Correlation of renin angiotensin system (RAS) candidate gene polymorphisms with response to Ramipril in patients with essential hypertension.

BACKGROUND: The renin-angiotensin system (RAS) is an important facet of blood pressure regulation physiology. Treatment of essential hypertension targets the RAS using Angiotensin Converting Enzyme Inhibitors (ACEIs). However, ACEIs are not uniformly effective and show inter-individual pharmacodynamic variations. AIM: To assess the correlation between genetic polymorphisms in the genes coding for RAS components (angiotensin converting enzyme (ACE I/D), α-adducin (ADD1) and β1 -adrenoreceptor (β1-ADR)) and response to Ramipril.
MATERIALS AND METHODS: We recruited 120 patients with essential hypertension who were administered Ramipril monotherapy initially, followed by combination therapy, if needed, based on their responses. Relationship between genotypes of the three candidate genes and decrease in the blood pressure (BP) was analyzed.
RESULTS: One hundred and six patients were evaluable at the end of the study period and 21 different genotypes were observed among them. Seven of them were classified as responders after 8 weeks and at the end of 12 weeks, an additional 77 (72.64%) were deemed responders. 19/22 non-responders were treated with combination therapy and 7/19 (36.84%) showed a response to the same. There was a significant difference between the proportions of responders and non-responders among the genotypes of the ADD1 and β1-ADR genes (P=0.005 and 0.003, respectively). The best predictors of response to Ramipril 5 mg daily were the II/GG/SS, II/TG/SS, II/GG/SG, ID/GG/SS, ID/GG/SG and ID/TT/SS and DD/GG/SS; II/GG/GG, II/TT/SG, ID/TG/SG, ID/TT/SG, DD/GG/SG and DD/GG/GG were moderately predictive and II/TT/SS, II/TG/GG, ID/TG/GG, DD/TG/SG and DD/TG/GG were poorly predictive of response. DISCUSSION: Variable responses to Ramipril may be the result of genetic factors.
CONCLUSION: Pre-prescription genotyping may help individualize treatment.

Introduction

Hypertension is a major public health problem,[1] with India heading towards becoming the “Hypertension Capital of the World”.[2] Essential hypertension is a heterogeneous group of diseases with the common characteristic of elevated blood pressure (BP).

One of the major components of blood pressure regulation physiology is the renin-angiotensin system (RAS). The RAS has several sub-components — angiotensin converting enzyme (ACE), which converts Angiotensin I to Angiotensin II, α adducin (ADD1), which plays a role in renal sodium reabsorption[3] and the β1-adrenoreceptor (β-1 ADR), which stimulates rennin release.

The RAS not only plays a role in the development of hypertension, but also leads to disease progression by promoting vasoconstriction, sodium reabsorption, cardiac remodeling and norepinephrine release among other potentially detrimental actions.[4] Inhibition of the RAS is the mechanism of action of angiotensin converting enzyme inhibitors (ACEIs) — one of the most commonly used classes of drugs for controlling elevated BP. However, significant variation has been observed in the response to Ramipril, an ACEI, among hypertensive patients.[5]

It is believed that this variation in Ramipril pharmacodynamics is the result of polymorphisms in genes coding for the RAS sub-components. The complimentary physiological relationship between ACE I/D, ADD1 and β-1 ADR genetic polymorphisms in the regulation of BP [Figure 1] is hypothesized to influence the response to ACE inhibitors. These polymorphisms are: Insertion (I) or deletion (D) alleles in the ACE gene, Gly460Trp in the ADD1 gene and Ser49Gly in the β-1 ADR gene.[6]

Figure 1

Multiple genes contribute to the role of RAS in the development of hypertension

Therefore, the present study was planned to correlate polymorphisms in these 3 candidate genes with variation in the therapeutic response to Ramipril.

Materials and Methods

Ethics

The study was approved by the Institutional Review Board and written informed consent was obtained from all participants.

Design

A cross-sectional study was conducted at the M. M. Institute of Medical Science and Research, Mullana, Haryana.

Inclusion criteria

Patients of the Haryanvi Jat ethnicity living in a rural area for more than 2 generations with occasional travel to the city were included. They were of age 18-80 years; with an average BP > 140/90 mm Hg on 3 separate occasions, in who the proposed management plan included therapy with Ramipril alone or in combination with Hydrochlorthiazide or Metoprolol.

Exclusion criteria

Patients who were pregnant, lactating, had elevated liver enzymes, had elevated BP along with (were hypertensives) Diabetes, required 3 or more drugs or commuted daily to the city were excluded from the study.

Sample size calculation

A cross-sectional survey conducted by our institute showed that of 35,000 inhabitants in 21 villages of rural Haryana (data validated by the 2001 Census report of India), 1890 individuals had essential hypertension as defined in the inclusion criteria. Therefore, the disease prevalence for essential hypertension was 5.4%.

Using Daniel's formula[7], we calculated a sample size of 79 patients with a power of 80% at 5% significance. However, in order to account for loss to follow up, we recruited 120 patients.

Clinical methodology

The blood pressure for all participants was recorded by physicians in the outpatient department in a quiet environment using standard procedures.[8]

Once the diagnosis of essential hypertension was made, treatment of cases was initiated with the ACE inhibitor Ramipril, given at the dose of 1.25 mg once daily. Blood pressure was measured again after 4 weeks to assess the response.

Classification of responders and non-responders

If there was a fall of ≥10 mmHg in systolic and diastolic blood pressures, the patient was classified as a responder to Ramipril therapy. Such patients were continued on the same dose of the drug.

Patients who did not show such a change in their blood pressures were given an increased dose of Ramipril. The dose was increased in a stepwise manner from 1.25 mg to 2.5 mg to 5 mg once a day and response was re-checked every four weeks.

Patients who failed to respond to 5 mg Ramipril once daily for four weeks were classified as non-responders and a second drug was added to their treatment regimens.[9]

Lab methodology

Genomic DNA was extracted from venous blood samples of both cases using the modified salting out procedure described by Miller.[10] Genotyping was performed to detect the insertion (I) or deletion (D) alleles of the ACE gene; the Gly460Trp single nucleotide polymorphism (SNP) of the ADD1 gene; and the Ser49Gly SNP of the β-1 ADR gene.

Genotyping for ACE I/D

The ACE gene is said to have the insertion (I) or deletion (D) allele based on the presence or absence of a 287 bp sequence in intron 16.

The ACE I/D alleles were detected by polymerase chain reaction (PCR)[11] using primers that would flank the 287 bp sequence. All samples identified as homozygotes for the D allele (DD), were re-tested with an insertion-specific primer pair (Gen bank accession number GQ449380, GQ449383): Forward primer: 5′-GCCACTACGCCCGGCTAAT-3′; Reverse primer: 5-′- GATGTGGCCATCACATTCGTCAGAT-3′. The PCR products were resolved on 2% agarose gel and visualized following ethidium bromide staining (NuSieve, 3:1 agarose, FMC Bioproducts).

Genotyping for ADD1

The SNP that leads to the Gly460Trp variation in the amino acid sequence for α-adducin is located at nucleotide position 614 of exon 10 of the ADD1 gene (Gen bank accession number L29294). This SNP was detected using amplification refractory mutation system PCR.[12] The following primer sets were used: F614G, 5′-GGGGCGACGAAGCTTCCGAGGTAG-3′; F614T5′-GCTGAACTCTGGCCCAGGCCGACGAAGCTTCCGAGGATT-3′; R614 5′-CCTCCGAAGCCCCAGCTACCCA-3′.

The sizes of the PCR products were 220 bp and 234 bp for the 460Gly and 460Trp alleles, respectively, and were resolved clearly on 4% agarose gel [Figure 2b] to determine if the patient had GG, GT or TT genotype (NuSieve, 3:1 agarose, FMC Bioproducts).

Figure 2

(a) A representative agarose gel photography of PCR products showing the amplification for ACE I/D polymorphism, (b) Representative agarose gel electrophoresis showing the amplification of Gly460Trp α-adducin polymorphism, (c) A representative agarose gel photography of PCR products showing the amplification for Ser49Gly β-1 ADR polymorphism

Genotyping for β-1 ADR Polymorphism

The SNP (Gen bank accession number C_8898494_10) that leads to the Ser49Gly variation in the amino acid sequence for β-1 adrenoceptors is located at position 145 in codon 49. The sequence containing this polymorphism was amplified using PCR.[13] The sense and antisense primers used were: 5′CCGGGCTTCTGGGGTGTTCC3-′ and 5′GGCGAGGTGATGGCGAGGTAGC3-′. The 564 bp PCR product was digested using the enzyme Eco 0109I [New England biolabs] (giving 345 and 219 bp fragments if the polymorphism was present. The fragments were separated using restriction fragment length polymorphism [Figure 2c] to determine if the patient had SS, SG or GG genotype.

Data analysis

Data was analyzed using the statistical package for social sciences (SPSS 16.0) for Windows and was tested for normality. Continuous variables were expressed as means with standard deviations (SDs). Intergroup comparisons were made using the Student's t test. Differences between the groups were calculated using one-way analysis of variance. A P-value of <0.05 was considered statistically significant.

Results

Demographic data

One hundred and twenty cases (n = 120) with essential hypertension were recruited. This included 71 (59.2%) males and 49 (40.8%) females. The ages of males ranged from 21 to 82 years with a mean age of 52.8 ± 14.3 years and females were aged 40 to 75 years with a mean age of 56.1 ± 8.0 years. Of the 120 cases, 14 (11.67%) were lost to follow-up and a total of 106 (88.33%) patients eventually completed the study protocol.

Responders and non responders

At the end of the fourth week, none of the 106 patients could be classified as responders. After 8 weeks, and at a dose of 2.5 mg daily, 7 patients (6.60%) were classified as responders and at the end of 12 weeks, an additional 77 (72.64%) were deemed responders [Table 1].

Table 1

Distribution of responders and non responders in hypertensive patients after treatment with ACE inhibitor (Ramipril)

Genotype	4 week follow up at 1.25 mg daily		P-value	8 week follow up after increasing the dose at 4 weeks to 2.5 mg daily		P-value	12 week follow up after increasing the dose (if needed) at 8 weeks to 5 mg daily		P-value
ACE gene	R	NR	—	R	NR	0.001	R	NR	0.315
I/D (n=49)	00	49 (100)		01 (2)	48 (98)		40 (82)	09 (18)
D/D (n=30)	00	30 (100)		00	30 (100)		21 (70)	09 (30)
I/I (n=27)	00	27 (100)		06 (22)	21 (78)		23 (85)	04 (15)
ADD1 gene	R	NR	—	R	NR	0.281	R	NR	0.005
G/G (n=61)	00	61 (100)		06 (10)	55 (90)		55 (90)	06 (10)
T/G (n=35)	00	35(100)		01 (3)	34 (97)		23 (66)	12 (34)
T/T (n=10)	00	10 (100)		00	10 (100)		6 (60)	04 (40)
B1-ADR gene	R	NR	—	R	NR	0.307	R	NR	0.003
S/S (n=49)	00	49		04 (8)	45 (92)		44 (90)	05 (10)
S/G (n=41)	00	41		03 (7)	38 (93)		32 (78)	09 (22)
G/G (n=16)	00	16		00	21 (100)		08 (50)	08 (50)

Thus, 84/106 (79.25%) were eventually classified as responders and 22 (20.75%) were classified as non-responders. A total of 19/22 non-responders agreed to be treated with combination therapy. Of these, 7/19 (36.84%) showed a response to combination therapy and the rest did not.

Genotyping data

ACE I/D alleles

Of the 106 patients, 49 (46.23%) had the I/D genotype (40 responders and 9 non-responders), 30 (28.30%) had D/D genotype (21 responders and 9 non-responders) and 27 (25.47%) had I/I genotype (23 responders and 4 non-responders). On comparing the I/I with the I/D genotype, a significant difference in the reduction of [Figure 3] systolic blood pressure was observed (P = 0.028).

Figure 3

Mean reduction of systolic and diastolic blood pressure after treatment with ACE inhibitors (5mg) with respect to ACE, ADD1 & β-1 ADR polymorphism

ADD1 polymorphisms

It was observed that 61 (57.55%) patients had G/G genotype (55 responders and 6 non-responders), 35 (33.02%) had T / G genotype (23 responders and 12 non-responders) and 10 (9.43%) had T/T genotype (6 responders and 4 non-responders). On comparing the G/G with the T/G genotype, a significant difference in the reduction of systolic and diastolic blood pressures was observed (P=0.032 and 0.012, respectively). A significant difference in the reduction of [Figure 3] diastolic blood pressures also existed on comparing the GG with the TT genotype (P = 0.013) and the T/G with the TT genotype (P = 0.01).

β-1 ADR polymorphisms

Forty nine patients (46.23%) were found to have the S/S genotype (44 responders and 5 non-responders), 41 (38.68%) had the S/G genotype (32 responders and 9 non-responders) and 16 (15.09%) had the G/G genotype (8 responders and 8 non-responders). On comparing the S/S with the S/G genotype, a significant difference in the reduction of [Figure 3] systolic blood pressure was observed (P = 0.032).

There was no difference between the proportions of responders and non-responders among the three genotypes of the ACE I/D gene. However, there did exist a significant difference between the proportions of responders and non-responders among the genotypes of the ADD1 and β1-ADR genes (P = 0.005 and 0.003, respectively).

Genotype combinations and prediction of response

It was observed that 21 different genotype combinations [Table 2] existed in the 106 patients.

Table 2

Percentage response (responder versus non responder) of ramipril (5mg) in predictor model of three different genotypes combination of respective genes (ACE I/D/ADD1/β-1ADR).

Genotype combination	8 weeks		12 weeks		P value (Responders vs non responders at 8 weeks)	P value (Responders vs non responders at 12 weeks)
	R	NR	R	NR
DD/GG/SS (8)	—	08 (100)	8 (100)	—	—	—
DD/TG/SS (7)	—	07 (100)	5 (71)	2 (29)	—	0.0186*
DD/TG/GG (2)	—	02(100)	1 (50)	1 (50)	—	—
DD/TG/SG (3)	—	03(100)	1 (33)	2 (67)	—	—
DD/GG/GG (5)	—	05(100)	3 (60)	2 (40)	—	0.0398*
DD/GG/SG (5)	—	05(100)	3 (60)	2 (40)	—	0.783
ID/TG/SG (7)	—	07(100)	5 (71)	2 (29)	—	0.006**
ID/GG/GG (4)	—	04(100)	3 (75)	1 (25)	—	—
ID/TG/SS (7)	—	07(100)	5 (71)	2 (29)	—	0.1536
ID/TT/SG (5)	—	05(100)	3 (60)	2 (40)	—	—
ID/GG/SS (11)	—	11(100)	11 (100)	—	—	0.024*
ID/TT/SS (1)	—	01 (100)	1 (100)	—	—	—
ID/TG/GG (2)	—	02 (100)	—	2 (100)	—	—
ID/GG/SG (11)	—	11 (100)	11 (100)	—	—	—
II/GG/SS (8)	3 (27)	05 (63)	8 (100)	—	0.0001***	—
II/GG/SG (7)	3 (43)	04 (57)	7 (100)	—	0.0639	—
II/TG/SS (6)	1 (17)	05 (83)	6 (100)	—	—	—
II/GG/GG (2)	—	02 (100)	1 (50)	1 (50)	0.073	—
II/TT/SG (3)	—	03 (100)	2 (67)	1 (33)	0.515	—
II/TT/SS (1)	—	01 (100)	—	1 (100)	—	—
II/TG/GG (1)	—	01 (100)	—	1 (100)	—	—

The best predictors of response to Ramipril 5 mg daily were the II/GG/SS, II/TG/SS, II/GG/SG, ID/GG/SS, ID/GG/SG and ID/TT/SS and DD/GG/SS. All of the patients who had any of these genotypes were responders.

Less predictive of response were the II/GG/GG, II/TT/SG, ID/TG/SG, ID/TT/SG, DD/GG/SG and DD/GG/GG combinations with 50%-70% of patients with these genotypes being responders.

The genotype combinations that were least predictive of response (≤50% cases with these combinations were responders) were II/TT/SS, II/TG/GG, ID/TG/GG, DD/TG/SG and DD/TG/GG.

Data on 19/22 non-responders who were treated with combination therapy showed that patients with the combinations II/GG/GG (n = 1), DD/TG/SG (n = 2) and II/TG/GG (n = 1) responded to Ramipril plus Metoprolol; non-responders with the II/TT/SS (n = 1) and DD/TG/SS (n = 2) genotypes responded to Ramipril plus Hydrochlorothiazide.

Discussion

This study evaluated gene polymorphisms that could determine response to Ramipril within a cohort of patients with essential hypertension. Patients with the ID and II genotypes were more likely to respond to the drug at the third month as compared to patients with the DD genotype. This may be accounted for by the lower expression of the ACE I/D gene in those with the I allele, leading to decreased serum ACE activity [Table 1]. Two other studies have demonstrated similar results[1415] while differing results were seen in the study by Staessen et al.[16] Since there is an inconsistency of findings across studies, the extent of effect of these polymorphisms still remains unclear.[17] Patients with the G allele of the ADD1 gene and the S allele of the β1-ADR gene were more likely to respond to Ramipril as compared to patients with other alleles (T allele of ADD1 and G allele of β1-ADR) [Table 1]. This may be explained by the fact that the presence of the T allele of the ADD1 gene is linked to a higher activity of the sodium pump, leading to increased tubular re-absorption of sodium in the kidneys.[181920]

All patients who were homozygous for the T allele of the ADD1 or the G allele of the β1-ADR gene were non-responders in our study. Patients with the DD genotype were responders when they also had the GG or TG genotypes of the ADD1 and SS genotype of the β1-ADR gene and non-responders when they had the GG or SG genotypes of the β1-ADR gene.

Among non responders (n = 19), patients with the GG or SG genotypes of the β1-ADR gene were found to have greater reduction of BP when treated with a combination of Ramipril and Metoprolol. In vitro studies have shown that the G allele of the β1-ADR gene leads to greater sensitivity to the inhibitory effect of Metoprolol and greater down regulation on long-term agonist stimulation.[21] However, another study reported that patients homozygous for SS polymorphism responded better to beta blockers than those with the GG polymorphism.[21]

An attempt has been made to explain response to Ramipril with respect to ACE I/D, β-1 ADR and ADD1 gene polymorphisms. The I allele of ACE, G allele of ADD1 and S allele of the β1-ADR genes could serve as potential markers of response.

There was a significant difference in the reduction of systolic blood pressures when patients with heterozygous genotypes of any of the three genes (ACE I/D, β-1 ADR and ADD1) were compared with patients with the corresponding wild type genotypes. The change in the diastolic blood pressures was significantly different only when ADD1 wild and polymorphic genotypes were compared. Though, we have a small number of patients treated with combination drug therapy, our results indicate that in patients with the GG or SG genotype of the β1-ADR gene, Ramipril plus Metoprolol may be started at the time that treatment is initiated. The sample size while small, indicates variability in responses to ramipril with respect to different genes polymorphisms. This study could establish some baseline data for future research on larger populations.