Literature DB >> 25628038

Influenza D virus in cattle, France, 2011-2014.

Mariette F Ducatez, Claire Pelletier, Gilles Meyer.   

Abstract

A new influenza virus, genus D, isolated in US pigs and cattle, has also been circulating in cattle in France. It was first identified there in 2011, and an increase was detected in 2014. The virus genome in France is 94%-99% identical to its US counterpart, which suggests intercontinental spillover.

Entities:  

Mesh:

Year:  2015        PMID: 25628038      PMCID: PMC4313661          DOI: 10.3201/eid2102.141449

Source DB:  PubMed          Journal:  Emerg Infect Dis        ISSN: 1080-6040            Impact factor:   6.883


Recent studies in the United States have identified a new genus within the family Orthomyxoviridae, tentatively named Influenzavirus D (). The new pathogen, C/swine/Oklahoma/1334/2011 (C/OK), was first identified in pigs with influenza-like illness and was only moderately related to previously characterized influenza C viruses (≈50% overall homology between C/OK virus sequence and its closest related sequences). Like human influenza C virus, C/OK harbored 7 genomic segments, whereas influenza A and B viruses have 8. C/OK virus genome was more distant from influenza C virus genomes than influenza A genomes are from influenza B virus genomes. In hemagglutination-inhibition assays, cross-reactivity between antibodies against C/OK virus and human influenza C virus was lacking, which again suggests a new genus in the family Orthomyxoviridae (). C/OK-like viruses were also isolated from cattle in the United States in 2013 () and China in 2014 (). C/OK was shown to replicate in ferrets, the animal model of choice for studying influenza virus in humans, suggesting that humans could be infected with C/OK-like viruses. Thus, the host range and geographic distribution of C/OK-like viruses (influenza D virus) needs to be investigated. Because cattle have been suggested as the reservoir for this novel influenza virus (), we screened bovine samples in France for influenza D virus and characterized the virus from positive specimens.

The Study

Bovine lung fragments, deep nasal swab specimens, and trans-tracheal aspiration liquids were submitted to the Laboratoire Départemental d’Analyses de Saône-et-Loire (Mâcon, France) and tested for classical respiratory pathogens. The Unité Mixte de Recherche, Interactions Hôtes—Agents Pathogènes 1225 (Toulouse, France), received and tested 134 samples by using real-time reverse transcription PCR for influenza D virus as previously described (). We tested 25 archived samples per year for 2010–2013 and 34 samples collected during January–March 2014. Six (4.5%) were positive for influenza D virus: 1 each in 2011 and 2012 and 4 in 2014; cycle threshold (Ct) values ranged from 15 to 35 (Table 1). Co-infections were detected with Pasteurella multocida, Mannheimia haemolytica, Histophilus somni, bovine respiratory syncytial virus, and/or bovine herpesvirus 1 in 4 of the influenza D–positive specimens. Two samples (nos. 5831 and 5920, collected in 2014) were negative for all tested respiratory pathogens, despite reports of clinical signs in the animals (Table 1).
Table 1

Cattle samples positive for influenza D virus genome by real-time reverse transcription PCR, France*

Sample IDCollection dateSample typeAgeAntimicrobial treatmentVaccination†Duration of respiratory signsFluD (CT)BRSVBPIV-3 Pasteurella multocida Mannheimia haemolytica Mycoplasma bovis Histophilus somni BCoVBoHV-1
57312014 Jan 25LungAdultYesNCNCP (35)NNWPWPNPNTP
58312014 Feb 5Lung12 moYesYes3–4 wkP (31)NNNNNNNTNT
59202014 Feb 18Lung1 moYesYes3 dP (27)NNNNNNNNT
61062014 Mar 14Lung1 moNoYes1 dP (35)NNWPNNWPNNT
23642011 Mar 30LungNCNCNCNCP (35)NTNTPNNNNTNT
29862012 Jan 17Nasal swabNCNCNCNCP (15)PNWPWPNNNTNT

*Ct, cycle threshold; BCoV, bovine coronavirus; BoHV-1, bovine herpesvirus I; BPIV3, bovine parainfluenzavirus 3; BRSV, bovine respiratory syncytial virus; FluD, influenza D virus; ID, identification; N, negative; NC, not communicated; NT, not tested; P: positive (Ct<35), WP: weakly positive (35

*Ct, cycle threshold; BCoV, bovine coronavirus; BoHV-1, bovine herpesvirus I; BPIV3, bovine parainfluenzavirus 3; BRSV, bovine respiratory syncytial virus; FluD, influenza D virus; ID, identification; N, negative; NC, not communicated; NT, not tested; P: positive (Ct<35), WP: weakly positive (35BRSV and BPIV-3. The specimen with the lowest Ct value, D/bovine/France/2986/2012 (Ct 15) was selected for further molecular characterization, and its full genome was amplified by PCR (primers in Table 2) and sequenced on a 3130XL Applied Biosystems capillary sequencer (Applied Biosystems, Foster City, CA, USA). The sequences were submitted to EMBL (LN559120–LN559126).
Table 2

Primer sets used for PCR amplification and sequencing of the full genome of D/bovine/France/2986/2012

Gene
Forward primer, 5′ → 3′
Reverse primer, 5′ → 3′
Hemagglutinin-esteraseFluD_HE-1F: AGCATAAGCAGGAGATTTTCAAAGFluD_HE-745R: GCACTACATGCTTGTTGC
FluD_HE-667F: GTTTGTGGGACTGAGCAATCFluD_HE-1350R: CCCTGCTTGCGGTATTATC
FluD_HE-1267F: CCCAAGTATGGCAGATGfluD_HE-2042R: GCAAGGAGATTTTTTCTAAGATT
MatrixFluD-MP-8F: GCAGAGGATATTTTTGACGCFluD-MP-670R: CCCATATGCTATTCTTGCCAG
FluD-MP-602F: AAAAAAGAGGCCCAGGCACFluD-MP-1212R: GCAAGAGGATTTTTTCGCG
NucleoproteinFluD-NP-1F: GGCATAAGCAGGAGATTATTAAGCFluD-NP-949R: TAAAGGCTCTTACTCCAGAATA
FluD-NP-849F: GCCTTGGTCAATGTGGCTGFluD-NP-1717R: GGGGACTGCAACAGAACCA
Nonstructural proteinFluD-NS-8F: GCAGGGGTGTACAATTTCAATFluD-NS-804R: TCGAAACTGACTTGATTTCATCC
Polymerase 3FluD-P3–1F: GGCATAAGCAGGAGATTTAFluD-P3–759R: TTTTCTTCTAGATGTTCCAGTTTGA
FluD-P3–677F: AAAAGAAATCAGGCTGAATGCFluD-P3–1467R: CCAAACAAACAGTCAGTTGA
FluD-P3–1394F: CCCGGAAAGGTCAAGATAGFluD-P3–2184R: GGAGATTTTTAACATTACAAGGCC
Polymerase basic 1FluD-PB1–1F: GGCATAAGCAGAGGATTTTATFluD-PB1–736R: TTTTCCTCTTTCTCCGTC
FluD-PB1–631F: AAAAATGAAGTCTCCAACATTGC/OK-Rev (2)
C/OK-Fwd (2)FluD-PB1–2317R: GATTTTTCTGTTATTAAACAACGC
Polymerase basic 2FluD-PB2–1F: GGCATAAGCAGAGGATGTCFluD-PB2–882R: CCCTTATCTTCTCTGCTGG
FluD-PB2–796F: AAAAGAAGAGAGATGTTAGAGCFluD-PB2–1776R: TTTTACCCATTATCAAAGCAGG
FluD-PB2–1724F: GAAAGAATAAACACTGATGATGFluD-PB2–2353R: GAGGATTTTTTCAATGTGCTTC
The 7 gene segments of D/bovine/France/2986/2012 clearly clustered with US influenza D strains from pigs and cattle (C/OK, C/bovine/Minnesota/628/2013, C/bovine/Minnesota/729/2013, and C/bovine/Oklahoma/660/2013) (Figure), which suggests a common origin of these new influenza viruses. We found no evidence of reassortment between influenza C and D (C/OK-like) viruses. In addition, the splicing pattern of the matrix gene segment and the reduced 5-N-acetyl binding pocket in the hemagglutinin-esterase (HE) protein of D/bovine/France/2986/2012 was similar to that of C/OK and different from that of human influenza C virus, confirming the similarity of D/bovine/France/2956/2012 and the newly described swine and bovine US influenza D virus strains. The estimated ranges of evolutionary distances (in number of substitutions per site using the maximum composite likelihood model) between D/bovine/France/2986/2012 and the 4 US influenza D viruses ranged from 0.8 to 5.7% and were as follows: 1.9%–2.1%, 0.8%–0.9%, 2.1%–2.5%, 2.3%–2.7%, 1.8%–3.8%, 3.6%–4.2%, and 5.1%–5.7% for polymerase basic (PB) 2, PB1, polymerase 3/polymerase acidic, nucleoprotein, matrix, nonstructural protein, and HE gene segments, respectively.
Figure

Phylogenetic trees of the 7 gene segments of D/bovine/France/2986/2012 influenza virus at the nucleotide level. A) PB2. B) PB1. C) P3/PA. D) Nucleoprotein E) P42/Matrix. F) Nonstructural protein. G) Hemagglutinin-esterase. Maximum-likelihood analysis with 500 bootstrap replicates (bootstrap values >75 are indicated on the tree nodes). The gene sequences of D/bovine/France/2986/2012 (in large bold underlined font) were compared with representatives of all the Orthomyxoviridae genera: all the viral strains used in (). P, polymerase, nucleoprotein, PB, polymerase basic  Scale bars indicate nucleotide substitutions per site.

Phylogenetic trees of the 7 gene segments of D/bovine/France/2986/2012 influenza virus at the nucleotide level. A) PB2. B) PB1. C) P3/PA. D) Nucleoprotein E) P42/Matrix. F) Nonstructural protein. G) Hemagglutinin-esterase. Maximum-likelihood analysis with 500 bootstrap replicates (bootstrap values >75 are indicated on the tree nodes). The gene sequences of D/bovine/France/2986/2012 (in large bold underlined font) were compared with representatives of all the Orthomyxoviridae genera: all the viral strains used in (). P, polymerase, nucleoprotein, PB, polymerase basic  Scale bars indicate nucleotide substitutions per site. We also identified unique features in D/bovine/France/2956/2012 genome. Forty unique amino acid substitutions were identified throughout the genome, but the limited available data on influenza D genomes make a functional interpretation of the substitutions difficult to determine. In addition, although the HE proteins of human influenza C and C/OK viruses contain 7 and 6 potential glycosylation sites, respectively, D/bovine/France/2986/2012 has just 5: at positions 28, 54, 146, 346, and 613 (ATG numbering), identical to 5 of the 6 identified for C/OK virus. For influenza A viruses, modifications of N-linked glycosylation sites in the globular head of the hemagglutinin protein have been linked to changes in virulence, antigenicity, receptor-binding preference, fusion activity, and immune evasion (). For example, an increase in glycosylation site numbers has been associated with early stages of influenza A(H1N1) virus evolution, and changes in the positional conversion of the glycosylation sites have been associated with later evolutionary stages of the virus (). The missing potential glycosylation site in D/bovine/France/2986/2012 is located at position 513, probably likely in the F3 = HE2 fusion domain of the protein () and not in the globular head of the protein. Thus speculating on the putative time course of virus emergence between C/OK-like and D/bovine/France/2986/2012-like strains is difficult. Further studies are needed to understand the phenotype(s) associated with aa substitutions in influenza D viruses.

Conclusions

Webster et al. suggested the existence of a common ancestor for influenza A, B, and C viruses and a more recent common ancestor to influenza A and B viruses only considering the different genome organizations between influenza A/B and influenza C viruses (). Sheng et al. recently estimated the time of divergence between influenza C and D virus gene segments at 334 years for PB1 to 1,299 years for HE (). The time of emergence and evolutionary rate of influenza D viruses need to be examined as more data become available. A puzzling question raised by our current study is the geographic origin of influenza D strains: were cattle in France contaminated by their North American counterparts or vice versa? Did co-evolution occur? Did the pathogen originate from a distinct location or from a distinct host? Retrospective studies with archived samples would help date the emergence of influenza D viruses and enable an understanding of their evolution. In addition, the geographic prevalence still needs to be investigated. The pathogen may have spread to swine and cattle in recent years only; efforts should be made to find the virus host range and its reservoir species and to evaluate the public health relevance of this new pathogen. Finally, surveillance projects with larger cohorts, as well as experimental infections, need to be conducted before 1) the causality between respiratory symptoms and influenza D virus infection in cattle can be established, 2) recommendations on samples to collect can be given, and 3) prevalence can be compared in different geographic areas. Although the causative agent(s) of some respiratory infections in the field remain(s) unknown (G. Meyer, pers. comm.) and although 2 of the positive specimens in our study originated from young cattle with respiratory symptoms but no identified respiratory pathogen, further studies are also warranted to provide an understanding of the pathobiology of influenza D virus in cattle and its putative role in complex bovine respiratory disease.
  8 in total

Review 1.  Evolution and ecology of influenza A viruses.

Authors:  R G Webster; W J Bean; O T Gorman; T M Chambers; Y Kawaoka
Journal:  Microbiol Rev       Date:  1992-03

2.  Identification of a potential novel type of influenza virus in Bovine in China.

Authors:  Wen-Ming Jiang; Su-Chun Wang; Cheng Peng; Jian-Min Yu; Qing-Ye Zhuang; Guang-Yu Hou; Shuo Liu; Jin-Ping Li; Ji-Ming Chen
Journal:  Virus Genes       Date:  2014-08-21       Impact factor: 2.332

3.  Genomic and evolutionary characterization of a novel influenza-C-like virus from swine.

Authors:  Zizhang Sheng; Zhiguang Ran; Dan Wang; Adam D Hoppe; Randy Simonson; Suvobrata Chakravarty; Ben M Hause; Feng Li
Journal:  Arch Virol       Date:  2013-08-13       Impact factor: 2.574

4.  Glycosylation site alteration in the evolution of influenza A (H1N1) viruses.

Authors:  Shisheng Sun; Qinzhe Wang; Fei Zhao; Wentian Chen; Zheng Li
Journal:  PLoS One       Date:  2011-07-28       Impact factor: 3.240

Review 5.  N-linked glycosylation in the hemagglutinin of influenza A viruses.

Authors:  Jin Il Kim; Man-Seong Park
Journal:  Yonsei Med J       Date:  2012-09       Impact factor: 2.759

6.  Isolation of a novel swine influenza virus from Oklahoma in 2011 which is distantly related to human influenza C viruses.

Authors:  Ben M Hause; Mariette Ducatez; Emily A Collin; Zhiguang Ran; Runxia Liu; Zizhang Sheng; Anibal Armien; Bryan Kaplan; Suvobrata Chakravarty; Adam D Hoppe; Richard J Webby; Randy R Simonson; Feng Li
Journal:  PLoS Pathog       Date:  2013-02-07       Impact factor: 6.823

7.  Characterization of a novel influenza virus in cattle and Swine: proposal for a new genus in the Orthomyxoviridae family.

Authors:  Ben M Hause; Emily A Collin; Runxia Liu; Bing Huang; Zizhang Sheng; Wuxun Lu; Dan Wang; Eric A Nelson; Feng Li
Journal:  mBio       Date:  2014-03-04       Impact factor: 7.867

8.  Structure of the haemagglutinin-esterase-fusion glycoprotein of influenza C virus.

Authors:  P B Rosenthal; X Zhang; F Formanowski; W Fitz; C H Wong; H Meier-Ewert; J J Skehel; D C Wiley
Journal:  Nature       Date:  1998-11-05       Impact factor: 49.962

  8 in total
  74 in total

1.  Seroprevalence of influenza D virus in bulls in Argentina.

Authors:  Ignacio J Alvarez; Marcelo Fort; Juan Pasucci; Fabiana Moreno; Hugo Gimenez; Katarina Näslund; Sara Hägglund; Siamak Zohari; Jean François Valarcher
Journal:  J Vet Diagn Invest       Date:  2020-06-18       Impact factor: 1.279

2.  Pathogenesis, Host Innate Immune Response, and Aerosol Transmission of Influenza D Virus in Cattle.

Authors:  Elias Salem; Sara Hägglund; Hervé Cassard; Tifenn Corre; Katarina Näslund; Charlotte Foret; David Gauthier; Anne Pinard; Maxence Delverdier; Siamak Zohari; Jean-François Valarcher; Mariette Ducatez; Gilles Meyer
Journal:  J Virol       Date:  2019-03-21       Impact factor: 5.103

Review 3.  Zoonotic Influenza and Human Health-Part 1: Virology and Epidemiology of Zoonotic Influenzas.

Authors:  L W Goneau; K Mehta; J Wong; A G L'Huillier; J B Gubbay
Journal:  Curr Infect Dis Rep       Date:  2018-08-01       Impact factor: 3.725

4.  Murine Model for the Study of Influenza D Virus.

Authors:  J Oliva; J Mettier; L Sedano; M Delverdier; N Bourgès-Abella; B Hause; J Loupias; I Pardo; C Bleuart; P J Bordignon; E Meunier; R Le Goffic; G Meyer; M F Ducatez
Journal:  J Virol       Date:  2020-01-31       Impact factor: 5.103

5.  A DNA Vaccine Expressing Consensus Hemagglutinin-Esterase Fusion Protein Protected Guinea Pigs from Infection by Two Lineages of Influenza D Virus.

Authors:  Yanmin Wan; Guobin Kang; Chithra Sreenivasan; Lance Daharsh; Junfeng Zhang; Wenjin Fan; Dan Wang; Hideaki Moriyama; Feng Li; Qingsheng Li
Journal:  J Virol       Date:  2018-05-14       Impact factor: 5.103

6.  Serological evidence for the co-circulation of two lineages of influenza D viruses in equine populations of the Midwest United States.

Authors:  H Nedland; J Wollman; C Sreenivasan; M Quast; A Singrey; L Fawcett; J Christopher-Hennings; E Nelson; R S Kaushik; D Wang; F Li
Journal:  Zoonoses Public Health       Date:  2017-11-14       Impact factor: 2.702

7.  Serological evidence for high prevalence of Influenza D Viruses in Cattle, Nebraska, United States, 2003-2004.

Authors:  Junrong Luo; Lucas Ferguson; David R Smith; Amelia R Woolums; William B Epperson; Xiu-Feng Wan
Journal:  Virology       Date:  2016-11-23       Impact factor: 3.616

Review 8.  Novel Influenza D virus: Epidemiology, pathology, evolution and biological characteristics.

Authors:  Shuo Su; Xinliang Fu; Gairu Li; Fiona Kerlin; Michael Veit
Journal:  Virulence       Date:  2017-08-25       Impact factor: 5.882

9.  Metagenomic characterization of the virome associated with bovine respiratory disease in feedlot cattle identified novel viruses and suggests an etiologic role for influenza D virus.

Authors:  Namita Mitra; Natalia Cernicchiaro; Siddartha Torres; Feng Li; Ben M Hause
Journal:  J Gen Virol       Date:  2016-05-05       Impact factor: 3.891

10.  Replication and Transmission of the Novel Bovine Influenza D Virus in a Guinea Pig Model.

Authors:  Chithra Sreenivasan; Milton Thomas; Zizhang Sheng; Ben M Hause; Emily A Collin; David E B Knudsen; Angela Pillatzki; Eric Nelson; Dan Wang; Radhey S Kaushik; Feng Li
Journal:  J Virol       Date:  2015-09-16       Impact factor: 5.103

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.