ScOpi1p is a well-characterized transcriptional repressor and master regulator of inositol and phospholipid biosynthetic genes in the baker's yeast Saccharomyces cerevisiae. An ortholog has been shown to perform a similar function in the pathogenic fungus Candida glabrata, but with the distinction that CgOpi1p is essential for growth in this organism. However, in the more distantly related yeast Yarrowia lipolytica, the OPI1 homolog was not found to regulate inositol biosynthesis, but alkane oxidation. In Candida albicans, the most common cause of human candidiasis, its Opi1p homolog, CaOpi1p, has been shown to complement a S. cerevisiae opi1∆ mutant for inositol biosynthesis regulation when heterologously expressed, suggesting it might serve a similar role in this pathogen. This was tested in the pathogen directly in this report by disrupting the OPI1 homolog and examining its phenotypes. It was discovered that the OPI1 homolog does not regulate INO1 expression in C. albicans, but it does control SAP2 expression in response to bovine serum albumin containing media. Meanwhile, we found that CaOpi1 represses filamentous growth at lower temperatures (30 °C) on agar, but not in liquid media. Although, the mutant does not affect virulence in a mouse model of systemic infection, it does affect virulence in a rat model of vaginitis. This may be because Opi1p regulates expression of the SAP2 protease, which is required for rat vaginal infections.
ScOpi1p is a well-characterized transcriptional repressor and master regulator of inositol and phospholipid biosynthetic genes in the baker's yeastSaccharomyces cerevisiae. An ortholog has been shown to perform a similar function in the pathogenic fungus Candida glabrata, but with the distinction that CgOpi1p is essential for growth in this organism. However, in the more distantly related yeastYarrowia lipolytica, the OPI1 homolog was not found to regulate inositol biosynthesis, but alkane oxidation. In Candida albicans, the most common cause of humancandidiasis, its Opi1p homolog, CaOpi1p, has been shown to complement a S. cerevisiaeopi1∆ mutant for inositol biosynthesis regulation when heterologously expressed, suggesting it might serve a similar role in this pathogen. This was tested in the pathogen directly in this report by disrupting the OPI1 homolog and examining its phenotypes. It was discovered that the OPI1 homolog does not regulate INO1 expression in C. albicans, but it does control SAP2 expression in response to bovine serum albumin containing media. Meanwhile, we found that CaOpi1 represses filamentous growth at lower temperatures (30 °C) on agar, but not in liquid media. Although, the mutant does not affect virulence in a mouse model of systemic infection, it does affect virulence in a rat model of vaginitis. This may be because Opi1p regulates expression of the SAP2 protease, which is required for ratvaginal infections.
Candida albicans is a commensal organism that lives as a benign resident of the microflora of the human oral, gastrointestinal, and vaginal tracts as well as the skin. It can shift from a commensal to a pathogenic state in response to environmental stimuli that trigger developmental programs that induce the expression of virulence factors. Virulence factors exhibited by C. albicans include growth at 37°C, dimorphism, and production of secreted hydrolases such as proteases, lipases, and phospholipases [1, 2].The pathways that regulate the transcription of secreted aspartyl protease (SAP) virulence factors in C. albicans are beginning to be understood, but much remains to be learned. SAPs are encoded by a family of 10 related genes (SAP1 to SAP10) [3, 4]. Unlike SAP1 to SAP8, which encode secreted proteases, SAP9 and SAP10 encode GPI-anchored proteases, located at the cell membrane or cell wall, and both are required for virulence [5]. Among this family of genes, Sap2p is the most well-studied protease since it is the major secreted protease during in vitro growth conditions. SAP2 is expressed in in vitro conditions where bovine serum albumin is the main nitrogen source [3, 4], and its regulation in these conditions has been well characterized. SAP2 is under the control of the STP1 transcription factor and STP1’s upstream GATA transcription factors GLN3 and GAT1 [6, 7].The importance of SAP2 in pathogenesis has been discussed by several groups. For instance, De Bernardis et al. demonstrated that SAP2 is a major virulence contributor in the ratvaginitis model [8, 9]. Schaller et al. showed that SAP2 is required to cause tissue damage in an in vitro model of vaginal candidiasis [10]. In addition, Hube et al. demonstrated that SAP2 was required for virulence in a rodent model of systemic infection [11]. In contrast, Naglik et al. and Lermann and Morschhäuser found that SAP2 was not required to invade and damage oral or vaginal reconstituted human epithelium [12, 13]. Meanwhile, the effect of the aspartic protease inhibitorpepstatin A on reducing tissue damage caused by C. albicans in the reconstituted human epithelium model remains elusive. Naglik et al. showed that pepstatin A can attenuate tissue damage, while Lermann and Morschhäuser demonstrated no effect, leaving the role for the Sap family in inducing epithelial damage controversial [12, 13]. Thus, there is contradictory evidence about the role of SAP2 amd other SAPs in pathogenesis.S. cerevisiaeOPI1 (ScOPI1) is a negative regulator of inositol biosynthesis, and acts to inhibit the transcription of ScINO1 along with other phospholipid biosynthetic genes in response to extracellular inositol levels [14-17]. ScINO1 encodes the inositol-3-phosphate synthase (ScIno1p) that catalyzes the conversion of glucose-6-phosphate to inositol-3-phosphate, which is then dephosphorylated by INM1 or INM2 to form inositol [17-19]. Inositol and cytidyldiphosphate-diacylglycerol (CDP-DAG) are precursors for the essential phospholipid phosphatidylinositol (PI). ScOpi1p acts as the master regulator of ScINO1 and other target genes by inhibiting the transcriptional activators ScIno2p and ScIno4p. The mechanism by which it regulates these genes in response to extracellular inositol has been well described [15–17, 20–22].The structural gene encoding ScINO1 is conserved between S. cerevisiae and C. albicans, and shares similar function [23]. C. albicans and S. cerevisiaeINO1 homologs are similarly regulated in response to exogenously provided inositol [22]. The ScOPI1 ortholog in C. albicans (OPI1) can complement Scopi1Δ for INO1 regulation in S. cerevisiae [24]. We therefore hypothesized that OPI1 might function as an INO1 negative regulator in C. albicans as it does in Candida glabrata [25]. However, a report regarding the ScIno2p and ScIno4p homologs suggested that the regulation of INO1 expression in S. cerevisiae and C. albicans might not be conserved [26]. The C. albicans heterodimeric transcription factors INO2 and INO4 (related to ScINO2 and ScINO4 from S. cerevisiae) did not regulate INO1, but instead activated ribosomal protein genes such as RPL32. These results indicate that inositol regulation might be transcriptional rewired between these two related eukaryotic organisms. A previous report comparing S. cerevisiae and C. albicans Gal4p transcription factor homologs that control sugar metabolism suggests that these proteins have been rewired between these two organisms [27]. In C. albicans the Gal4p homolog activates the gluconeogenesis gene LAT1 instead of galactose metabolism genes such as GAL10, and surprisingly GAL10 was activated by another transcription factor, CPH1. Therefore, we wished to investigate if C. albicansOPI1 has a similar role in inositol regulation to ScOPI1 and CgOPI1, or if it has possibly been transcriptional rewired.In this communication, we report that C. albicansOPI1 does not regulate the inositol biosynthetic gene INO1, but affects the SAP2 expression and virulence of C. albicans in a ratvaginitis model. In addition, OPI1 affects morphogenesis at 30°C. These results illustrate that the regulation of inositol biosynthesis in C. albicans and S. cerevisiae is different. From now on, in this paper, all genes from C. albicans will be referred to by their simple names such as OPI1 or INO1, whereas genes from other organisms such as S. cerevisiae will be referred to as ScOPI1 or ScINO1.
Materials and Methods
Ethics Statement
Mouse model of systemic infection studies were conducted in the animal facility at University of Tennessee (UT) in good practice as defined by the United States Animal Welfare Act and in full compliance with the guidelines of the UT Institutional Animal Care and Use Committee (IACUC). The mouse experiments were reviewed and approved by the UT IACUC under protocol number L016. Procedures involving rats and their care were conducted in conformity with national and international laws and policies. The study has been approved by the Committees on the Ethics of Animal Experiments of the Istituto Superiore di Sanita’, Rome, Italy (Permit Number: DM 227/2009-B). All experimental procedures were carried out according to the ARRIVE (Animal Research: Reporting In Vivo Experiments; http://www.nc3rs.org.uk/page.asp?id=1357) and NIH (National Institutes of Health) guidelines for the ethical treatment of animals.
Strains and growth media
C. albicans strains used in this study are shown in Table 1. Media used in this study include YPD (yeast extract-peptone-dextrose: 1% yeast extract, 2% peptone, 2% glucose), defined medium 199 (M199, Invitrogen, pH7.0 adjusted by 150mM HEPES), Spider (1% nutrient broth, 1% mannitol, 0.2% dipotassium phosphate, 1.35% agar), YPD containing 10% fetal bovine serum, YCB-BSA (1.17% yeastcarbon base-Difco, 0.2% bovine serum albumin-Sigma),YCB-BSA-YE (1.17% yeastcarbon base, 0.2% bovine serum albumin, 0.1% yeast extract, pH 5.0) [28, 29]. Unless otherwise stated, agar plates were solidified with 2% agar (granulated, Fisher).
Table 1
Candida albicans strains used in this study.
Strains
Genotype
Parent
Source
SC5314 (wild-type)
Prototrophic wild type
Clinical isolate
[47]
YLC58
opi1Δ::NAT1-FLP/OPI1
SC5314
This study
YLC85
opi1Δ/OPI1
YLC58
This study
YLC86
opi1Δ/opi1Δ::NAT1-FLP
YLC85
This study
YLC88
opi1Δ/opi1Δ
YLC86
This study
YLC117
opi1Δ/opi1Δ::OPI1-NAT1
YLC88
This study
SAP2MS4A
sap2Δ/sap2Δ
SC5314
[37]
YLC223
OPI1/OPI1 URA3::PACT1 -SAP2
SC5314
This study
YLC226
opi1Δ/opi1Δ URA3::PACT1 -SAP2
YLC88
This study
Strain construction
The C. albicansOPI1 gene (OPI1) was disrupted by using the CaNAT1-FLP cassette [30] (Table 2). For the OPI1 disruption construct, the 379 base pair (bp) 5’ non-coding region (NCR) of OPI1 was amplified with primers TRO522 and TRO526 (Table 3), and cloned as a KpnI-ApaI digested 228bp fragment into pJK863 5’ of the CaNAT1-FLP cassette (Fig. 1A). The 448 bp 3’ NCR of OPI1 was amplified with primers TRO524 and TRO525 which introduced SacII and SacI sites, and was cloned into pJK863 3’ of the CaNAT1-FLPcassette (Fig. 1A). This created the OPI1 knock out construct plasmid pYLC36 (Table 2, Fig. 1A), which was cut with KpnI and SacI to release the disruption construct (5’ NCR of OPI1-CaNAT1-FLP-3’ NCR of OPI1) which was transformed into the wild type SC5314 strain by electroporation [31]. The disruption construct was used to sequentially disrupt both alleles of OPI1. The OPI1 reconstitution construct was made by amplifying a 1.7 Kb fragment containing the OPI1 ORF and 5’ NCR from SC5314 genomic DNA using primers (JCO12 and JCO14) that introduced KpnI and SalI sites. This fragment was ligated into the pRS316 vector along with another 1.7 Kb fragment containing the NAT1–3’NCR of OPI1 amplified from plasmid pYLC36 using primers JCO50 and TRO42 which introduced SalI and SacI sites. This resulted in the OPI1 reconstitution plasmid pYLC37 (Table 2, Fig. 1B). The 3.4 Kb KpnI-SacI fragment from pYLC37 was transformed into the opi1Δ/Δ mutant (YLC88) in order to create the reconstituted opi11Δ/Δ::OPI1 strain (YLC117). The SAP2 constitutive expression construct was made by cloning the dominant selectable marker NAT1 with primers JCO129 and JCO130 to NdeI-digested pAU34 [32] and resulted in pYLC219. The SAP2 ORF was then cloned to XmaI-digested pYLC219 with primers JCO131 and JCO132, and resulted in pYLC221, which can constitutively express SAP2 under the control of the ACT1 promoter. To transform this constitutive construct into wild type and opi1Δ/Δ strains, a PpuMI-digested linear plasmid pYLC221 was integrated at the URA3 site of Candida genome, and resulted in OPI1/OPI1URA3::P (YLC223) and opi1Δ/Δ URA3::P (YLC226).
pJK863 flanked 5’ and 3’OPI1NCR for OPI1 gene knock out
This study
pYLC37
OPI1 reconstitution construct
This study
pAU34
Constitutively expression construct under the control of ACT1 promoter
[32]
pYLC219
pAU34 contained NAT1 selectable marker
This study
pYLC221
pYLC219 contained SAP2 ORF for constitutive expression
This study
Table 3
Primers used in this study.
Primer
Use
Sequence (5’ à 3’)
JCO522
Disrupt OPI1
AAAAAAGGGCCCTACACACACACACACTTACACACAT
JCO526
Disrupt OPI1
AAAAAAGGGCCCCGGTTTCCCCCTTTTTATATA
JCO524
Disrupt OPI1
AAAAAACCGCGGTGAGTGGTGGTTTCTTTTTGTT
JCO525
Disrupt OPI1
AAAAAAGAGCTCCAAGTTGGACTACAAATGGTCAAG
JCO12
Restore OPI1
GTGTGGTACCTATTTCCAAATTCA
JCO14
Restore OPI1
AAAAGTCGACCTACTACACACTACCATCTA
TRO369a
Confirm OPI1 disruptions
GCACGTCAAGACTGTCAAGG
TRO532
Confirm OPI1 disruptions
ACGGCATGCTAGGTATATACTGCT
JCO48
ACT1 Northern blot probe
CCAGCTTTCTACGTTTCC
JCO49
ACT1 Northern blot probe
CTGTAACCACGTTCAGAC
JCO35
SAP2 Northern blot probe
TTCATTGCTCTTGCTATTGCT
JCO36
SAP2 Northern blot probe
CACCGGCTTCATTGGTTTTA
TRO562
INO1 Northern blot probe
GAAAACTCTGTTGTTGAAAAAGATG
TRO563
INO1Northern blot probe
TTGTTGGCACGTTCACTTTG
JCO129
SAP2 constitutive expression
AAAAAACATATGCCCCGCGGGATATCAAGC
JCO130
SAP2constitutive expression
AAAAAACATATGTGGGTACCGAATTCGAGCT
JCO131
SAP2 constitutive expression
AAAAAACCCGGGATGTTTTTAAAGAATATTTTC
JCO132
SAP2 constitutive expression
AAAAAACCCGGGTTAGGTCAAGGCAGAAATAC
JCO133
SAP2constitutive expression
AGAGAGCAGAAACTCATGCCT
JCO134
SAP2 constitutive expression
TAAGCATTCCAACCAGCATC
JCO122
SAP2constitutive expression
AAAAAAGGTACCCGTCAAAACTAGAGAATAATAAAG
JC798
SAP2 Real time PCR primer
TCCTGATGTTAATGTTGATTGTCAAG
JC799
SAP2 Real time PCR primer
TGGATCATATGTCCCCTTTTGTT
Figure 1
The OPI1 gene was disrupted in the strain SC5314 using the CaNAT1-FLP cassette.
(A) Structure of the opi1::CaNAT1-FLP disruption construct. Approximately 500 base pairs of non-coding DNA flanking the 5’ and 3’ ends of the OPI1 gene (5’-and 3’-NCR, respectively) were cloned onto either flank of the CaNAT1-FLP cassette. The thick dark arrows represent the FRT sites of the FLP recombinase. The ball-and-stick symbol represents the ACT1 terminator (ACT1t), and the thinner bent arrow represents the SAP2 promoter (P). (B) The OPI1-NAT1 construct used to reintegrate OPI1 into the opi1Δ/Δ mutant. (C) Southern blotting was used to confirm the opi1Δ/Δ disruptions. The genomic DNA of the wild type and mutants was cut by KpnI and SphI restriction enzymes. A PCR product containing the ~500 bp 3’ NCR of OPI1 (amplified with primers TRO524 and TRO525) was used as a probe (red line) for Southern blot confirmation. Lanes: 1, wild type; 2, opi1Δ::NAT1-FLP/OPI1 strain; 3, opi1Δ/OPI1 strain; 4, opi1Δ/Δ::NAT1-FLP strain; 5, opi1Δ/Δ strain; and 6, opi1Δ/Δ::OPI1-NAT1 strain.
The OPI1 gene was disrupted in the strain SC5314 using the CaNAT1-FLP cassette.
(A) Structure of the opi1::CaNAT1-FLP disruption construct. Approximately 500 base pairs of non-coding DNA flanking the 5’ and 3’ ends of the OPI1 gene (5’-and 3’-NCR, respectively) were cloned onto either flank of the CaNAT1-FLP cassette. The thick dark arrows represent the FRT sites of the FLP recombinase. The ball-and-stick symbol represents the ACT1 terminator (ACT1t), and the thinner bent arrow represents the SAP2 promoter (P). (B) The OPI1-NAT1 construct used to reintegrate OPI1 into the opi1Δ/Δ mutant. (C) Southern blotting was used to confirm the opi1Δ/Δ disruptions. The genomic DNA of the wild type and mutants was cut by KpnI and SphI restriction enzymes. A PCR product containing the ~500 bp 3’ NCR of OPI1 (amplified with primers TRO524 and TRO525) was used as a probe (red line) for Southern blot confirmation. Lanes: 1, wild type; 2, opi1Δ::NAT1-FLP/OPI1 strain; 3, opi1Δ/OPI1 strain; 4, opi1Δ/Δ::NAT1-FLP strain; 5, opi1Δ/Δ strain; and 6, opi1Δ/Δ::OPI1-NAT1 strain.
Northern blot analysis
Northern blotting for SAP2 and INO1 expression was performed as described [33, 34] with the following exceptions. Strains grown in YCB-BSA or YCB-BSA-YE medium at 37°C for 12 hrs (for SAP2) and in liquid medium 199 (pH 7.0) at 37°C for 2 hrs (for INO1) were collected for total RNA extraction by the hot phenol method. The PCR product containing bps 17–571 of the SAP2 ORF (primers JCO35 and JCO36) and bps 76–581 of the INO1 ORF (primers TRO562 and TRO563) were used as probes. Expression was normalized against C. albicansACT1 gene expression probed on the same membrane. The ACT1 probe was generated with the primers JCO48 and JCO49.
RT real-time PCR
Strains were cultured overnight in YPD at 37°C, washed twice with dH2O, then diluted to 0.2 O.D600/ml and incubated in liquid YCB-BSA medium (1.17% yeastcarbon base, 0.2% BSA) for 12 hrs at 37°C with shaking at 200 rpm. The 50 ml cultures were pelleted at 3000rpm at 4°C and immediately frozen with liquid nitrogen to stop cellular processes. Total RNAs were extracted with a RiboPure Yeast RNA Purification Kit (Ambion), treated with TURBO DNA-free Kit (Invitrogen), and 2 μg of DNA-free total RNAs was reverse transcribed to cDNA using High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems). Real-time PCR reactions of 20 μl included 6 ng cDNA (in 6 μl), 10 μl of 2x qPCR master mix (Fast SYBR Green Master Mix; Applied Biosystems), 2 μl of 2.5 μM forward primer (JC798 for SAP2), 2 μl of 2.5 μM reverse primer (JC799 for SAP2). Primer design for detecting SAPs expression was based on previous publication by Naglik et al [13]. Quantitative PCR conditions were shown below 95°C /10 min for denaturation; 95°C /3 sec, 60°C /30 sec (40 cycles); 95°C /15 sec, 60°C /60 sec, 95 °C /15 sec (melting curve). The StepOnePlus System and StepOne v2.2 (Applied Biosystems) were used to determine ∆∆Ct. The bar graphs of ACT1 normalized relative quantity compared with wild-type (SC5314) were created with Prism 5.03.
Southern blot analysis
Hybridization conditions for the Southern blot analysis were similar to those for Northern blot analysis, except that the Techne Hybrigene oven was set to 60°C for the incubation step, and 42°C and 60°C for washing steps. The cells were grown in liquid YPD at 30°C overnight. The genomic DNA was extracted using the Winston-Hoffman method [35] and 20μg of genomic DNA were subjected to Southern blotting. The genomic DNA of the wild type and opi1Δ/Δmutants was cut by KpnI and SphI restriction enzymes. PCR products containing the ~500bp 3’ NCR of OPI1(primers TRO524 and TRO525) were used as probes for Southern blot confirmation (Fig. 1C).
Mouse bloodstream infection studies
Five- to six-week-old male CD1mice (18 to 20 g) from Charles River Laboratories were used in this study. Mice were housed at five per cage. For infection, colonies from each C. albicans strain were inoculated into 20 ml of YPD. Cultures were grown overnight at 30°C with shaking in YPD, washed twice with 25 ml of sterile water, counted by hemocytometer, and resuspended at 107 cells per ml in sterile water. Mice were injected via the tail vein with 0.1 ml of the cell suspension (106 cells), and the course of infection was monitored for up to 14 days. The survival of mice was monitored twice daily, and moribund mice (body weight reduced by 30%, unable to eat/drink, or severely hunched) were euthanized with CO2. Cells were also plated on YPD to determine the viability. At least two independent infections were performed for each strain. The statistical analysis was done using Prism 5.03 software (GraphPad Software). For the mouse model of systemic infection, Kaplan-Meier survival curves were compared for significance using the Mantel-Haenszel log rank test. Statistical significance was set at P< 0.05.
Rat vaginitis studies
The protocol of estrogen-dependent ratvaginal infection model adapted from De Bernardis et al. [8] was used throughout this study. Briefly, oophorectomized female Wistar rats (80–100 g; Charles River, Calco, Italy) were injected subcutaneously with 0.5 mg of estradiol benzoate (Benzatrone; Samil, Rome). Six days after the first estradiol treatment, the animals were inoculated intravaginally with 107 yeast cells of each C. albicans strain in 0.1 mL. The inoculum was dispensed into the vaginal cavity through a syringe equipped with a multipurpose calibrated tip (Combitip; PBI, Milan, Italy). The yeast cells had been previously grown in YPD broth at 28°C on a gyratory shaker (200 rpm), harvested by centrifugation (1500 g), washed, counted in a hemocytometer, and suspended to the required number in saline solution. The results of two independent experiments are each represented separately. A third experiment involving all of the strains is not shown, but gave similar trends. In each experiment, each Candida strain was inoculated into 5 rats. Kinetics of C. albicans growth in, and clearance from, the vaginal cavity was measured by colony forming unit (CFU) enumeration after culturing 100 μl of vaginal samples, taken by washing the vaginal cavity by gentle aspiration of 100 μl of sterile saline solution, repeated four times, at 1:10 serial dilutions on Sabouraud agar containing chloramphenicol (50 μg/ml). CFUs were enumerated after incubation at 28°C for 48 h.
Results
C. albicans OPI1 does not regulate INO1 expression
When heterologously expressed in an S. cerevisiae Scopi1∆ mutant, the C. albicansOPI1 gene has been demonstrated to repress expression of a reporter gene that contains the inositol/choline responsive element (ICRE) found in ScINO1 and other ScOpi1p-ScIno2p-ScIno4p target genes [24]. This data suggested that C. albicansOpi1p may regulate the cognate C. albicansINO1 gene, as its homolog does in S. cerevisiae. In order to test this both copies of the C. albicansOPI1 gene were disrupted in C. albicans using the CaNAT1-FLP cassette [30] as described in Fig. 1.The wild type and opi1Δ/Δ strains were then compared to see if the opi1∆/∆ mutant would fail to repress INO1, as expected, if it acts like the homologous S. cerevisiae mutant, Scopi1∆ [22]. First, the strains were grown in Medium 199, pH 7.0, which contains low levels of inositol (~10 μM), which should result in high expression of INO1, and it was found that both upregulated INO1 to similar levels (Fig. 2). Then, they were grown in the same medium supplemented with 75 μM inositol, which should repress INO1 expression in wild-type, but not in the opi1∆/∆ mutant, if it cannot repress the gene. However, in both strains, INO1 was similarly repressed, suggesting that inositol biosynthesis is regulated by different transcription factors in C. albicans.
Figure 2
C. albicans OPI1 does not regulate INO1 expression.
Strains were grown for 2 hrs in Medium 199, pH7.0 (± 75 μM inositol) at 37°C, collected, and subjected to Northern blotting against INO1. ACT1 was reprobed on the same membrane as a loading control.
C. albicans OPI1 does not regulate INO1 expression.
Strains were grown for 2 hrs in Medium 199, pH7.0 (± 75 μM inositol) at 37°C, collected, and subjected to Northern blotting against INO1. ACT1 was reprobed on the same membrane as a loading control.
The opi1Δ/Δ mutant exhibits hyperfilamentous growth in filament-inducing media at 30°C
It has been shown that ScOPI1 is necessary to activate invasive growth and ScFLO11 expression in S. cerevisiae [34]. It was therefore hypothesized that OPI1 would affect filamentous growth in C. albicans. Three filament-inducing media were used to test this hypothesis. In contrast to the situation with the Scopi1∆ mutant in S. cerevisiae, it was found that the opi1Δ/Δ mutant exhibited hyperfilamentous growth rather than hypofilamentous growth, but only at 30°C on solid filament-inducing agar plates (Fig. 3). This effect was not observed at 37°C on similar media. These phenotypes were also not seen in liquid forms of the same filament-inducing media at either 30°C or 37°C. In order to control for a possible effect from some other unlinked mutation, a copy of the C. albicansOPI1 gene was reintegrated into the opi1∆/∆ mutant (Fig. 1B), and it was found that the phenotype was restored when the wild-type copy of OPI1 was present (Fig. 3), indicating that the hyperfilamentous growth at 30°C is linked to the loss of OPI1 gene.
Figure 3
The opi1∆/∆ mutant exhibits hyperfilamentous growth at 30°C in filament-inducing conditions on agar plates.
C. albicans strains from overnight cultures were diluted in sterile water and plated on the indicated medium and grown at 30°C for the indicated amount of time.
The opi1∆/∆ mutant exhibits hyperfilamentous growth at 30°C in filament-inducing conditions on agar plates.
C. albicans strains from overnight cultures were diluted in sterile water and plated on the indicated medium and grown at 30°C for the indicated amount of time.
OPI1 does not affect virulence in a mouse model of systemic infection
The opi1∆/∆ mutant appears to affect the ability of the fungus to repress filamentation at lower temperatures. Some hyperfilamentous mutants such as nrg1∆/∆ and tup1∆/∆ have been found to be attenuated in virulence in mouse models of infection [36]. Therefore, a mouse model of systemic infection was used to test the role of OPI1 in virulence. However, the OPI1 gene does not contribute to the virulence in this model since the opi1Δ/Δ mutant exhibits a similar phenotype to wild-type on the survival curves of mice (Fig. 4).
Figure 4
OPI1 is not required for virulence of C. albicans in a mouse model of systemic candidiasis.
Each strain was used to infect mice by injecting 106
C. albicans yeast-form cells into the tail-vein of each mouse. The mice were then assessed over the course of 14 days. The number of mice used for a specific strain is indicated in parentheses. The data obtained here are from a single experiment.
OPI1 is not required for virulence of C. albicans in a mouse model of systemic candidiasis.
Each strain was used to infect mice by injecting 106
C. albicansyeast-form cells into the tail-vein of each mouse. The mice were then assessed over the course of 14 days. The number of mice used for a specific strain is indicated in parentheses. The data obtained here are from a single experiment.
OPI1 is involved in establishing infection in the rat vaginitis model
In addition to infections of the bloodstream, C. albicans can also cause infections of mucosal surfaces including the vaginal tract [8]. A ratvaginitis model was used to determine if the opi1∆/∆ mutation would play a role in the establishment of infection in this host niche. It was demonstrated that OPI1 was involved in establishing ratvaginitis. In this model C. albicans cells are injected into the rat vaginal tract, and then over time the level of colonization is measured based on the recovery of colony counts. It was discovered that the opi1Δ/Δ mutant is quickly cleared by the host compared to the wild type (Fig. 5). The opi1∆/∆::OPI1 reintegrant strain and opi1∆/OPI1 heterozygous mutant had an intermediate phenotype between the opi1Δ/Δ mutant and wild type (Fig. 5).
Figure 5
OPI1 is involved in establishing infection in the rat vaginitis model.
For each C. albicans strain, 5 rats were inoculated on day 0 with 107 blastospores, and vaginal colony forming units (CFUs) at particular time points were counted by plating at the indicated time points. The error bars represented the standard errors of the mean in each group. The number of rats used for a specific strain is indicated in parentheses and the data obtained here are from a single experiment.
OPI1 is involved in establishing infection in the rat vaginitis model.
For each C. albicans strain, 5 rats were inoculated on day 0 with 107 blastospores, and vaginal colony forming units (CFUs) at particular time points were counted by plating at the indicated time points. The error bars represented the standard errors of the mean in each group. The number of rats used for a specific strain is indicated in parentheses and the data obtained here are from a single experiment.It has been shown that deletion of the C. albicansSAP2 proteasegene [8] causes a similar clearance to the opi1∆/∆ mutant, and a sap2∆/∆ mutant (SAP2MS4A) [37] was included in this experiment as a control. Our results confirmed that an independently constructed sap2∆/∆ mutant (gift from Joachim Morschhäuser), behaved like a previously constructed sap2∆/∆ mutant, and exhibits reduced colonization in the rat vaginal tract (Fig. 5), suggesting the importance of SAP2 in the ratvaginitis model. Our results also indicate that OPI1 plays a critical role in establishing infection in the rat vaginal tract (Fig. 5).
OPI1 affects rat vaginal establishment through regulating SAP2
The similarity of the phenotypes of the opi1∆/∆ mutant with the sap2∆/∆ mutant suggested that OPI1 might act through SAP2. In wild-type cells, SAP2 is upregulated in bovine serum albumin (BSA) media. We performed reverse transcriptase (RT) real-time PCR to detect if OPI1 controls SAP2 expression in YCB-BSA medium. The opi1∆/∆ mutant showed 5.5 fold reduced SAP2 expression compared to wild type (Fig. 6), indicating that OPI1 controls SAP2 expression. The opi1∆/∆::OPI1 reintegrant strain can restore the SAP2 expression and actually shows ~ 3 fold higher expression of SAP2 than the wild type.
Figure 6
SAP2 expression is regulated by OPI1 in C. albicans.
RT real-time PCR was used to assess the SAP2 expression levels in the wild-type (SC5314), opi1Δ/Δ, opi1Δ/Δ::OPI1 and sap2 Δ/Δ mutants. Strains were cultured overnight in YPD at 37°C, washed twice with dH2O. Then strains were diluted to 0.2 O.D600/ml and incubated in liquid YCB-BSA medium (1.17% yeast carbon base, 0.2% BSA) for 12 hrs at 37°C. The error bars represented the standard errors of the mean. The data obtained here are from a representative single experiment with technical triplicates. P value was determined by t tests and < 0.05 was considered statistically significance.
SAP2 expression is regulated by OPI1 in C. albicans.
RT real-time PCR was used to assess the SAP2 expression levels in the wild-type (SC5314), opi1Δ/Δ, opi1Δ/Δ::OPI1 and sap2 Δ/Δ mutants. Strains were cultured overnight in YPD at 37°C, washed twice with dH2O. Then strains were diluted to 0.2 O.D600/ml and incubated in liquid YCB-BSA medium (1.17% yeastcarbon base, 0.2% BSA) for 12 hrs at 37°C. The error bars represented the standard errors of the mean. The data obtained here are from a representative single experiment with technical triplicates. P value was determined by t tests and < 0.05 was considered statistically significance.In order to test if OPI1 affects colonization of the rat vaginal tract through SAP2, an epistasis experiment was performed in which the SAP2 gene was overexpressed in the opi1∆/∆ mutant via the ACT1 promoter (P). This overexpression was confirmed by Northern blotting (S1 Fig.). If opi1∆/∆ blocked rat colonization by compromising SAP2 expression, then overexpression of SAP2 from an independent promoter should suppress the phenotype. In contrast to the opi1∆/∆ mutant, the opi1Δ/ΔURA3::P mutant was suppressed for its defect in ratvaginal infection, and behaved similarly to the wild type (Fig. 7). This implicates the OPI1 gene as a regulator of SAP2 in the vaginal tract of the rat.
Figure 7
OPI1 affects rat vaginal establishment through regulating SAP2.
For each strain 5 rats were inoculated on day 0 with 107 blastospores, and vaginal CFUs were counted by plating at the indicated time points. The error bars represented the standard errors of the mean in each group. The number of rats used for a specific strain is indicated in parentheses and the data obtained here are from a single experiment.
OPI1 affects rat vaginal establishment through regulating SAP2.
For each strain 5 rats were inoculated on day 0 with 107 blastospores, and vaginal CFUs were counted by plating at the indicated time points. The error bars represented the standard errors of the mean in each group. The number of rats used for a specific strain is indicated in parentheses and the data obtained here are from a single experiment.
Discussion
Our results show that the OPI1 gene of C. albicans, unlike its homologs in S. cerevisiae and C. glabrata [22, 25], does not affect INO1 expression, but does repress filamentous growth at low temperature (Fig. 3) and regulates virulence in the ratvaginitis model (Figs. 5 and 7). The latter phenotype appears to be mediated by changes in SAP2 expression. The opi1Δ/Δ mutant exhibits reduced SAP2 expression compared with the wild type in liquid YCB-BSA medium (Fig. 6), and in vivo SAP2 overexpression can restore the opi1Δ/Δ mutant’s vaginal colonization defect, when under the control of the constitutive ACT1 promoter. Epistasis experiments are inherently challenging to interpret, as overexpression of a target gene such as SAP2 could lead to enhanced colonization by a mechanism that bypasses the actual defect caused by the opi1∆/∆ mutation. Based on our data, this possibility cannot be completely ruled out. It is also possible that OPI1 controls colonization in the rat vaginal tract by regulating one of the other SAPs (e.g. SAP1, SAP3–10). However, as the differential expression of nine other SAPs in the opi1∆/∆ mutant compared to the wild type using the same condition (i.e. YCB-BSA liquid medium and RT real time PCR) was not detected, we do not know if these others are affected in vivo, and this remains to be examined (unpublished data). Meanwhile, further studies will be needed to test if SAP4, SAP5 and SAP6 genes are regulated by OPI1 under hypha-inducing conditions since SAP4–6 are hypha-specific genes [38, 39].In S. cerevisiae, ScOpi1p is the master regulator of ScINO1 and other phospholipid genes [15–17, 20]. ScOpi1p controls expression in response to cellular inositol levels by binding to Ino2p in the Ino2p-Ino4p heterodimer and repressing its activation of ScINO1, among other targets. When inositol is plentiful, PI is efficiently synthesized from CDP-DAG and inositol by the ScPis1p enzyme [40, 41]. In this circumstance, the endoplasmic reticulum (ER) localized pool of phosphatidic acid (PA), which is the precursor for CDP-DAG, is consumed, and ScOpi1p is translocated to the nucleus. There, it binds ScIno2p and represses ScINO1 with help from the global repressor Sin3p via a direct interaction involving the N-terminal Sin3p binding domain of ScOpi1p [16, 24]. When inositol is not plentiful in the environment, cellular stores drop and PI synthesis slows causing a build-up of precursors including PA. ScOpi1p binds to PA in the ER via its basic domain, and the ER membrane protein Scs2p via its FFAT domain [20, 42]. This sequesters ScOpi1p to the ER, and then Ino2p-Ino4p activate transcription of ScINO1 so inositol can be synthesized for PI production.A previous report demonstrated that OPI1 from C. albicans could complement an Scopi1∆ mutant in S. cerevisiae, and it could repress the ICRE promoter element found on ScINO1 and other phospholipid biosynthetic genes when expressed heterologously in S. cerevisiae [24]. However, we found that in C. albicans, OPI1 does not regulate INO1 expression. This overlap in function of CaOPI1 when expressed heterologously in S. cerevisiae, but not endogenously in C. albicans, may be due to the conservation of some key domains required for ScOpi1p function, but not the conservation of other domains (S2 Fig.). In particular, the C. albicansOpi1p has very little conservation with ScOpi1p in the large N-terminal ScSin3p binding domain [16]. However, CaOpi1p does have some conserved sequences with the C-terminal ScIno2p interaction domain of ScOpi1p, including two out of three residues (ScOpi1p aas 358–360) that were shown to be crucial for ScIno2p-ScOpi1p interactions in S. cerevisiae [16]. In contrast, CaOpi1p shares very few residues in common with ScOpi1p in the PA-binding basic domain, and no residues of the FFAT domain that binds to ScScs2p [20, 42]. It does, however, carry a leucine zipper motif with some isoleucine substitutions that has been shown to be crucial for ScIno2p-ScOpi1p interactions [15]. Thus, this conservation of some domains, but not others may help explain why CaOpi1p can complement a Scopi1∆ mutant for ScINO1 repression [24], but not act the same within C. albicans itself. Further support for our findings comes from the observation that CaINO2 and CaINO4 do not appear to regulate CaINO1 either, but may actually regulate ribosomal genes [26]. This is in marked contrast to CgOPI1 from C. glabrata, which does regulate CgINO1 with help from CgINO2 and CgINO4 [25]. Consistently, CgOpi1p has close conservation of all of the important regulatory domains of ScOpi1p (S2 Fig.). Interestingly, one other ScOpi1p homolog has been characterized, and this is Yas3p from Yarrowia lipolytica. Yas3p also does not have a number of domains conserved with ScOpi1p, and like CaOpi1p does not regulate YlINO1, but does, along with Ino2p and Ino4p homologs Yas1p and Yas2p, respectively, regulate hexane metabolism genes [43]. The C. albicans regulators of CaINO1 are currently unknown, and this will be interesting to elucidate, as expression of CaINO1 is regulated by extracellular inositol levels, but not by CaOpi1p and apparently not by CaIno2p or CaIno4p either.Finally, the role Opi1p in repressing filamentation at 30°C on solid media remains elusive (Fig. 3). The opi1Δ/Δ mutant exhibits hyperfilamentous growth in filament-inducing agar plates including medium 199, spider, and 10% serum at 30°C, but not 37°C. These results indicate that OPI1 might be a low temperature repressor of filamentous growth. It has been demonstrated that C. albicans CPP1, a tyrosine phosphatase, is required tor repress the yeast to hyphal transition at 23°C in contact with solid surfaces [44, 45]. The cpp1Δ/Δ mutant exhibited hyperfilamentous growth on spider and a wide variety of rich and defined solid media including Lee’s medium, YPD, YPM, and 10% serum at 23°C, but not at 37°C. The germ tube formation defect of the cpp1Δ/Δ mutant was not observed at liquid culture at 37°C, an effect similar to opi1Δ/Δ mutant. In contrast to opi1Δ/Δ, the cpp1Δ/Δ mutant exhibited reduced virulence in mousesystemic infection and mousemastitis models [44-46]. The relationship between Opi1 and Cpp1 is unknown and needs further studies in C. albicans. Taken together, our data suggest that, when compared to its homolog in S. cerevisiae, C. albicans has a transcriptionally rewired regulator, OPI1, which does not regulate INO1 expression but affects morphogenesis, SAP2 expression and virulence in a ratvaginitis model. It also makes it clear that identification of ScOpi1p homologs in other fungi does not clearly implicate them for roles in regulating inositol biosynthesis in these microbes. Rather, the Opi1p family members, which are conserved in a wide variety of fungi appear to have a diversity of functions.
SAP2 is overexpressed in the P construct.
Expression was tested by Northern blotting in YPD media, and it was confirmed that the P construct overexpressed SAP2.(TIF)Click here for additional data file.
Multiple sequence alignment comparing Opi1p homologues of S. cerevisiae (S.C.), C. glabrata (C.G.), Y. lipolytica (Y.L.), and C. albicans (C.A.).
This alignment was performed using Clustal W. 2.0.1.0. Asterisk represents conservation among all four species. Various domains represented by different colors, and boxes highlight particularly conserved regions between species. Blue: Opi1-Sin3 interaction domain. Gold: phosphatidic acid (PA)-binding domain. Red: Leucine zipper. Green: FFAT (2 phenylalanines and an acid tract). Purple: Polyglutamine tract. Orange with black boxes: Ino2p activator interaction domain.(TIF)Click here for additional data file.
Authors: Julian R Naglik; David Moyes; Jagruti Makwana; Priya Kanzaria; Elina Tsichlaki; Günther Weindl; Anwar R Tappuni; Catherine A Rodgers; Alexander J Woodman; Stephen J Challacombe; Martin Schaller; Bernhard Hube Journal: Microbiology (Reading) Date: 2008-11 Impact factor: 2.777
Authors: Sonia Villa; Mohammad Hamideh; Anthony Weinstock; Mohammad N Qasim; Tony R Hazbun; Adnane Sellam; Aaron D Hernday; Shankar Thangamani Journal: FEMS Yeast Res Date: 2020-02-01 Impact factor: 2.796