3a and RFT1 expression, and peak expression was observed 96 days after sowing (DAS) in most of them. Varieties bearing wild type alleles of Hd1, Ghd7 and Ghd8 had higher levels of Hd3a and RFT1 mRNA compared to Nipponbare, indicating that de-repression of florigens is not exclusively caused by mutations in these regulators (Fig. 2B, C).
Fig. 2.

Seasonal patterns of Hd3a and RFT1 expression in temperate japonica varieties cultivated in Italy and Nipponbare under natural field conditions at high latitudes (45°N). Expression dynamics of Ehd1 (A, E, H), Hd3a (B, F, I), RFT1 (C, G, J) and Hd1 (D) in varieties bearing functional alleles of LD repressors (left), a single non-functional allele (center) or multiple combinations of LD floral repressors. The quantification of gene expression from Nipponbare was included as control and represented in all graphs to facilitate comparisons (black lines). All samples were collected 2h after dawn and values were normalized using Ubiquitin (Ubq) expression. The sampling period ranged from 15 May (40 DAS) to 24 September (110 DAS) during 2012. Biological replicates from 2013 gave similar results. Seasonal variation of day length is indicated with a dashed line and day length at sampling is indicated on top of the graphs. The longest day length during the sampling period was 15:41.

Seasonal patterns of Hd3a and RFT1 expression in temperate japonica varieties cultivated in Italy and Nipponbare under natural field conditions at high latitudes (45°N). Expression dynamics of Ehd1 (A, E, H), Hd3a (B, F, I), RFT1 (C, G, J) and Hd1 (D) in varieties bearing functional alleles of LD repressors (left), a single non-functional allele (center) or multiple combinations of LD floral repressors. The quantification of gene expression from Nipponbare was included as control and represented in all graphs to facilitate comparisons (black lines). All samples were collected 2h after dawn and values were normalized using Ubiquitin (Ubq) expression. The sampling period ranged from 15 May (40 DAS) to 24 September (110 DAS) during 2012. Biological replicates from 2013 gave similar results. Seasonal variation of day length is indicated with a dashed line and day length at sampling is indicated on top of the graphs. The longest day length during the sampling period was 15:41. Positive correlations between the amount of Hd3a and RFT1 mRNA and heading dates of the mini-panel grown under NLD were observed, and the highest correlations were determined for RFT1 at 68 DAS (Table 2). These data indicate that Hd3a and RFT1 are not repressed in varieties of the mini-panel and expression of both genes likely contributes to flowering under NLD.
Table 2.

Correlation between Hd3a and RFT1 gene expression levels and heading date

NLDSD
40DAS54DAS68DAS82DAS96DAS110DAS33DAS47DAS
r2 Hd3a/heading0.00030.04930.28790.18710.28620.14720.0144 0.6134
r2 RFT1/heading0.00310.1973 0.5686 0.3838 0.27570.0167 0.4310 0.7158

NLD: natural long days; SD: short days; DAS: days after sowing. Highest correlations are indicated in italic.

Correlation between Hd3a and RFT1 gene expression levels and heading date NLD: natural long days; SD: short days; DAS: days after sowing. Highest correlations are indicated in italic. It has been previously demonstrated that under SD conditions RFT1 expression was lower compared to Hd3a in wild type plants. Further reduction of its expression by RNAi caused no delay of flowering, indicating that RFT1 is not contributing to flowering promotion under SD (Komiya ). In Italian varieties, the correlation between heading dates and RFT1 expression was higher than with Hd3a expression at two time points under continuous SD (Table 2). Expression of upstream regulators of the florigens was poorly correlated to heading dates (Supplementary Table S4). Therefore, the diurnal mRNA expression profiles of Hd3a and RFT1 were determined under both LD and SD. In addition to Nipponbare, which shows a high PS index, three Italian varieties with a low PS index were selected for this experiment, regardless of genotype. Hd3a was induced in all varieties to levels similar to those observed in Nipponbare (Fig. 3A). Additionally, high levels of RFT1 expression in the three Italian varieties (Fig. 3B) were observed, indicating that RFT1 transcription was strongly de-repressed under SD and exceeded that of Nipponbare. Plants grown under LD showed induction of Hd3a and RFT1 transcription (Fig. 3C, D). The overall expression levels of RFT1 were higher under SD than under LD (Fig. 3B, D). In Italian varieties, de-repression of Hd3a and RFT1 transcription occurs under both long and short photoperiods in the morning, differently from the normal day length-induced peak in the evening in Nipponbare. Induction of RFT1 expression is not only a consequence of activation by the LD pathway but rather the result of its transcriptional de-repression in the background of varieties adapted to northern latitudes.
Fig. 3.

Diurnal patterns of Hd3a and RFT1 mRNA expression in Italian varieties under SD and LD. (A) Diurnal quantification of Hd3a mRNA expression under SD. (B) Diurnal quantification of RFT1 mRNA expression under SD. (C) Diurnal quantification of Hd3a mRNA expression under LD. (D) Diurnal quantification of RFT1 mRNA expression under LD. Quantification of expression levels was determined in Volano, Sant’Andrea and Augusto compared to Nipponbare. Bars on top indicate day (white) or night (black). ZT indicates hours from dawn (Zeitgeber). Ubiquitin (Ubq) was used to normalize gene expression levels.

Diurnal patterns of Hd3a and RFT1 mRNA expression in Italian varieties under SD and LD. (A) Diurnal quantification of Hd3a mRNA expression under SD. (B) Diurnal quantification of RFT1 mRNA expression under SD. (C) Diurnal quantification of Hd3a mRNA expression under LD. (D) Diurnal quantification of RFT1 mRNA expression under LD. Quantification of expression levels was determined in Volano, Sant’Andrea and Augusto compared to Nipponbare. Bars on top indicate day (white) or night (black). ZT indicates hours from dawn (Zeitgeber). Ubiquitin (Ubq) was used to normalize gene expression levels.

Hd1 represses Ehd1 under natural long days

Several varieties could flower under NLD despite bearing wild type alleles of all LD floral repressor genes analysed, indicating the existence of additional factors that contribute to reduce the sensitivity to photoperiod (Fig. 2). Whether these factors could act through upstream transcriptional regulators of Hd3a and RFT1 was tested by quantifying the expression levels of Ehd1 and Hd1. Expression of Ehd1 was transiently induced, similarly to Hd3a and RFT1 (Fig. 2A), and in many varieties its expression was high regardless of the presence of Ghd7 and/or Ghd8 wild type alleles (Fig. 2A, E, H). Quantification of Hd1 in the same varieties showed that its expression was strongly reduced and often completely abolished compared to Nipponbare (Fig. 2D). Expression of other LD repressors was not reduced (Fig. S2), supporting the idea that additional factors influence flowering and PS by repressing Hd1 expression and by promoting Ehd1 expression. Whether increased expression of Ehd1 mRNA was caused by reduced expression of Hd1 was tested using hd1 mutant alleles isolated from Nipponbare. Two loss-of-function mutants in which Tos17 retrotransposons were inserted in the first and second exon, respectively, were grown under natural long days in Milan (Fig. 4A). Both mutant alleles showed accelerated heading compared to Nipponbare (Fig. 4B) and transiently expressed Hd3a and RFT1 in leaves (Fig. 4E, F). The expression levels of Ehd1 were also higher compared to those of wild type plants (Fig. 4D), indicating that Hd1 repressed Ehd1 under NLD and that such repression was sufficient to prevent flowering at higher latitudes.
Fig. 4.

Hd1 represses Ehd1 under long days in the field. (A) Diagram of the Hd1 locus indicating the position of Tos17 retrotransposons in hd1-1 and hd1-2 alleles. Black and white boxes indicate exons and UTRs, respectively. (B) Heading dates of hd1-1 and hd1-2 mutants grown under NLD and compared to Nipponbare (wt). Quantification of Hd1 (C), Ehd1 (D), Hd3a (E) and RFT1 (F) mRNA levels in hd1-1, hd1-2 and Nipponbare in seasonal time courses. Samples were collected at the indicated days after sowing, two hours after dawn. Dashed lines indicate the dynamics of day length during the sampling period.

Hd1 represses Ehd1 under long days in the field. (A) Diagram of the Hd1 locus indicating the position of Tos17 retrotransposons in hd1-1 and hd1-2 alleles. Black and white boxes indicate exons and UTRs, respectively. (B) Heading dates of hd1-1 and hd1-2 mutants grown under NLD and compared to Nipponbare (wt). Quantification of Hd1 (C), Ehd1 (D), Hd3a (E) and RFT1 (F) mRNA levels in hd1-1, hd1-2 and Nipponbare in seasonal time courses. Samples were collected at the indicated days after sowing, two hours after dawn. Dashed lines indicate the dynamics of day length during the sampling period.

Single mutations of LD repressor genes are sufficient to promote flowering at higher latitudes

Combinations of hd1, ghd7 and ghd8 mutations seemed to contribute to higher expression of Hd3a under NLD, as shown in the group of varieties bearing several non-functional alleles (Fig. 2I) compared to those bearing a single non-functional allele (Fig. 2F) or only functional alleles (Fig. 2B). Nipponbare (Hd1, Ghd7, Ghd8) and Augusto (hd1, ghd7, ghd8) showed different heading dates under SD, LD and NLD, opposing patterns of Hd3a and RFT1 expression under NLD and very different PS (Fig. 1 and Fig. 2I, J). To assess if pyramiding of hd1, ghd7 and ghd8 mutations is necessary to promote flowering under LD, Augusto and Nipponbare were crossed, F2 individuals bearing all combinations of hd1, ghd7 and ghd8 mutations were selected and heading dates of F3 families grown under constant LD were scored. Plants bearing only functional LD repressor genes recapitulated the late flowering phenotype of Nipponbare and did not express Hd3a or RFT1, whereas plants bearing at least one mutant repressor flowered earlier (Fig. 5A) and expressed Hd3a and RFT1 at higher levels (Fig. 5B, C). The Hd6 mutant allele from Nipponbare segregated in F3 families, but it did not affect heading dates or gene expression levels (data not shown). The homozygous mutant ghd8 from Augusto had the strongest effect to increase Hd3a and RFT1 expression, either in combination with ghd7 or alone (Fig. 5B, C). Taken together, these data suggest that single mutations in Hd1, Ghd7 or Ghd8 or reduction of Hd1 expression are sufficient to de-repress Hd3a and RFT1 expression and to promote flowering at higher latitudes.
Fig. 5.

Single mutations in Hd1, Ghd7 or Ghd8 are sufficient to accelerate flowering under long days. (A) Heading dates of F3 plants obtained from a cross between Augusto (Aug) and Nipponbare (Nip) grown under LD. Numbers on top of the columns indicate the number of plants scored. Quantification of Hd3a (B) and RFT1 (C) mRNA expression in the same plants as in (A). F3 plants bearing functional alleles for the three repressors and Nipponbare plants had not flowered after 240 days. Samples were collected 66 days after sowing and Ubiquitin (Ubq) was used to normalize gene expression levels.

Single mutations in Hd1, Ghd7 or Ghd8 are sufficient to accelerate flowering under long days. (A) Heading dates of F3 plants obtained from a cross between Augusto (Aug) and Nipponbare (Nip) grown under LD. Numbers on top of the columns indicate the number of plants scored. Quantification of Hd3a (B) and RFT1 (C) mRNA expression in the same plants as in (A). F3 plants bearing functional alleles for the three repressors and Nipponbare plants had not flowered after 240 days. Samples were collected 66 days after sowing and Ubiquitin (Ubq) was used to normalize gene expression levels.

Loss-of-function alleles of Ghd8, Ghd7 and PRR37 but not of Hd1 are associated with early heading at northernmost sites in Europe

To assess how long day repressors impact on heading dates across a latitudinal cline at higher latitudes, a germplasm collection comprising 247 varieties cultivated in Europe was used (Ahmadi ; http://eurigendb.cirad.fr). The frequency of hd1, prr37, ghd7, ghd8 and el1 mutant alleles was determined for all varieties (Supplementary Tables S1 and S2). Of these, 145 (58.7%) carried at least one non-functional allele (Fig. 6A), a result very similar to that observed using the mini-panel. Non-functional alleles of Hd1 were the most frequent followed by ghd8, ghd7, prr37 and el1 (Fig. 6A). Extensive pyramiding of loss-of-function mutant alleles was observed, including a variety (Timich 108 from Romania) bearing four mutations (hd1, ghd8, prr37, el1; Fig. 6A, Supplementary Table S1).
Fig. 6.

Targeted association mapping in a European rice collection. (A) Frequency of genotypes determined at floral repressor loci in a European rice collection comprising 247 accessions. (B) p-values of association between genotypes and time to flowering determined at five locations in Europe. Asterisks indicate significant associations (* indicates p≤0.005, ** indicate p≤0.0005). Graphs on the right within each box indicate the mean effect of the mutant allele on days to heading as determined by allele substitution tests.

Targeted association mapping in a European rice collection. (A) Frequency of genotypes determined at floral repressor loci in a European rice collection comprising 247 accessions. (B) p-values of association between genotypes and time to flowering determined at five locations in Europe. Asterisks indicate significant associations (* indicates p≤0.005, ** indicate p≤0.0005). Graphs on the right within each box indicate the mean effect of the mutant allele on days to heading as determined by allele substitution tests. Selected varieties of the European collection were grown across a latitudinal cline at five locations in Europe, comprising Vercelli (Italy, 45.3°N), Arles (France, 43.6°N), Thessaloniki (Greece, 40.6°N), Salvaterra de Magos (Portugal, 39°N) and Alcala del Rio (Spain, 37.5°N). Flowering time data were recorded and made publically available at http://tropgenedb.cirad.fr and in Supplementary Table S1 (Feyt ). For each gene, all loss-of-function alleles were grouped into a single NF and genotypic data were used for targeted association analysis. Results of association statistics are presented in Fig. 6B, following a MLM2. The p-values of association calculated according to other models are reported in Supplementary Table S3. The mean effect of allelic substitutions between wild type and mutant alleles on days to heading were calculated as the phenotypic difference between the two homozygotes, by setting to 0 the effect of the functional allele and computing the effect of the non-functional allele. Depending on the location, different alleles were significantly associated with early heading (Fig. 6B). At the northernmost location, strong associations were detected for ghd8, ghd7 and prr37. Only ghd7 mutations were associated to early heading in Arles. No association was detected between hd1 loss-of-function alleles and early heading at any location. A latitudinal gradient of significance was observed when considering the p-values of association for ghd7 and ghd8 (Supplementary Table S3). Therefore, loss-of-function alleles of flowering time genes are differentially affecting cycle duration, depending on the latitude and mutant alleles of ghd7 and ghd8 are the most effective to accelerate flowering at the northern limits of rice cultivation in Europe, but their effect quickly decreases with latitude.

Discussion

Rice is largely cultivated in Europe and has a major impact on the economy of several regions. Its adaptation to higher latitudes has required the targeted manipulation of several genes. This study provides a comprehensive characterization of the natural genetic variation of loci encoding LD floral repressor genes and shows how selection of non-functional alleles in European germplasm could be part of the mechanism that allowed rice cultivation at northern sites in Europe. These data can be the basis to design varieties better adapted to such environments. Additionally, the study of Hd1 alleles showing reduced or null expression has allowed for better definition of a regulatory node in the LD pathway, suggesting that Hd1 can repress Ehd1 to reduce expression of the florigens under LD.

Genetic variation of Hd3a and RFT1 expression contributes to identification of the existence of novel factors regulating flowering

Flowering of rice is promoted upon expression of Hd3a and RFT1. These genes are physically located very close to each other and are likely the product of chromosomal duplication. Yet, their function has diversified during evolution and mutant analysis has helped elucidate the role of each gene under different photoperiods. Plants in which Hd3a expression is reduced by RNAi delay flowering under SD, but flower normally under LD. Conversely, reduction of RFT1 mRNA expression delays flowering under LD, but not under SD (Komiya , 2009). Transgenic plants in which both genes are down-regulated produce a strong additive effect and do not flower, clearly indicating that they have a fundamental role for flowering in rice (Komiya ). These results account for the little functional genetic variation that has been detected at loci encoding Hd3a and RFT1 in cultivated varieties (Takahashi ; Ogiso-Tanaka ; Naranjo ). Still, genetic diversity of RFT1 is higher than that of Hd3a and functional polymorphisms at the RFT1 locus have been recently identified that disrupt protein function and lead to delayed flowering under LD (Hagiwara ; Ogiso-Tanaka ). Also several species from the genus Oryza bear mutations in RFT1 that lead to non-functional proteins (Ogiso-Tanaka ). These data indicate that RFT1 might not be required under specific environmental conditions, particularly at tropical latitudes where Hd3a is the major factor promoting flowering. For these reasons, genetic variation at Hd3a or RFT1 loci was not assessed in this study, but given the importance of their expression levels to regulate floral induction, detailed expression analyses were performed and expression curves were designed for several varieties. The results indicate that varieties adapted to grow in Europe induce both Hd3a and RFT1 under NLD and such induction correlates with flowering. However, variation in expression patterns could not be exclusively correlated to genotypes at known repressor loci, indicating that the contribution of other regulators, likely including transcriptional activators or as yet unknown genes, has to be taken into consideration. Genetic evidence indicated that reducing Hd1 expression is sufficient to adapt rice flowering to higher latitudes because Hd1 could repress Ehd1 under NLD and consequently, Hd3a and RFT1. This finding highlights the central role of Ehd1 in the LD regulatory network, where repression from Ghd7, Ghd8 and Hd1 converge. It further suggests the existence of Hd1 repressors that might be useful tools to breed varieties adapted to long photoperiods, bypassing the need to introduce mutations in Hd1 or other repressors. European varieties could be useful genetic tools to identify such novel regulators. Seasonal induction of Hd3a and RFT1 was transient in all varieties tested. Induction started between 54 and 68 DAS, reached a maximum 96 DAS in most varieties and then rapidly decreased. This pattern seems to be common to other varieties and locations (Ogiso-Tanaka ), and suggests that maintenance of high levels of Hd3a and RFT1 expression in leaves is not required to sustain the flowering process. Upon commitment of shoot apical meristems to reproductive development, Hd3a and RFT1 expression is likely not necessary any longer. Transcriptional dynamics were largely shared by both Hd3a and RFT1, suggesting a common mechanism for their temporary transcriptional induction in varieties adapted to LD. The molecular nature of this system is unknown but one possibility is that an epigenetic mechanism might temporarily allow access of RFT1 and Hd3a chromatin to transcriptional activators. Given the close proximity of these two genes, such mechanism might be operating on both of them. Under NLD, Hd3a and RFT1 expression quickly dropped in Nipponbare, a variety strongly sensitive to day length, but under developmental or diurnal time courses under SD their levels were high and promoted flowering. Correlation of heading dates with RFT1 expression levels was higher than with Hd3a and peak levels of RFT1 transcription in several Italian varieties were higher than those of Nipponbare (peak expression of Hd3a and RFT1 showed a shift of up to six hours compared to Nipponbare, a behaviour that we cannot currently explain but that could be related to defects in diurnal time measurement). These results indicate that RFT1 can be strongly activated also under SD conditions, depending on the genetic background and demonstrate that regulation of its transcription can be very adaptable.

Mutations in Ghd7, Ghd8 and PRR37 are strongly associated to early heading varieties at northern latitudes but not at southern latitudes in Europe

Association mapping between time to flowering and targeted loci across a latitudinal cline in Europe allowed assigning a relative weight to LD repressors. Ghd8, Ghd7 and PRR37 were detected as major repressors of flowering at the northernmost limits of rice cultivation in Europe, but not at southern locations. These genes have been useful tools for breeders to reduce cycle length and varieties bearing the mutant alleles could spread closer to the northern limits of rice cultivation in Asia (Fujino and Sekiguchi, 2008; Xue ; Wei ; Ebana ; Fujino ; Gao ). However, whereas strong associations between genotypes and heading were detected for Ghd7, Ghd8 and PRR37 at the northernmost location in Europe, the effect of ghd8 and prr37 was milder in France, where only ghd7 was statistically associated to fast-cycling accessions. At even southern locations, including Greece, Portugal and Spain, no statistically significant association could be detected. These data suggest that the photoperiodic network can finely tune flowering responses and has the capacity to detect small changes in day length. Since seasonal variation of photoperiod is different depending on latitude, it is likely sufficient to modulate flowering to the extent that loss of function alleles that are crucial at ~45°N to promote flowering become less relevant at 40°N or lower latitudes. It is however important to note that statistical thresholds do not abolish the biological value of some alleles. For example, despite not being statistically significant according to the models used in this study, ghd7 mutant alleles should be considered useful tools to accelerate flowering in Greece. High natural genetic variation is associated to the Hd1 locus and contributed to diversification of flowering time in many varieties, including those adapted to northern regions (Yano ; Fujino ; Takahashi ; Fujino ; Zhao ; Naranjo ). Hd1 represses flowering under LD, and mutant alleles confer an advantage to varieties adapted to short-growing seasons. Several European varieties bear mutant alleles of hd1 and genetic evidence also showed that such mutations can increase Ehd1 transcription and promote flowering. However, targeted association mapping did not detect any significant association between early heading and mutant alleles at this locus. This is likely the result of population structure of the European collection used in this study (Courtois ). European varieties are mostly temperate japonica accessions that have been further distinguished into four sub-groups, American, European 1 and 2, and Admixed, based on SSR and SNP markers (Courtois ). The American group comprises non-European accessions that contributed hd1 mutant alleles to Europe. Accessions from this group, which have tropical ancestors in their background, are also consistently later than accessions from the other groups (Courtois ). When associations with hd1 mutants were corrected for population structure and kinship, they were not anymore significant. Therefore, the full statistical significance and impact of Hd1 alleles in Europe remains to be determined. This specific case highlights some limitations of association analysis, when population structure is strongly correlated with phenotypic differences.

Mutant selection as a tool to expand the cultivated area of rice

Field data and analysis of F3 families indicated that single mutations in hd1, ghd7 or ghd8 are sufficient to accelerate flowering under NLD or LD, even if not sufficient to produce very fast cycling accessions. Complex genotypes where up to four repressors were mutated in a single variety were observed when mining European germplasm. Yet, the significance of pyramiding of floral repressors remains to be determined. Varieties bearing combinations of ppr37 and ghd7 mutant alleles have been reported as very early flowering and photoperiod insensitive, possibly indicating that targeting these regulators is sufficient to generate genotypes suitable for cultivation at very high latitudes (Ebana ; Kim ; Koo ). Consistently, among European varieties, Auzgusta and Russo1 (ghd7 prr37) were among the earliest flowering accessions when grown in Vercelli. However, ghd7 and prr37 mutant alleles seem to be underrepresented among European rice varieties, at least compared to hd1 and ghd8 mutant alleles. Increasing their frequency, and particularly that of prr37, might facilitate reduction of cycle duration or allow moving cultivation of specific varieties to even northern latitudes.

Supplementary Material

Supplementary data can be found at JXB online. Supplementary Fig. S1. Natural genetic variation of repressor genes belonging to the mini-panel compared to Nipponbare. Supplementary Fig. S2. Expression dynamics of Ghd7 (A) and PRR37 (B) in Italian varieties grown under NLD. All varieties bear functional alleles of floral repressor genes. Supplementary Table S1. Allelic variants of Hd1, PRR37, Ghd7, Ghd8 and EL1 and heading dates of 247 European rice varieties grown at 5 locations in Europe. Supplementary Table S2. Strategies and primers used for genotyping mutant alleles of LD repressor genes. Supplementary Table S3. p-values obtained from targeted association mapping analyses using different statistical models. NF: non-functional; GLM: General Linear Model, MLM: Mixed Linear Model. Supplementary Table S4. Correlation between Ehd1 and OsMADS51 gene expression levels and heading dates of Italian varieties grown under continuous SD. Supplementary Table S5. Primers used for quantification of mRNA expression.
  42 in total

1.  Hd1, a major photoperiod sensitivity quantitative trait locus in rice, is closely related to the Arabidopsis flowering time gene CONSTANS.

Authors:  M Yano; Y Katayose; M Ashikari; U Yamanouchi; L Monna; T Fuse; T Baba; K Yamamoto; Y Umehara; Y Nagamura; T Sasaki
Journal:  Plant Cell       Date:  2000-12       Impact factor: 11.277

2.  Hd6, a rice quantitative trait locus involved in photoperiod sensitivity, encodes the alpha subunit of protein kinase CK2.

Authors:  Y Takahashi; A Shomura; T Sasaki; M Yano
Journal:  Proc Natl Acad Sci U S A       Date:  2001-06-19       Impact factor: 11.205

3.  Target site specificity of the Tos17 retrotransposon shows a preference for insertion within genes and against insertion in retrotransposon-rich regions of the genome.

Authors:  Akio Miyao; Katsuyuki Tanaka; Kazumasa Murata; Hiromichi Sawaki; Shin Takeda; Kiyomi Abe; Yoriko Shinozuka; Katsura Onosato; Hirohiko Hirochika
Journal:  Plant Cell       Date:  2003-08       Impact factor: 11.277

4.  Hd3a, a rice ortholog of the Arabidopsis FT gene, promotes transition to flowering downstream of Hd1 under short-day conditions.

Authors:  Shoko Kojima; Yuji Takahashi; Yasushi Kobayashi; Lisa Monna; Takuji Sasaki; Takashi Araki; Masahiro Yano
Journal:  Plant Cell Physiol       Date:  2002-10       Impact factor: 4.927

Review 5.  Florigen in rice: complex gene network for florigen transcription, florigen activation complex, and multiple functions.

Authors:  Hiroyuki Tsuji; Ken-ichiro Taoka; Ko Shimamoto
Journal:  Curr Opin Plant Biol       Date:  2013-02-28       Impact factor: 7.834

6.  Targeted association analysis identified japonica rice varieties achieving Na(+)/K (+) homeostasis without the allelic make-up of the salt tolerant indica variety Nona Bokra.

Authors:  N Ahmadi; S Negrão; D Katsantonis; J Frouin; J Ploux; P Letourmy; G Droc; P Babo; H Trindade; G Bruschi; R Greco; M M Oliveira; P Piffanelli; B Courtois
Journal:  Theor Appl Genet       Date:  2011-06-29       Impact factor: 5.699

7.  Molecular control of flowering in response to day length in rice.

Authors:  Vittoria Brambilla; Fabio Fornara
Journal:  J Integr Plant Biol       Date:  2013-03-18       Impact factor: 7.061

8.  Phytochrome mediates the external light signal to repress FT orthologs in photoperiodic flowering of rice.

Authors:  Takeshi Izawa; Tetsuo Oikawa; Nobuko Sugiyama; Takatoshi Tanisaka; Masahiro Yano; Ko Shimamoto
Journal:  Genes Dev       Date:  2002-08-01       Impact factor: 11.361

9.  Origin of Oryza sativa in China inferred by nucleotide polymorphisms of organelle DNA.

Authors:  Xin Wei; Rongsheng Wang; Lirong Cao; Nannan Yuan; Juan Huang; Weihua Qiao; Wanxia Zhang; Hanlai Zeng; Qingwen Yang
Journal:  PLoS One       Date:  2012-11-15       Impact factor: 3.240

10.  Hd16, a gene for casein kinase I, is involved in the control of rice flowering time by modulating the day-length response.

Authors:  Kiyosumi Hori; Eri Ogiso-Tanaka; Kazuki Matsubara; Utako Yamanouchi; Kaworu Ebana; Masahiro Yano
Journal:  Plant J       Date:  2013-07-25       Impact factor: 6.417

View more
  18 in total

1.  Antagonistic Transcription Factor Complexes Modulate the Floral Transition in Rice.

Authors:  Vittoria Brambilla; Damiano Martignago; Daniela Goretti; Martina Cerise; Marc Somssich; Matteo de Rosa; Francesca Galbiati; Roshi Shrestha; Federico Lazzaro; Rüdiger Simon; Fabio Fornara
Journal:  Plant Cell       Date:  2017-10-17       Impact factor: 11.277

2.  Identification of LATE BLOOMER2 as a CYCLING DOF FACTOR Homolog Reveals Conserved and Divergent Features of the Flowering Response to Photoperiod in Pea.

Authors:  Stephen Ridge; Frances C Sussmilch; Valérie Hecht; Jacqueline K Vander Schoor; Robyn Lee; Gregoire Aubert; Judith Burstin; Richard C Macknight; James L Weller
Journal:  Plant Cell       Date:  2016-09-26       Impact factor: 11.277

3.  The E3 Ubiquitin Ligase HAF1 Modulates Circadian Accumulation of EARLY FLOWERING3 to Control Heading Date in Rice under Long-Day Conditions.

Authors:  Chunmei Zhu; Qiang Peng; Debao Fu; Dongxia Zhuang; Yiming Yu; Min Duan; Weibo Xie; Yaohui Cai; Yidang Ouyang; Xingming Lian; Changyin Wu
Journal:  Plant Cell       Date:  2018-09-21       Impact factor: 11.277

4.  Effects of Hd2 in the presence of the photoperiod-insensitive functional allele of Hd1 in rice.

Authors:  Zhen-Hua Zhang; Li-Yong Cao; Jun-Yu Chen; Ying-Xin Zhang; Jie-Yun Zhuang; Shi-Hua Cheng
Journal:  Biol Open       Date:  2016-11-15       Impact factor: 2.422

5.  Transcriptional and Post-transcriptional Mechanisms Limit Heading Date 1 (Hd1) Function to Adapt Rice to High Latitudes.

Authors:  Daniela Goretti; Damiano Martignago; Martina Landini; Vittoria Brambilla; Jorge Gómez-Ariza; Nerina Gnesutta; Francesca Galbiati; Silvio Collani; Hiroki Takagi; Ryohei Terauchi; Roberto Mantovani; Fabio Fornara
Journal:  PLoS Genet       Date:  2017-01-09       Impact factor: 5.917

6.  The timing of GIGANTEA expression during day/night cycles varies with the geographical origin of Arabidopsis accessions.

Authors:  Amaury de Montaigu; George Coupland
Journal:  Plant Signal Behav       Date:  2017-06-23

Review 7.  The Importance of Being on Time: Regulatory Networks Controlling Photoperiodic Flowering in Cereals.

Authors:  Vittoria Brambilla; Jorge Gomez-Ariza; Martina Cerise; Fabio Fornara
Journal:  Front Plant Sci       Date:  2017-04-26       Impact factor: 5.753

8.  Lessons from natural variations: artificially induced heading date variations for improvement of regional adaptation in rice.

Authors:  Yong Hu; Shuangle Li; Yongzhong Xing
Journal:  Theor Appl Genet       Date:  2018-10-31       Impact factor: 5.699

Review 9.  Genetic control of flowering time in rice: integration of Mendelian genetics and genomics.

Authors:  Kiyosumi Hori; Kazuki Matsubara; Masahiro Yano
Journal:  Theor Appl Genet       Date:  2016-09-30       Impact factor: 5.699

10.  The Oryza sativa Regulator HDR1 Associates with the Kinase OsK4 to Control Photoperiodic Flowering.

Authors:  Xuehui Sun; Zhiguo Zhang; Jinxia Wu; Xuean Cui; Dan Feng; Kai Wang; Ming Xu; Li Zhou; Xiao Han; Xiaofeng Gu; Tiegang Lu
Journal:  PLoS Genet       Date:  2016-03-08       Impact factor: 5.917

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.