| Literature DB >> 25666057 |
Pu Zhao1, Xiu-Jie Li, Man Teng, Lu Dang, Zu-Hua Yu, Jia-Qi Chi, Jing-Wei Su, Gai-Ping Zhang, Jun Luo.
Abstract
In the past decade, a large number of microRNAs (miRNAs) have been identified in the viral genome of Gallid herpesvirus 2 (GaHV-2), which is historically known as Marek's disease virus type 1. The biological role of most GaHV-2 miRNAs remains unclear. In the present study, we have performed an overall gene expression profile of GaHV-2 miRNAs during the virus life cycle at each phase of the developing disease, a highly contagious, lymphoproliferative disorder, and neoplastic immunosuppressive disease of poultry known as the Marek's disease. According to their distinct in vivo expression patterns, the GaHV-2 miRNAs can be divided into three groups: 12 miRNAs in group I, including miR-M4-5p, displayed a typical expression pattern potentially correlated to the latent, late cytolytic, and/or the proliferative phases in the cycle of GaHV-2 pathogenesis; group II consisting of another 12 miRNAs with expression correlated to the early cytolytic and/or latent phases in GaHV-2's life cycle; while the other two miRNAs in group III showed no identical expression features. Our findings may provide meaningful clues in the search for further potential functions of viral miRNAs in GaHV-2 biology.Entities:
Mesh:
Substances:
Year: 2015 PMID: 25666057 PMCID: PMC4381040 DOI: 10.1007/s11262-015-1167-z
Source DB: PubMed Journal: Virus Genes ISSN: 0920-8569 Impact factor: 2.332
Primer pairs or primers used for the quantitative real-time PCR (qRT-PCR) analysis of the expression of viral miRNAs and GaHV-2 protein-coding genes in the present study
| No. | Primer (pair) | Target | Typea | Sequence (5′–3′)b | Length (nt) |
|---|---|---|---|---|---|
| 1 | qPCRMeq-F |
| 5′ | CGCAGGAAGCAGACGGACTA | 20 |
| qPCRMeq-R |
| 3′ | CCATAGGGCAAACTGGCTCAT | 21 | |
| 2 | qMDV100-F |
| 5′ | GCACTGCATTCCGAGAGTCAT | 21 |
| qMDV100-R |
| 3′ | TTGGGAATTTGGAGGGCG | 18 | |
| 3 | qPCRgB-F |
| 5′ | TCTAGGGCATGGCACACGAC | 20 |
| qPCRgB-R |
| 3′ | GAATACGGAAACACAGAGCGG | 21 | |
| 4 | qPCRpp38-F |
| 5′ | CCGAAAGACAAAACCCAAAT | 20 |
| qPCRpp38-R |
| 3′ | ATGTAACCAGCATATAAGAACGC | 23 | |
| 5 | qPCRGAPDH-F |
| 5′ | AAGTCCCTGAAAATTGTCAGCAAT | 24 |
| qPCRGAPDH-R |
| 3′ | ATGGCATGGACAGTGGTCATAAG | 23 | |
| 6 | miR-M1-3p-F | miR | 5′ | GCGCATGAAAGAGCGAAAA | 19 |
| 7 | miR-M1-5p-F | miR | 5′ | TGTTCACTGTGCGGCAAAAA | 20 |
| 8 | miR-M2-3p-F | miR | 5′ | CTGCCGCAGAATAGCTTAAAAA | 22 |
| 9 | miR-M2-5p-F | miR | 5′ | GTTGTATTCTGCCCGGTAGTCC | 22 |
| 10 | miR-M3-3p-F | miR | 5′ | GGGGGGTTCACATTTTTAAGTAAA | 24 |
| 11 | miR-M3-5p-F | miR | 5′ | TGAAACCTCTCCCGCAAAAA | 20 |
| 12 | miR-M4-3p-F | miR | 5′ | GGTTCTGACAGCATGACCAAAAA | 23 |
| 13 | miR-M5-3p-F | miR | 5′ | TGTGTATCGTGGTCGTCTACTGTAAA | 26 |
| 14 | miR-M4-5p-F | miR | 5′ | TTAATGCTGTATCGGAACCCTTC | 23 |
| 15 | miR-M5-5p-F | miR | 5′ | CGTATGCGATCACATTGACAAAA | 23 |
| 16 | miR-M6-3p-F | miR | 5′ | GATCCCTGCGAAATGACAGTAAA | 23 |
| 17 | miR-M6-5p-F | miR | 5′ | TCTGTTGTTCCGTAGTGTTCTCAAA | 25 |
| 18 | miR-M7-3p-F | miR | 5′ | TCGAGATCTCTACGAGATTACAGAAAA | 27 |
| 19 | miR-M7-5p-F | miR | 5′ | CGGGGAGATCCCGATAAAAA | 20 |
| 20 | miR-M8-3p-F | miR | 5′ | GTGACCTCTACGGAACAATAGTAAAAA | 27 |
| 21 | miR-M8-5p-F | miR | 5′ | TATTGTTCTGTGGTTGGTTTCGA | 23 |
| 22 | miR-M9-3p-F | miR | 5′ | CGAGGGCAGGAAAAAGAAAAA | 21 |
| 23 | miR-M9-5p-F | miR | 5′ | CTTCCCCCCGGAGTTAAAAA | 20 |
| 24 | miR-M10-3p-F | miR | 5′ | TCGAAATCTCTACGAGATAACAAAAA | 26 |
| 25 | miR-M10-5p-F | miR | 5′ | TTGTCTCGTAGAGGTCCAGAAAAA | 24 |
| 26 | miR-M11-3p-F | miR | 5′ | AGTTACATGGTCAGGGGATTAAAAA | 25 |
| 27 | miR-M11-5p-F | miR | 5′ | TTTTCCTTACCGTGTAGCTTAGAAA | 25 |
| 28 | miR-M12-3p-F | miR | 5′ | TGCATAATACGGAGGGTTCTAAAA | 24 |
| 29 | miR-M12-5p-F | miR | 5′ | GCCCTCCGTATAATGTAAATGTAAAA | 26 |
| 30 | miR-M13-3p-F | miR | 5′ | ATGGAAACGTCCTGGGAAAAA | 21 |
| 31 | miR-M31-3p-F | miR | 5′ | CTACAGTCGTGAGCAGATCAAAAA | 24 |
| 32 | Universal qPCR Primer | miR | 3′ | UA |
miR miRNA, GAPDH glyceraldehyde phosphate dehydrogenase, meq MDV coRI-Q, ICP4 immediate-early gene ICP4 (infected cell protein 4), gB virion membrane glycoprotein B, pp38 38 KD phosphorylated protein
a5′, forward primer; 3′, reverse primer
bUA, the Universal qPCR Primer is provided by Invitrogen with unavailable sequence
Fig. 1Relative expression levels of the GaHV-2 protein-coding genes analyzed by qRT-PCR. a gB, the gene of glycoprotein B; b ICP4, the gene of infected cell protein 4; c pp38, the gene of 38 KD phosphorylated protein; d Meq, the oncogene of MDV coRI-Q. The endogenous chicken GAPDH gene was used as a standard and the relative quantification of mRNA expression was calculated with the method. Columns represent the mean of relative expression levels in the spleens of three randomly selected birds, determined in triplicate. Error bars indicate 1× SD. The star indicates significant difference (p < 0.05) compared to that determined at 3 dpi
Fig. 2Expression profiles of GaHV-2 miRNAs during the different phases of the developing disease. a The Meq-clustered miRNAs; b the LAT-clustered miRNAs; c the Mid-clustered miRNAs. A quantitative real-time PCR was performed to determine miRNA expression and the absolute copy number was estimated using synthetic miR-M4-5p as the standard. Columns represent the mean miRNA expression levels in the spleens from three randomly selected birds, determined in triplicate. Error bars indicate 1× SD. The single and double stars indicate significant differences (p < 0.05 or p < 0.01) compared to that determined at 3 dpi