Literature DB >> 25640197

MiR-429 inhibits oral squamous cell carcinoma growth by targeting ZEB1.

Wanke Lei1, Yun-e Liu2, Yuzhu Zheng3, Lin Qu4.   

Abstract

BACKGROUND: Oral squamous cell carcinoma (OSCC) is the sixth most common human malignancy worldwide. To develop new therapeutics requires elucidation of the underlying mechanism of OSCC pathogenesis. The role of miR-429 in OSCC remains unknown. MATERIAL/
METHODS: The level of miR-429 and ZEB1 in OSCC tissues and cell lines was measured by qRT-PCR. MiR-429 was down-regulated by miRNAs antisense oligonucleotides (ASO) transfection and up-regulated by miRNAs mimics. Cell proliferation was analyzed by MTT assay. Cell apoptosis was revealed by FACS analysis. Targeted genes were predicted by a bioinformatics algorithm and confirmed by a dual luciferase reporter assay.
RESULTS: MiR-429 was down-regulated in OSCC tissues, and miR-429 overexpression inhibited OSCC cell lines growth and vice versa. Further, we found that miR-429 could inhibit zinc finger E-boxbinding homeobox 1 (ZEB1) expression, and that miR-429 and ZEB1 expression in OSCC tissues were negatively correlated.
CONCLUSIONS: Our data demonstrate the tumor suppressor role of miR-429 in OSCC, and may provide a potential therapeutic target that warrants further investigation.

Entities:  

Mesh:

Substances:

Year:  2015        PMID: 25640197      PMCID: PMC4324578          DOI: 10.12659/MSM.893412

Source DB:  PubMed          Journal:  Med Sci Monit        ISSN: 1234-1010


Background

Oral squamous cell carcinoma (OSCC) is a significant global disease and is the sixth most common human malignancy worldwide. Importantly, the incidence rate is increasing, especially in younger people [1,2]. Although the incidence of OSCC accounts for only 3% of all cases of cancer worldwide, this disease is considered a critical public health threat due the relatively low survival compared to the major cancers [3]. In China, over 11,900 cases of oral cancers are diagnosed each year and approximately 5,000 patients die of the disease [4]. A number of factors are associated with the increase of risks of oral cancer. The risk factors include age, tobacco and alcohol consumption, human papilloma virus infection, and race [5-7]. OSCC carcinogenesis occurs by a multistep process in which gene mutation or modifications were accumulated [8]. Although many molecules involved in the OSCC pathogenesis have been identified, the 5-year survival rate of OSCC remains very low [9]. The development of new therapies requires elucidation of the underlying mechanism of OSCC pathogenesis. MicroRNAs (miRNAs) are a class of endogenous, non-coding, single-stranded, small regulatory RNA molecules, which are approximately 22 nucleotides in length [10]. MiRNAs inhibit translation and cleave mRNA by base-pairing to the 3′ untranslated region of the target genes [11-13]. Deregulation or dysfunction of miRNAs contributes to cancer development [14-19]. In OSCC, for example, down-regulation of miR-375 promoted proliferation via MYC protein [20], and decreased expression of miR-125b and miR-100 in oral cancer cells contributes to malignancy [21]. A previous study suggested that miR-429 may be involved in the pathogenesis of OSCC [22]. MiR-429 belongs to the miR-200 family, which plays a very important role in epithelial-mesenchymal transition (EMT) [23]. Another study revealed that miR-429 up-regulation induces apoptosis and suppresses invasion by targeting Bcl-2 and SP-1 in esophageal carcinoma [24]. In this study, we focused on the role of miR-429 in OSCC. We found that miR-429 could inhibit OSCC cell lines growth, and revealed the gene which miR-429 targeted. We hope that the results of this study will be useful in further investigation of OSCC pathogenesis and provide a potential therapeutic target.

Material and Methods

Patients and sample

Surgical specimens from 66 PDAC OSCC patients and matched tumor-adjacent normal oral tissues were obtained postoperatively from 2006 onward from the Department of Oral and Maxillofacial Surgery, West China College of Stomatology, Sichuan University (Chengdu, China). All patients gave signed, informed consent for their tissues to be used for scientific research. Ethics approval for the study was obtained from West China Hospital, Sichuan University (Chengdu, China). All diagnoses were based on pathological and/or cytological evidence. The histological features of the specimens were evaluated by senior pathologists according to the World Health Organization classification criteria. Tissues were obtained prior to chemotherapy and radiotherapy and were immediately frozen and stored at −80°C prior to qRT-PCR assay. Matched tumor-adjacent normal tissues were used as control.

Cell culture and reagent

HEK293, SCC-25, and CAL27 were obtained from the Cell Bank of the Chinese Academy of Science (Shanghai, China) and cultured in DMEM medium (Hyclone, South Logan, UT, USA) supplemented with 10% fetal bovine serum (Hyclone), 2 mM L-glutamine, and 100 μg/mL penicillin/streptomycin (Bio Light, Shanghai, China) as described in previous studies [25,26].

Quantitative real-time PCR (qRT-PCR)

The qRT-PCR analysis for miR-429 was performed by Shengong Company (Shanghai) using standard protocols on an Applied Biosystem’s 7500 HT sequence detection system. This assay includes a reverse-transcription step performed using a High-Capacity Complementary DNA Archive Kit (Applied Biosystems), in which a stem-loop reverse-transcription primer specifically hybridizes with an miRNA and then is reverse-transcribed with MultiScribe reverse transcriptase. miR-429 expression was assessed using a mirVana™ qRT-PCR miRNA Detection Kit (Ambion, USA). The following primers were designed and synthesized by Shengong Company (Shanghai, China): MiR-429 sense strand UAAUACUGUCUGGUAAAACCGU; miR-429 antisense strand CAAGAUCGGAUCUACGGGUUUU; NC sense strand UUCUCCGAACGUGUCACGUTT; and NC antisense strand ACGUGACACGUUCGGAGAATT. MiRNA-U6 was used as an internal control.

MTT assay

For MTT assay, 5×103 cells per well were seeded in triplicate in a 96-well plate with complete growth medium. The viability of the cells was measured over a period of 5 days using the MTT assay (Promega, Fitchburg, WI, USA) as described previously [17,27,28]. The data were read by Microtiter plate reader 570-nm filters (Promega, Fitchburg, WI, USA).

MicroRNA target prediction [29–32]

MiRNA targets were predicted using the following algorithms: TargetScan () [33], miRand () [29], PicTar () [34], miRGen [35,36], and miRBase () [37]. The algorithm produced a list of hundreds of target genes for miRNAs by searching for the presence of conserved 8-mer and 7-mer sites matching the seed region of miRNAs.

MiRNA, plasmid and transfection

MiR-429 mimics, negative control miRNAs, and miR-429 antisense oligonucleotides (miR-429 ASO) were obtained from GenePharma (GenePharma, China). Plasmids were constructed by Genema (Genema, Shanghai). The mutant reporter plasmids were constructed using the QuikChange Mutagenesis Kit (Stratagene, La Jolla, CA). Cells were transfected with synthetic miR-429 (mimics) (Genema, Shanghai), pre-miR-429, negative control (NC), or pcDNA3.1-ZEB1 at a concentration of 50 nM using Lipofectamine 2000 (Invitrogen, Canada) transfection reagent according to the manufacturer’s instructions. Cells were used for further experiments 48 h later.

Luciferase reporter assay

The 3′UTR fragments of ZEB1 containing putative binding sites for miR-429 were cloned into pMIR-Report construct (Ambion, Austin, TX). The primers were constructed by Biomart (Shanghai, China) according to previous publications [38,39] and the details are provided in previous papers [39,40]. Mutant 3′UTR of ZEB1, which carried a mutated sequence in the complementary site for the seed region of miR-429, was generated using the fusion PCR method. Luciferase reporter assay was performed in HEK293 cells as described previously [41].

Western blot and antibodies

Tumor tissues were collected, lysed, and blotted as described previously [16]. Membranes were blocked with blocking solution (5% skim milk in TBST) and incubated with primary antibody, followed by the incubation with appropriate HRP-conjugated secondary antibody. The ZEB1 antibody (anti-ZEB1) was purchased from Santa Cruz Biotechnology, Inc [42]. The densitometry of Western blot results was measured using ImageJ software.

Statistical analysis

Data are presented as the mean ±sd from at least three independent experiments. The difference between the groups was analyzed using two-tailed Student’s t test when only two groups were compared. The difference between the groups was analyzed using ANOVA when three or more groups were compared. The Wilcoxon matched-pairs signed rank test was used to determine if there was a statistically significant difference in the expression of miR-429 between matched pairs. Correlation analysis was performed by two-tailed Pearson’s correlation coefficient analysis. Statistical analyses were performed using SPSS software (version 17.0). P<0.05 was considered significantly different.

Results

Expression of miR-429 in OSCC tissues

Initially, we collected 66 pairs of OSCC and its matched tumor-adjacent normal oral tissues. Then these tissues were analyzed by qRT-PCR for the miR-429 level. We found that in 52 pairs of pairs of OSCC and its matched tumor-adjacent normal oral tissues, miR-429 level in OSCC tissue were lower than in its matched tumor-adjacent normal oral tissues (Figure 1A) and the mean level of miR-429 was lower in OSCC tissues than in matched tumor-adjacent normal oral tissues (Figure 1B). These data indicate that miR-429 may play a role in the pathogenesis of OSCC.
Figure 1

Expression of miR-429 in OSCC tissues. Sixty-six pairs of OSCC and the matched tumor-adjacent normal oral tissues were collected for miR-429, which was analyzed by qRT-PCR (A). The mean miR-429 expression in the 66 pairs of OSCC and the matched tumor-adjacent normal oral tissues (B). All qRT-PCR experiments were performed in triplicate. Data are shown as mean ±s.d. of three separate experiments. P<0.05.

MiR-429 overexpression inhibited OSCC cell lines growth

To further investigate the role of miR-429 in OSCC, we firstly measured the miR-429 level in two OSCC cell lines – SCC-25 and CAL27. We found that the miR-429 levels in SCC-25 and CAL27 were lower in than in normal oral tissues and HEK293 cell line (Figure 2A). Then, we up-regulated the miR-429 level in SCC-25 and CAL27 by miR-429 mimics transfection. The effectiveness of transfection was verified by qRT-PCR (Figure 2B). After miR-429 mimics transfection, cellular proliferation was assayed by MTT assay, and we found that up-regulation of miR-429 inhibited SCC-25 and CAL27 proliferation (Figure 2C).
Figure 2

Transfection with miR-429 mimics inhibited proliferation of OSCC cell lines. The miR-429 levels in normal oral tissues, HEK293, SCC-25, and CAL-27 were assayed by qRT-PCR. The miR-429 levels in normal oral tissues were arbitrarily defined as 100% (A). Forty-eight hours after miR-429 mimics transfection, the miR-429 levels in SCC-25, and CAL-27 were assayed by qRT-PCR. The miR-429 levels in the miR-NC group were arbitrarily defined as 100% (B). After miR-429 mimics transfection, the cellular proliferation of SCC-25 and CAL-27 were assayed by MTT analysis at the indicated time point (C). All data are shown as mean ±s.d. of three separate experiments. * P<0.05.

Down-regulation of miR-429 promoted OSCC cell lines growth

We then down-regulated the miR-429 level in SCC-25, CAL27, and HEK293 cell lines by transfecting with miR-429 ASO. The level of miR-429 in the three cell lines was assayed by qRT-PCR 48 h after transfection and we found miR-429 ASO transfection down-regulated the miR-429 level in the three cell lines (Figure 3A). Then the cellular proliferation was assayed by MTT assay. We found that miR-429 ASO transfection mildly promoted cells growth in SCC-25 and CAL27 and greatly promoted cells growth in HEK293 cell lines (Figure 3B).
Figure 3

Transfection with miR-429 ASO promoted cellular proliferation of OSCC cell lines. The miR-429 levels in SCC-25, CAL-27 and HEK293 were assayed by qRT-PCR 48 h after miR-429 ASO transfection. The miR-429 levels in miR-NC ASO group were arbitrarily defined as 100% (A). After miR-429 ASO transfection, the cellular proliferation of SCC-25, CAL-27, and HEK293 were assayed by MTT analysis at the indicated time point (B). All data are shown as mean ±s.d. of three separate experiments. * P<0.05.

ZEB1 was targeted by miR-429

Epithelial-mesenchymal transition (EMT) is a critical step in tumor cell invasion and metastasis, and correlates positively with poor patient prognosis [43,44]. E-cadherin transcriptional repressors, ZEB1, are the EMT-inducing transcriptional factors. ZEB1 repress E-cadherin expression and promote cancer cell migration and invasion [45-48]. Previous studies have shown that EMT is also a critical step of the pathogenesis of OSCC [49], and clinically, the level of ZEB1 expression was higher in recurrent OSCC tumor samples but lower in primary lesions [50]. The bioinformatics algorithm predicted that ZEB1 was a potential target gene of miR-429. The five binding sites and mutated sites in ZEB1 are shown in Figure 4A. To confirm that ZEB1 was a potential target gene of miR-429 and the miRNA-target interaction, five binding sites in the 3′UTR of ZEB1and its mutated version were cloned into luciferase reporter plasmids. MiR-429 mimics and the reporter plasmids were co-transfected into HEK293 cells. We found that in wild type 3′ UTR, miR-429 mimics reduced the luciferase activity; however, in the mutated version, the mutated binding site partly restored the luciferase activity and the five mutated binding sites almost restored the luciferase activity (Figure 4B). Next, we transfected CAL27 cell line with miR-429 mimics; 48 h later, the data from Western blot analysis showed that the ZEB1 protein level was inhibited (Figure 4C). Further, the ZEB1 mRNA expression in the 66 OSCC tissues were examined by qRT-PCR, and we found that ZEB1 mRNA level and miR-429 level were negative correlated (Figure 4D).Therefore, our results show that miR-429 plays a role in OSCC via ZEB1.
Figure 4

ZEB1 was targeted by miR-429. Putative targeted genes were predicated by TargetScanHuman, the binding site of putative targeted gene, and mutated site of miR-429 are shown (A). Five binding site in the 3′UTR of ZEB1and its mutated version were cloned into luciferase reporter plasmids. MiR-429 mimics and the reporter plasmids were co-transfected into HEK293 cells. Luciferase activities were measured after 48 h. Then the ratio of RL activity of firefly luciferase activity in the miR-429 treated group were calculated and compared with the ratio in the miR-NC group, which was arbitrarily defined as 100%. (B). ZEB1 protein levels were assayed by Western blotting 48 h after miR-429 mimics transfection (C). ZEB1 mRNA expression in the 66 OSCC tissues were examined by qRT-PCR. The correlation between ZEB1 mRNA and miR-429 were determined by two-tailed Person’s correlation coefficient analysis (D). All data are shown as mean ±s.d. of three separate experiments. * P<0.05.

Discussion

Our results show that miR-429 expression is lower in OSCC tissues than in normal control oral tissues. MiR-429 overexpression inhibited OSCC cell lines growth and vice versa. 3′UTR of ZEB1 was targeted by miR-429. Therefore, we conclude that the low miR-429 level in OSCC promoted tumor cells growth. Our data highlights the role of miR-429 in the growth of OSCC cells. Our study may be the first to reveal the role of miR-429 in OSCC. Previously, miR-429 was shown to have two different roles in cancer. In most cancers, miR-429 level is down-regulated [51,52], which agrees with our data. In endometrial carcinoma and bladder cancer, miR-429 level was up-regulated [53,54]. Higher expression levels of miR-429 are correlated with a poor prognosis in patients with serious ovarian carcinoma [55]. In hepatocellular carcinoma, miR-429 plays the role of an oncogene, is overexpressed in liver cancer tissues, and can be considered as a potential prognostic factor for HCC. Furthermore, overexpression of this miR-429 promoted proliferation and inhibited apoptosis in liver cancer cells [56].The different roles of miR-429 are possibly due to the fact that miRNAs can down-regulate numerous targets, including oncogenes and tumor suppressor genes. A previous study proved that miR-429 could not only inhibit the proliferation of osteosarcoma cell lines, but also induce more cell apoptosis. MiR-429 plays its role in osteosarcoma by binding the 3′UTR of ZEB1 mRNA, and overexpression of ZEB1 could reverse the proliferation inhibitory effect of miR-429 [40]. This study also revealed the miR-429-ZEB1 pathway in osteosarcoma. Our data show that ZEB1 mRNA level and miR-429 level were negative correlated, and that miR-429 targeted ZEB1. ZEB1 is a very important protein in epithelial-mesenchymal transition (EMT), which is a critical step in the pathogenesis in various cancers. Whether ZEB1 plays a direct role or are targeted by other miRNAs in OSCC needs further study.

Conclusions

In conclusion, our data proves that low miR-429 level and in OSCC tissues promotes tumor cell growth. MiR-429 exerts its role by targeting ZEB1. We anticipate the results of our study will provide useful information and be a basis for further studies.
  56 in total

Review 1.  Small regulatory RNAs in mammals.

Authors:  John S Mattick; Igor V Makunin
Journal:  Hum Mol Genet       Date:  2005-04-15       Impact factor: 6.150

Review 2.  MicroRNAs in stress signaling and human disease.

Authors:  Joshua T Mendell; Eric N Olson
Journal:  Cell       Date:  2012-03-16       Impact factor: 41.582

3.  Tumor-suppressing effects of miR-429 on human osteosarcoma.

Authors:  Xiaozhou Liu; Yunlai Liu; Sujia Wu; Xin Shi; Lihong Li; Jianning Zhao; Haidong Xu
Journal:  Cell Biochem Biophys       Date:  2014-09       Impact factor: 2.194

4.  MicroRNA-99a inhibits hepatocellular carcinoma growth and correlates with prognosis of patients with hepatocellular carcinoma.

Authors:  Dong Li; Xingguang Liu; Li Lin; Jin Hou; Nan Li; Chunmei Wang; Pin Wang; Qian Zhang; Peng Zhang; Weiping Zhou; Zhengxin Wang; Guoshan Ding; Shi-Mei Zhuang; Limin Zheng; Wenzhao Tao; Xuetao Cao
Journal:  J Biol Chem       Date:  2011-08-30       Impact factor: 5.157

5.  miR-200bc/429 cluster targets PLCgamma1 and differentially regulates proliferation and EGF-driven invasion than miR-200a/141 in breast cancer.

Authors:  S Uhlmann; J D Zhang; A Schwäger; H Mannsperger; Y Riazalhosseini; S Burmester; A Ward; U Korf; S Wiemann; O Sahin
Journal:  Oncogene       Date:  2010-05-31       Impact factor: 9.867

6.  Epidemiology and cost analysis for patients with oral cancer in a university hospital in China.

Authors:  Sheng Han; Yan Chen; Xu Ge; Ming Zhang; Jinwei Wang; Qingbo Zhao; Jianjun He; Zhenghong Wang
Journal:  BMC Public Health       Date:  2010-04-16       Impact factor: 3.295

7.  MicroRNA-143 inhibits migration and invasion of human non-small-cell lung cancer and its relative mechanism.

Authors:  Qingping Ma; Qianqian Jiang; Qiang Pu; Xuechao Zhang; Weihan Yang; Yu Wang; Sujuan Ye; Shifei Wu; Guoxing Zhong; Jiang Ren; Yan Zhang; Lunxu Liu; Wen Zhu
Journal:  Int J Biol Sci       Date:  2013-07-18       Impact factor: 6.580

8.  MicroRNA-429 Modulates Hepatocellular Carcinoma Prognosis and Tumorigenesis.

Authors:  Xiao-Ying Huang; Jin-Guang Yao; Hong-Dong Huang; Chao Wang; Yun Ma; Qiang Xia; Xi-Dai Long
Journal:  Gastroenterol Res Pract       Date:  2013-09-24       Impact factor: 2.260

9.  Tumor suppressor miR-375 regulates MYC expression via repression of CIP2A coding sequence through multiple miRNA-mRNA interactions.

Authors:  Hyun Min Jung; Rushi S Patel; Brittany L Phillips; Hai Wang; Donald M Cohen; William C Reinhold; Lung-Ji Chang; Li-Jun Yang; Edward K L Chan
Journal:  Mol Biol Cell       Date:  2013-04-03       Impact factor: 4.138

10.  Elevated miR-34c-5p mediates dermal fibroblast senescence by ultraviolet irradiation.

Authors:  Bing-rong Zhou; Xian-fei Guo; Jia-an Zhang; Yang Xu; Wei Li; Di Wu; Zhi-qiang Yin; Felicia Permatasari; Dan Luo
Journal:  Int J Biol Sci       Date:  2013-08-09       Impact factor: 6.580

View more
  18 in total

1.  miRNA-429 Inhibits Astrocytoma Proliferation and Invasion by Targeting BMI1.

Authors:  Gang Peng; Yiwei Liao; Chenfu Shen
Journal:  Pathol Oncol Res       Date:  2016-09-23       Impact factor: 3.201

2.  MiRNA-101 inhibits oral squamous-cell carcinoma growth and metastasis by targeting zinc finger E-box binding homeobox 1.

Authors:  Baolei Wu; Delin Lei; Lei Wang; Xinjie Yang; Sen Jia; Zihui Yang; Chun Shan; Xi Yang; Chenping Zhang; Bin Lu
Journal:  Am J Cancer Res       Date:  2016-06-01       Impact factor: 6.166

3.  Positron Emission Tomographic Imaging Elucidates the Complex Relationship Between Glucose Uptake and Tissue Blood Flow Mechanism in Squamous Cell Oral Cancer Patients.

Authors:  Ping Xu; Yan Li; Shuyong Yang; Mingzhe Li; Chenjun Li
Journal:  Med Sci Monit       Date:  2017-09-21

4.  MiR-429 suppresses the progression and metastasis of osteosarcoma by targeting ZEB1.

Authors:  Yi Deng; Fujun Luan; Li Zeng; Yanjun Zhang; Kunlong Ma
Journal:  EXCLI J       Date:  2017-05-05       Impact factor: 4.068

5.  PART1 and hsa-miR-429-Mediated SHCBP1 Expression Is an Independent Predictor of Poor Prognosis in Glioma Patients.

Authors:  Chengmin Xuan; Mingwei Jin; Lei Wang; Shengbai Xue; Qi An; Qingzeng Sun; Lei Wang; Yong Gao
Journal:  Biomed Res Int       Date:  2020-04-13       Impact factor: 3.411

6.  Increased Expression of Tissue/Salivary Transgelin mRNA Predicts Poor Prognosis in Patients with Oral Squamous Cell Carcinoma (OSCC).

Authors:  Jingqiu Bu; Xi Bu; Bing Liu; Fei Chen; Peng Chen
Journal:  Med Sci Monit       Date:  2015-08-05

7.  miR-429 functions as a tumor suppressor by targeting FSCN1 in gastric cancer cells.

Authors:  Min Zhang; Bing-Bin Dong; Min Lu; Mei-Juan Zheng; He Chen; Jing-Zhen Ding; A-Man Xu; Yuan-Hong Xu
Journal:  Onco Targets Ther       Date:  2016-03-03       Impact factor: 4.147

8.  miR-429 Inhibits Differentiation and Promotes Proliferation in Porcine Preadipocytes.

Authors:  Ying Peng; Fen-Fen Chen; Jing Ge; Jia-Yu Zhu; Xin-E Shi; Xiao Li; Tai-Yong Yu; Gui-Yan Chu; Gong-She Yang
Journal:  Int J Mol Sci       Date:  2016-12-07       Impact factor: 5.923

Review 9.  Functional Landscape of Dysregulated MicroRNAs in Oral Squamous Cell Carcinoma: Clinical Implications.

Authors:  Ruma Dey Ghosh; Arun Pattatheyil; Susanta Roychoudhury
Journal:  Front Oncol       Date:  2020-05-12       Impact factor: 6.244

10.  Tumor expression of miR-448 is a prognostic marker in oral squamous cell carcinoma.

Authors:  Hui Wei; Kang Yu; Yongheng Liu; Lili Li; Guowen Wang
Journal:  BMC Cancer       Date:  2020-08-12       Impact factor: 4.430

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.