| Literature DB >> 25551388 |
Lorraine Rodriguez-Bonilla1, Hugo E Cuevas2, Milly Montero-Rojas1, Fernando Bird-Pico1, Dianiris Luciano-Rosario1, Dimuth Siritunga1.
Abstract
Sweet potato (Ipomoea batatas L.) is the seventh most important food crop due to its distinct advantages, such as adaptability to different environmental conditions and high nutritional value. Assessing the genetic diversity of this important crop is necessary due to the constant increase of demand for food and the need for conservation of agricultural and genetic resources. In Puerto Rico (PR), the genetic diversity of sweet potato has been poorly understood, although it has been part of the diet since Pre-Columbus time. Thus, 137 landraces from different localities around PR were collected and subjected to a genetic diversity analysis using 23 SSR-markers. In addition, 8 accessions from a collection grown in Gurabo, PR at the Agricultural Experimental Station (GAES), 10 US commercial cultivars and 12 Puerto Rican accessions from the USDA repository collection were included in this assessment. The results of the analysis of the 23 loci showed 255 alleles in the 167 samples. Observed heterozygosity was high across populations (0.71) while measurements of total heterozygosity revealed a large genetic diversity throughout the population and within populations. UPGMA clustering method revealed two main clusters. Cluster 1 contained 12 PR accessions from the USDA repository collection, while cluster 2 consisted of PR landraces, US commercial cultivars and the PR accessions from GAES. Population structure analysis grouped PR landraces in five groups including four US commercial cultivars. Our study shows the presence of a high level of genetic diversity of sweet potato across PR which can be related to the genetic makeup of sweet potato, human intervention and out-crossing nature of the plant. The history of domestication and dispersal of sweet potato in the Caribbean and the high levels of genetic diversity found through this study makes sweet potato an invaluable resource that needs to be protected and further studied.Entities:
Mesh:
Substances:
Year: 2014 PMID: 25551388 PMCID: PMC4281141 DOI: 10.1371/journal.pone.0116184
Source DB: PubMed Journal: PLoS One ISSN: 1932-6203 Impact factor: 3.240
Twenty-three SSR marker primers with their respective sequence, annealing temperatures, repeat motifs and allele size.
| Name | Forward Primer | Reverse Primer | Annealing °C | Motif | Allele Size | HO | HT |
| IB242a | gcggaacggacgagaaaa | atggcagagtgaaaatggaaca | 58 | (ct)3ca(ct)11 | 136–155 | 0.89 | 0.84 |
| IB297a | gcaatttcacacacaaacacg | cccttcttccaccactttca | 58 | (ct)13 | 150–182 | 0.76 | 0.84 |
| IB324b | tttggcatgggcctgtatt | gttcttctgcactgcctgattc | 56 | - | 136–152 | 0.73 | 0.78 |
| IBCIP-1c | cccacccttcattccattact | gaacaacaacaaaaggtagagcag | 63 | (acc)7a | 155–167 | 0.79 | 0.74 |
| IBS10d | ctacgatctctcggtgacg | cagcttctccactccctac | 60 | (ct)12 | 307–337 | 0.49 | 0.86 |
| IBS11d | ccctgcgaaatcgaaatct | ggacttcctctgccttgttg | 58 | (ttc)10 | 254–305 | 0.95 | 0.88 |
| IBR13d | gtaccgagccagacaggatg | cctttgggattggaacacac | 58 | (ttc)6 | 225–298 | 0.73 | 0.88 |
| IBS17d | cagaagagtacgttgctcag | gcacagttctccatcctt | 58 | (gga)4 | 182–204 | 0.96 | 0.87 |
| IBS18d | ctgaacccgacagcacaag | gggaagtgaccggacaaga | 58 | (tagc)4 | 296–298 | 0.45 | 0.70 |
| IBR21d | gacagtctccttctcccata | ctgaagctcgtcgtcaac | 58 | (gac)5 | 181–207 | 0.80 | 0.63 |
| IBC12e | tctgagcttctcaaacatgaaa | tgagaattcctggcaaccat | 56 | (ttc)6 | 110–134 | 0.86 | 0.87 |
| J175e | atctatgaaatccatcactctcg | actcaattgtaagccaaccctc | 58 | (aatc)4 | 133–149 | 0.87 | 0.88 |
| J10ae | tcaaccactttcattcactcc | gtaattccaccttgcgaagc | 58 | (aag)6 | 191–225 | 0.79 | 0.85 |
| J67e | cacccatttgatcatctcaacc | ggctctgagcttccattgttag | 58 | (gaa)5 | 191–217 | 0.94 | 0.80 |
| J116ae | tcttttgcatcaaagaaatcca | cctcagcttctgggaaacag | 58 | (cct)6 | 207–251 | 0.65 | 0.88 |
| IB1809e | cttctcttgctcgcctgttc | gatagtcggaggcatctcca | 60 | (cct)6(ccg)6 | 144–155 | 0.78 | 0.81 |
| IBJ544be | agcagttgaggaaagcaagg | caggatttacagccccagaa | 61–62 | (tct)5 | 191–214 | 0.76 | 0.66 |
| IBS01f | tcctccaccagctctgattc | ccattgcagagccatacttg | 56 | (aga)10 | 233–268 | 0.37 | 0.67 |
| IB-R16d | gacttccttggtgtagttgc | agggttaagcgggagact | 60 | (gata)4 | 201–203 | 0.63 | 0.61 |
| IB-R19f | ggctagtggagaaggtcaa | agaagtagaactccgtcacc | 60 | (cag)5 | 190–208 | 0.15 | 0.65 |
| IB-R03d | gtagagttgaagagcgagca | ccatagacccattgatgaag | 58 | (gcg)5 | 243–258 | 0.42 | 0.65 |
| IB-R08f | ggcgacaccttagagtat | cacccccctattcacaa | 50 | (t3a)4 | 204–216 | 0.86 | 0.70 |
| IB-S07d | gcttgcttgtggttcgat | caagtgaagtgatggcgttt | 60 | (tgtc)7 | 193–211 | 0.59 | 0.79 |
HO: Observed heterozygosity.
HT: Total heterozygosity.
SSR Source: a Buteler et al. [12]; b Tseng et al. [15]; c Yañez [18]; d Benavides (unpublished data; 2002–2003 at CIP); e Solis et al. (unpublished data; 2005–2006 developed at CIP); f Yada et al. [17].
Figure 1Distribution of the number of alleles per locus analyzed for 23 SSR loci in 167 accessions of sweet potato (Ipomoea batatas).
Summary statistics of genetic diversity estimators at 23 SSR loci for 167 sweet potato samples.
| Group | NoA | Ho | HT | Gis |
|
| 8.65 | 0.80 | 0.80 | 0.00 |
|
| 4.68 | 0.70 | 0.72 | 0.01 |
|
| 7.18 | 0.66 | 0.72 | 0.08 |
|
| ||||
|
| 6.50 | 0.85 | 0.75 | −0.13 |
|
| 4.95 | 0.70 | 0.67 | −0.03 |
|
| 4.04 | 0.67 | 0.70 | 0.03 |
|
| 5.63 | 0.69 | 0.71 | 0.03 |
|
| 5.09 | 0.71 | 0.70 | −0.01 |
|
| 4.76 | 0.59 | 0.66 | 0.10 |
|
| 4.49 | 0.68 | 0.67 | 0.00 |
|
| 4.72 | 0.54 | 0.71 | 0.23 |
|
| 11.08 | 0.71 | 0.78 | 0.05 |
|
| 1.15 | 0.04 | 0.02 | 0.04 |
(NoA: Number of Alleles, Ho: Observed Heterozygosity, HT: Total Heterozygosity, Gis: Inbreeding Coefficient).
Figure 2Polymorphic Index Content (PIC) value of the 23 SSR loci analyzed in 167 accessions of sweet potato (Ipomoea batatas).
Figure 3Population structure and UPGMA clustering based on Euclidean distances of 167 accessions of sweet potato (Ipomoea batatas) analyzed with 23 SSR markers.
Eight accessions are from the agricultural experimental station in Gurabo, Puerto Rico (GAES), 22 from the plant genetic resources conservation unit (PGRCU) in Griffin, GA (12 PR accessions and 10 known US commercial cultivars) and 137 Puerto Rico landraces across the island were analyzed. The eight groups (Group 1: olive green, Group 2: pink, Group: navy blue, Group: orange, Group: purple, Group: lime green, Group: red, and Group: blue) were determined based on STRUCTURE and Evanno et al. [26] analysis. The colors of the branches in the dendrogram also indicates the groups while the highlight of the name refers to PRGCU (olive green), GAES (pink), US cultivars (navy blue) and PR landraces (light gray).
Figure 4Delta K values with respect to K (number of groups) according to the calculation method by Evanno et al. [26].
These results were obtained based on the analysis of 23 SSR markers in 167 accessions of sweet potato from the agricultural experimental station in Gurabo, Puerto Rico (12 accessions), the plant genetic resources conservation unit in Griffin, GA (22 accessions) and 137 Puerto Rico landraces.