Literature DB >> 25496021

Loss of vinculin and membrane-bound β-catenin promotes metastasis and predicts poor prognosis in colorectal cancer.

Ting Li, Hanqing Guo, Ying Song, Xiaodi Zhao, Yongquan Shi, Yuanyuan Lu, Sijun Hu, Yongzhan Nie, Daiming Fan, Kaichun Wu1.   

Abstract

BACKGROUND: Loss of cell-cell adhesion is important for the development of cancer invasion and metastasis. Vinculin, a key adhesion-related protein, can affect metastasis and prognosis in several tumours. Here, we determined the biological roles of vinculin in the metastasis of colorectal cancer (CRC) and evaluated its clinical significance as a potential disease biomarker.
METHODS: The expression level of vinculin in CRC cell lines and tissues was measured using Real-Time PCR and western blotting. Moreover, vinculin function was analysed using Transwell assays and in vivo metastasis assays in gain- and loss-of-function experiments. Furthermore, the impact of vinculin together with membrane-bound β-catenin on the prognosis of 228 CRC patients was investigated by immunohistochemistry. Additionally, the expression of epithelial-mesenchymal transition (EMT) indicators was verified by immunohistochemistry in CRC tissues obtained from these patients. RESULT: Vinculin expression was found to be significantly downregulated in highly metastatic CRC cell lines and metastatic tissues. Both in vitro and in vivo experiments showed that vinculin suppressed invasion, migration and metastasis in CRC cells and that this suppression could be attenuated by silencing β-catenin. Moreover, the expression of vinculin and membrane-bound β-catenin were positively correlated in CRC tissues, and lack of vinculin expression emerged as an independent prognostic factor in patients with CRC. Finally, the loss of vinculin and membrane-bound β-catenin was associated with node metastasis, organ metastasis and expression of EMT indicators.
CONCLUSION: Our results suggest that vinculin may play specific roles in the EMT and metastasis of CRC and that loss of vinculin could be used as a prognostic factor for CRC.

Entities:  

Mesh:

Substances:

Year:  2014        PMID: 25496021      PMCID: PMC4320448          DOI: 10.1186/1476-4598-13-263

Source DB:  PubMed          Journal:  Mol Cancer        ISSN: 1476-4598            Impact factor:   27.401


Background

Colorectal cancer (CRC) is the third most commonly diagnosed cancer in males and the second most commonly diagnosed cancer in females [1]. The CRC death rates have been decreasing in several Western countries [2], largely resulting from improved treatment, increased awareness and early detection [3]. However, an estimated 608,700 deaths have still occurred, making CRC the fourth leading cause of cancer deaths in males and the third leading cause of cancer deaths in females [1]. The poor prognosis of CRC is associated with tumour invasion and metastasis, which often leads to therapeutic failure. Recently, it has been reported that some loss of cell-cell adhesion may be important for the development of CRC invasion and metastasis [4, 5]. Vinculin is a ubiquitously expressed, actin-binding protein that localises to the cytoplasmic face of integrin-mediated cell-extracellular matrix junctions (focal adhesions) and cadherin-mediated cell-cell junctions [6]. Normally, vinculin plays a key role in focal adhesion formation [7], cell proliferation [8] and regulation of the actin cytoskeleton [9, 10]. Loss of vinculin has been found in the development of many cancers, such as squamous carcinoma [11, 12], rhabdomyosarcoma [13] and breast cancer [14], implying that vinculin may have anti-tumour effects. Recent studies confirmed this finding, as vinculin inhibited multiple processes associated with malignant tumours, including invasion, metastasis and apoptosis [8, 15]. Specifically, overexpression of vinculin caused reduced cell migration, whereas knockdown of vinculin enhanced cell motility [16-18]. Researchers also found that vinculin-null cells had upregulated activity of extracellular signal-regulated kinase (ERK), leading to enhanced survival and motility, which are important for metastasis [8]. In addition, low levels of vinculin may predict poor survival in squamous cell cancer [12], but the biological role of vinculin and its prognostic value in CRC have not been fully investigated. Vinculin activation is a key event in its coordination with focal adhesion formation, which is important for the suppression of cell mobility. This activation requires various binding partners, such as talin [19], α-actinin [20], α-catenin [21], β-catenin [22] and paxillin [8], to unmask the binding sites of vinculin and continue its localisation to focal adhesions. Because it is an important cell-cell adhesion protein, β-catenin can bind to vinculin to stabilise E-cadherin (E-cad) at the cell surface [22, 23]. This important stabilising function requires the binding of vinculin to the N-terminus of β-catenin [23], which can bind a number of proteins that regulate the transition of cancer cells from an epithelial to a more mesenchymal phenotype [24, 25]. Recently, the epithelial-mesenchymal transition (EMT), a critical process in tumour invasion and metastasis, was found to be associated with the translocation of β-catenin from the membrane to the nucleus [26]. Upregulated levels of β-catenin in the nuclei of CRC cells were found to induce the activity of the transcription factor ZEB1, leading to EMT and a more invasive phenotype [27]. The EMT process is characterised by decreased levels of epithelial cell-cell adhesion molecules, such as E-cad [28], and increased levels of mesenchymal cell-cell adhesion molecules, such as vimentin (VIM) [29]. In addition, reduced membrane-bound β-catenin expression and increased cytoplasmic E-cad expression predict poor survival in gastric cancer [30]. Decreased levels of β-catenin and E-cad on the cell membrane were also observed in CRC in a recent study [31]. Based on these findings and our results that reveal the diminished levels of vinculin in CRC, we hypothesised that the loss of vinculin and β-catenin at the cell surface could be advantageous for the development of EMT and metastasis and may predict poor survival in CRC patients. In this study, we investigated the biological function of vinculin and its prognostic value in CRC. We identified significant downregulation of vinculin in metastatic CRC cells and tissues. Furthermore, restoration of vinculin suppresses CRC metastasis in vitro and in vivo, whereas loss of vinculin promotes CRC invasion and migration. In addition, we found that vinculin may regulate CRC invasion and migration at least partially through β-catenin. We further verified the positive correlation between the expression of vinculin and membrane-bound β-catenin and their correlation with an EMT indicator. More importantly, our data provide novel evidence that vinculin and membrane-bound β-catenin expression can serve as predictive biomarkers of poor prognosis in CRC patients.

Results

Vinculin expression is downregulated in CRC cell lines and inversely correlated with CRC metastasis

To examine the significance of vinculin in CRC carcinogenesis, we measured the expression of vinculin in five human CRC cell lines (HCT116, Caco2, HT29, SW620 and SW480) and in HIEC, an immortalised colon epithelial cell line. Western blotting showed that vinculin expression was significantly decreased in all five CRC cell lines compared with HIEC (Figure  1A). Interestingly, compared with SW480, vinculin expression was significantly decreased in SW620, a cell line established from the lymph node metastasis of the same patient as SW480 [32]. qRT-PCR also showed that mRNA expression of vinculin was relatively lost in various CRC cell lines (Figure  1B). Furthermore, tissues from lymph node metastases expressed lower levels of vinculin compared with primary CRC tissues and the adjacent normal tissues, indicating the inverse relationship between the expression of vinculin and the metastatic status of CRC tissues (Figure  1C, D). Taken together, these results suggest that downregulation of vinculin is correlated with increased CRC metastasis and that vinculin might inhibit CRC progression.
Figure 1

Expression of vinculin in CRC cell lines and tissue samples. (A) The expression level of vinculin in five CRC cell lines and HIEC cells was measured by western blotting and quantified using Quantity One v4.6.2 software (one of three similar blots is shown). β-actin was used as a loading control. (B) The mRNA level of vinculin in five CRC cell lines and HIEC cells was measured by qRT–PCR using GAPDH as an internal control. (C) The expression of vinculin in adjacent non-cancerous colon tissues (N), primary CRC tissues (C) and lymph node metastatic tissues (M) from 6 patients was examined by western blotting. (D) The mRNA level of vinculin in paired tissues was measured using qRT-PCR. Vinculin expression was determined in tumour tissue relative to the patient’s adjacent normal tissue, and the relative expression of vinculin in the CRC cell lines was normalised to that in HIEC cells. Each sample was analysed in triplicate (*P < 0.05, **P < 0.01).

Expression of vinculin in CRC cell lines and tissue samples. (A) The expression level of vinculin in five CRC cell lines and HIEC cells was measured by western blotting and quantified using Quantity One v4.6.2 software (one of three similar blots is shown). β-actin was used as a loading control. (B) The mRNA level of vinculin in five CRC cell lines and HIEC cells was measured by qRT–PCR using GAPDH as an internal control. (C) The expression of vinculin in adjacent non-cancerous colon tissues (N), primary CRC tissues (C) and lymph node metastatic tissues (M) from 6 patients was examined by western blotting. (D) The mRNA level of vinculin in paired tissues was measured using qRT-PCR. Vinculin expression was determined in tumour tissue relative to the patient’s adjacent normal tissue, and the relative expression of vinculin in the CRC cell lines was normalised to that in HIEC cells. Each sample was analysed in triplicate (*P < 0.05, **P < 0.01).

Vinculin suppresses CRC cell invasion and metastasis in vitroand in vivo

To investigate whether vinculin regulates CRC cell invasion and migration, we performed in vitro gain-of-function analyses by overexpressing vinculin with a lentiviral vector encoding vinculin in SW620 cells. Conversely, SW480 cells were transfected with lentiviral vectors encoding vinculin siRNA or control siRNA. After cell transfection and antibiotic screening for 6 weeks, extracts from SW480 and SW620 cells transfected with the vinculin vector, siRNA or control vector were submitted to western blotting and compared (Figure  2A, B). Transwell assays showed that ectopic expression of vinculin significantly suppressed the invasion and migration of SW620 cells (Figure  2C). In contrast, the migration and invasion of SW480 cells sharply increased when endogenous vinculin was silenced by siRNA (Figure  2D). These results suggest that vinculin suppresses CRC cell invasion and migration in vitro.
Figure 2

Vinculin suppresses CRC cell invasion and metastasis and . (A) Western blot showing vinculin expression in SW620 cells infected with lentiviral vector encoding vinculin and in SW480 cells infected with vinculin siRNA (B). β-actin was used as an internal control. (C) Transwell migration and invasion assays using SW620 cells stably expressing vinculin or control vector. Representative images are shown on the left, and the quantification of 10 randomly selected fields is shown on the right. (D) Transwell migration and invasion assays using SW480 cells stably infected with vinculin siRNA or control siRNA. (E) Representative H&E staining of livers and lungs isolated from mice that received injections of SW620-control-vector or SW620-vinculin-vector cells. Black arrows indicate metastatic intrahepatic or lung tumours. The incidences of liver and lung metastasis in 10 mice are presented on the right. (F) Representative H&E staining of livers and lungs isolated from mice that received injections of SW480-control-siRNA or SW480-vinculin-siRNA cells.

Vinculin suppresses CRC cell invasion and metastasis and . (A) Western blot showing vinculin expression in SW620 cells infected with lentiviral vector encoding vinculin and in SW480 cells infected with vinculin siRNA (B). β-actin was used as an internal control. (C) Transwell migration and invasion assays using SW620 cells stably expressing vinculin or control vector. Representative images are shown on the left, and the quantification of 10 randomly selected fields is shown on the right. (D) Transwell migration and invasion assays using SW480 cells stably infected with vinculin siRNA or control siRNA. (E) Representative H&E staining of livers and lungs isolated from mice that received injections of SW620-control-vector or SW620-vinculin-vector cells. Black arrows indicate metastatic intrahepatic or lung tumours. The incidences of liver and lung metastasis in 10 mice are presented on the right. (F) Representative H&E staining of livers and lungs isolated from mice that received injections of SW480-control-siRNA or SW480-vinculin-siRNA cells. To further validate whether vinculin could regulate the metastatic phenotype of CRC in vivo, we injected SW620-vinculin cells, which stably express vinculin, into nude mice through the lateral tail vein. Liver and lung metastasis of CRC was apparent in mice injected with SW620-vinculin-control cells, while few metastatic tumours were detected in mice injected with SW620-vinculin cells (Figure  2E). In contrast, inhibition of vinculin in SW480 cells increased the rate of metastasis to liver and lung (Figure  2F). Taken together, these results indicate that vinculin has a suppressor role in CRC metastasis.

Vinculin regulates CRC metastasis through β-catenin

To understand the underlying molecular mechanism by which vinculin suppresses CRC invasion and metastasis, we further investigated whether β-catenin, an important binding partner of vinculin and a key activator of cancer malignant phenotypes, was involved in this process. Immunofluorescence assays showed that β-catenin was primarily located in the plasma membrane in SW480 cells; however, following vinculin siRNA infection, β-catenin showed less localisation in the nucleus and instead localised in the nucleus and cytoplasm (Figure  3A). On the other hand, the expression of membrane-bound β-catenin in SW620 cells significantly increased after vinculin restoration, while nuclear β-catenin was almost absent (Figure  3B).
Figure 3

Vinculin regulates CRC metastasis via β-catenin. (A) Immunofluorescence analysis of β-catenin (green) in SW480 cells infected with vinculin or control siRNA. Merged images represent overlays of β-catenin (green) and nuclear staining by DAPI (red). (B) Immunofluorescence analysis of β-catenin (green) in SW620 cells infected with the vinculin or control vector. (C) Transwell migration and invasion assays for SW480 cells infected with control or vinculin siRNA along with lentiviral vector expressing β-catenin siRNA. Representative images are shown on the left, and the quantification of 10 randomly selected fields is shown on the right. (D) Transwell migration and invasion assays using SW620 cells infected with control or vinculin vectors along with lentiviral vector expressing β-catenin.

To further verify whether β-catenin accounted for the change in CRC invasion and metastasis induced by vinculin, we transfected β-catenin siRNA into SW480 cells previously transfected with the vinculin siRNA vector. Transwell assays showed that the β-catenin siRNA significantly reduced vinculin-siRNA-induced CRC cell invasion and migration (Figure  3C). By contrast, restoration of β-catenin significantly abrogated the inhibition of invasion and migration that was induced by vinculin overexpression in SW620 cells (Figure  3D). Collectively, these results suggest that vinculin may regulate CRC invasion and migration at least partially through β-catenin. Vinculin regulates CRC metastasis via β-catenin. (A) Immunofluorescence analysis of β-catenin (green) in SW480 cells infected with vinculin or control siRNA. Merged images represent overlays of β-catenin (green) and nuclear staining by DAPI (red). (B) Immunofluorescence analysis of β-catenin (green) in SW620 cells infected with the vinculin or control vector. (C) Transwell migration and invasion assays for SW480 cells infected with control or vinculin siRNA along with lentiviral vector expressing β-catenin siRNA. Representative images are shown on the left, and the quantification of 10 randomly selected fields is shown on the right. (D) Transwell migration and invasion assays using SW620 cells infected with control or vinculin vectors along with lentiviral vector expressing β-catenin.

Vinculin positively correlates with membrane-bound β-catenin in CRC

To further investigate the expression levels and possible associations between vinculin and β-catenin in CRC, we measured the expression of vinculin and β-catenin in primary CRC tissue arrays containing 228 cases. Decreased levels of vinculin and β-catenin on the cell membrane were observed in CRC tissues compared to adjacent normal tissues, and immunohistochemistry showed low expression of vinculin in 145 of 228 CRC tissues (63.6%), as opposed to 59 of 228 adjacent non-cancerous tissues (25.9%) (Figure  4A, B, Additional file 1: Table S1). Moreover, diminished expression of membrane-bound β-catenin was also detected in 138 of 228 CRC tissues (60.5%), whereas lack of membrane-bound β-catenin was found in only 36 of 228 adjacent non-cancerous tissues (15.8%) (Figure  4A, C, Additional file 1: Table S1). Furthermore, membrane-bound β-catenin was correlated with high vinculin expression (Figure  4D, Additional file 2: Table S2). Taken together, these results indicated that a low level of vinculin was significantly correlated with the absence of membrane-bound β-catenin.
Figure 4

Vinculin positively correlates with membrane-bound β-catenin in CRC. Tissue microarrays of consecutive immunostained sections were performed using specific antibodies against vinculin and β-catenin. (A) Representative images of vinculin and β-catenin protein expression levels in normal and cancer specimens. (B) The expression level of vinculin was significantly lower in CRC tissue species than in normal colorectal tissue species (P < 0.0001, χ2 test). The same result was observed for membrane-bound β-catenin (P < 0.0001, χ2 test) (C). (D) Membrane-bound β-catenin was positively correlated with vinculin expression in CRC tissues (P < 0.0001, χ2 test).

Vinculin positively correlates with membrane-bound β-catenin in CRC. Tissue microarrays of consecutive immunostained sections were performed using specific antibodies against vinculin and β-catenin. (A) Representative images of vinculin and β-catenin protein expression levels in normal and cancer specimens. (B) The expression level of vinculin was significantly lower in CRC tissue species than in normal colorectal tissue species (P < 0.0001, χ2 test). The same result was observed for membrane-bound β-catenin (P < 0.0001, χ2 test) (C). (D) Membrane-bound β-catenin was positively correlated with vinculin expression in CRC tissues (P < 0.0001, χ2 test).

Low vinculin expression and lack of membrane-bound β-catenin are associated with tumour malignancy in CRC

The correlations between vinculin or β-catenin expression and various clinicopathological features of CRC are summarised in Table  1. There was a statistically significant correlation between differentiation and vinculin expression (P = 0.0021) or β-catenin expression (P = 0.0163). More importantly, the loss of vinculin was associated with lymph node metastasis and organ metastasis (P = 0.0273, P = 0.01078). Node or organ metastasis was also related to the absence of membrane-bound β-catenin expression (P = 0.0027, P = 0.0159), further supporting the relationship between decreased vinculin and the absence of membrane-bound β-catenin in CRC tissues. Interestingly, we found that decreased vinculin expression was significantly associated with vascular invasion (P = 0.0371). Tumour depth was also found to be associated with the absence of membrane-bound β-catenin expression (P = 0.0121). There were no significant differences in these molecules with regard to patient gender, age, tumour stage or location.
Table 1

Correlations of Clinico-pathological variables with vinculin and β-catenin expression

VinculinP valueMembrane-bound β-cateninP value
LowHighAbsentPresent
Total cases1458313890
Gender
Male76490.406871540.2048
Female69346736
Age
<6055370.330461310.1677
>6090467759
Differentiation
Well5951 0.0021* 5654 0.0163*
Morderate62175524
Poor24152712
Depth of Tumor
T1-T247320.38663940 0.0121*
T3-T498519950
Tumor stage
I - II82510.488576570.2716
III - IV63326233
Location
Signoid38240.757240220.5428
Colon /Rectum107599868
Vascular invasion
Negative7756 0.0371* 85480.2203
Positive68275342
Node Metastasis
Negative7254 0.0273* 6561 0.0027*
Positive73297329
Organ metastasis
Negative11577 0.0078* 11089 0.0159*
Positive306288

Analysis by chi-square criterion or Fisher’s exact test.

*P<0.05.

Correlations of Clinico-pathological variables with vinculin and β-catenin expression Analysis by chi-square criterion or Fisher’s exact test. *P<0.05.

Low vinculin expression is an independent prognostic factor

We evaluated the three-year survival rates using the Kaplan-Meier method. Our results showed that vinculin loss was confirmed to be an independent prognosticator for low survival of CRC patients (Figure  5A, P = 0.001). Because our results indicated that vinculin and β-catenin are co-expressed in CRC, we set out to detect whether the impact of vinculin on the prognosis of CRC patients was affected by β-catenin expression. Thus, the patients were divided into four groups according to their expression patterns of vinculin and β-catenin: vinculin(High, H)/β-catenin(Membrane-bound, M), vinculin(Low, L)/β-catenin(Non-Membrane-bound, NM), vinculin (H)/β-catenin(NM) and vinculin(L)/β-catenin(M). Survival analysis showed that patients with vinculin(L)/β-catenin(NM) expression endured the lowest overall survival (Figure  5B, P < 0.001). Furthermore, in patients with low and high expression of vinculin, β-catenin(NM) patients showed a decreased survival time compared to β-catenin(M) patients (Figure  5C, P < 0.001; Figure  5D, P = 0.042). However, low vinculin was found to result in low survival rates when membrane-bound β-catenin was absent (Figure  5E, P = 0.037), but not when membrane-bound β-catenin was detected (Figure  5F, P = 0.506).
Figure 5

Survival curves of CRC patients according to vinculin and β-catenin expression. (A) Patients with low vinculin expression showed a significantly poor prognosis than those with high vinculin expression. (B) Subgroup analysis of CRC patients with low or high expression of vinculin accompanied with the absence or presence of membrane-bound β-catenin. (C) The correlation of membrane-bound β-catenin expression with overall survival among patients with tumours expressing low or high levels of vinculin (D). (E) The correlation of vinculin expression with overall survival among patients with tumours with or without membrane-bound β-catenin (F).

Survival curves of CRC patients according to vinculin and β-catenin expression. (A) Patients with low vinculin expression showed a significantly poor prognosis than those with high vinculin expression. (B) Subgroup analysis of CRC patients with low or high expression of vinculin accompanied with the absence or presence of membrane-bound β-catenin. (C) The correlation of membrane-bound β-catenin expression with overall survival among patients with tumours expressing low or high levels of vinculin (D). (E) The correlation of vinculin expression with overall survival among patients with tumours with or without membrane-bound β-catenin (F). A univariate analysis according to the Cox proportional hazard regression model further confirmed these results (Table  2). Low expression of vinculin in the primary tumour was associated with an increased risk of death (HR: 1.805; 95% confidence interval [CI]: 1.262-2.582). Similarly, lack of membrane β-catenin was also associated with higher risk (HR: 2.420; 95% CI: 1.685-3.475). As expected, larger tumour size, vascular invasion, node metastasis and organ metastasis at the time of primary surgery were also associated with poorer survival. Taken together, these results suggest that low vinculin expression is an independent prognostic factor with poor prognosis in colon cancer.
Table 2

Univariate and multivariate analysis for overall survival (Cox proportional hazards regression model)

FactorsUnivariate analysisMultivariate analysis 1
HR95%CIPHR95%CIP
Gender (male/female)1.1480.825-1.5960.412---
Differentiation (well/ moderately, poorly)1.3400.966-1.8600.080---
Vascular invasion (absent/present)1.8431.327-2.561 0.0002* 1.4100.996-1.9970.0527
Depth of Tumor (T1-T2/T3-T4)1.1850.850-1.4530.317---
Node Metastasis (absent/present)2.7391.963-3.820 0.0015* 1.6311.139-2.315 0.0062*
Organ metastasis (absent/present)4.5092.915-6.975 <0.0001* 5.4013.379-8.634 <0.0001*
Vinculin expression (high/low)1.8051.262-2.582 0.0012* 2.0481.401-2.995 0.0002*
membrane-bound β-catenin expression (absent/present)2.4201.685-3.475 <0.0001* 2.0241.402-2.923 0.0019*

1Multivariate analysis performed only for variables significant in the univariate analysis.

*P < 0.05.

Univariate and multivariate analysis for overall survival (Cox proportional hazards regression model) 1Multivariate analysis performed only for variables significant in the univariate analysis. *P < 0.05.

Vinculin inhibits EMT in CRC

Because extensive evidence suggests that translocation of β-catenin from the cell membrane to the nucleus can initiate the EMT process [26], we speculated that loss of vinculin might impact EMT in CRC. To investigate this hypothesis, we detected the expression of the epithelial differentiation marker E-cad and the mesenchymal marker VIM in CRC cells and tissues. Western blots showed that membrane-bound β-catenin expression as well as E-cad dramatically increased in SW620 cells infected with vinculin vectors, whereas the expression of nuclear β-catenin and VIM were inhibited. In contrast, silencing vinculin in SW480 cells increased the subcellular expression of β-catenin, suppressed the expression of E-cad and upregulated the expression of VIM (Figure  6A, B).
Figure 6

Vinculin regulates CRC metastasis through β-catenin. (A) Western blot analysis of vinculin, membrane-bound β-catenin and nuclear β-catenin in SW620 cells infected with vinculin or control vector (left) and SW480 cells transfected with vinculin or control siRNA (right). (B) Western blot analysis of E-cadherin and vimentin in SW620 cells infected with vinculin or control vector (left) and of SW480 cells transfected with vinculin or control siRNA (right). (C) CRC tissue with high expression of vinculin, membrane-bound β-catenin, positive staining of E-cadherin and negative staining of vimentin. (D) CRC tissue with low vinculin expression, the absence of membrane-bound β-catenin, negative staining of E-cadherin and positive staining of vimentin. (E) E-cadherin expression was positively correlated with vinculin expression as well as (F) with membrane-bound β-catenin in CRC tissues (P < 0.0001, χ2 test; P < 0.0001, χ2 test). (G) Vimentin expression was negatively correlated with vinculin expression as well as (H) with membrane-bound β-catenin in CRC tissues (P = 0.0274, χ2 test; P = 0.0153, χ2 test).

Vinculin regulates CRC metastasis through β-catenin. (A) Western blot analysis of vinculin, membrane-bound β-catenin and nuclear β-catenin in SW620 cells infected with vinculin or control vector (left) and SW480 cells transfected with vinculin or control siRNA (right). (B) Western blot analysis of E-cadherin and vimentin in SW620 cells infected with vinculin or control vector (left) and of SW480 cells transfected with vinculin or control siRNA (right). (C) CRC tissue with high expression of vinculin, membrane-bound β-catenin, positive staining of E-cadherin and negative staining of vimentin. (D) CRC tissue with low vinculin expression, the absence of membrane-bound β-catenin, negative staining of E-cadherin and positive staining of vimentin. (E) E-cadherin expression was positively correlated with vinculin expression as well as (F) with membrane-bound β-catenin in CRC tissues (P < 0.0001, χ2 test; P < 0.0001, χ2 test). (G) Vimentin expression was negatively correlated with vinculin expression as well as (H) with membrane-bound β-catenin in CRC tissues (P = 0.0274, χ2 test; P = 0.0153, χ2 test). To evaluate whether those results could be translated to the clinical setting, immunohistochemistry on tissue arrays was further conducted. The results showed that positive, strong expression of E-cad was detected in vinculin(H)/β-catenin(M) CRC tissues, but not in vinculin(L)/β-catenin(NM) tissues, whereas VIM expression was present in the latter group of CRC tissues, but not in the former (Figure  6C, D). Moreover, the results showed that the absence of both vinculin and membrane-bound β-catenin were correlated with decreased E-cad and increased VIM (Figure  6 E-H, Additional file 3: Table S3), indicating that loss of vinculin and membrane-bound β-catenin may benefit the process of EMT in CRC.

Discussion

Metastasis is one of the most distinguished phenotypes of a malignant tumour, and it results in extremely poor prognosis and relatively high recurrence. The phenotypic changes of reduced cell adhesion and increased cell motility drive tumour metastasis [33]. Recently, accumulating studies have suggested that the loss of vinculin, a protein contributing to cell-cell adhesion, is observed in the development of various cancers and may lead to metastatic changes. In this study, we investigated the biological role and prognostic value of vinculin in CRC metastasis. Vinculin is a 117-kDa actin-binding protein consisting of 1066 amino acids and is localised on the cytoplasmic face of integrin-mediated cell-extracellular matrix junctions (focal adhesions) and cadherin-mediated cell-cell junctions. Early studies have found that fibroblasts isolated from vinculin-deficient mice showed decreased adhesion strength and faster migration than control cells [34], and this result was also verified in vinculin-null carcinoma cells [16]. Recent studies found that poor vinculin labelling in tumours of squamous-epithelial origin appeared to be related to the metastatic potential of the tumour [12]. Overexpression of vinculin in cancer cells was found to suppress their tumourigenic ability and metaplastic capacity [17]. These results, which revealed the cell-adhesion reduction and motility increase associated with vinculin loss, indicate the potential involvement of vinculin in tumour metastasis. However, few studies have been performed to determine the biological role of vinculin in CRC metastasis. Thus, we were interested as to whether CRC metastasis, a multistep process that normally begins with the loss of cell-cell adhesion leading to the detachment of cancer cells and invasion of the basement membrane, is related to the loss of vinculin. In this study, the expression of vinculin in several CRC cell lines was determined using qRT–PCR and western blotting. Vinculin expression was significantly decreased in all five CRC cell lines and was lower in SW620 cells compared with the immortal colon epithelial cell line HIEC. Furthermore, the results obtained from clinical CRC tissue also confirmed that vinculin was downregulated in advanced stages of CRC, indicating its possible involvement in both oncogenic transformation and tumour metastasis. We subsequently found that vinculin significantly suppressed CRC cell invasion and metastasis both in vitro and in vivo. Some studies reported that vinculin-knockout cells were 3-fold less invasive in three-dimensional collagen matrices simulating extracellular matrix (ECM) because the connection between the ECM and the actomyosin cytoskeleton through integrin-type cell-matrix adhesion receptors is facilitated by vinculin [35, 36]. These studies focused on tractions exerted by these cells to the ECM and cell-ECM adhesions. In our study, however, we explored the effects of vinculin on tumor metastasis, which often develops through several essential steps including not only invading through surrounding ECM, but also loosening of cell-cell adhesions and other steps. Thus it still requires further investigation to elaborate the specific functions of vinculin on cell-cell adhesion and cell-ECM adhesion through which tumor invasion and metastasis takes place. Vinculin exists in two conformations. In the inactive conformation, the extensive interactions between the head and tail domains prevent detectable binding to most of its ligands [19]. In the active conformation, displacement of the head-tail interactions leads to a significant accumulation of ternary complexes [37]. Vinculin activation requires several binding partners, such as talin [19], α-actinin [20], α-catenin [21], β-catenin [22] or paxillin [8], to fully unmask its binding sites and continue its localisation to focal adhesions. Several studies have indicated the close interaction between vinculin and β-catenin. Vinculin plays a critical role in maintaining the beta-catenin-MAGI-2 interaction in epithelial cells [38]. Moreover, β-catenin was found to be required to recruit vinculin to the cell cortex and to strengthen the junction’s association with the underlying cytoskeleton in response to tension [39]. Furthermore, researchers found that the interaction between vinculin and β-catenin is crucial for the stabilisation of E-cad at the cell surface [23], which is considered to be associated with inhibition of tumour metastasis [40]. In this study, we found that vinculin modulates CRC metastasis through β-catenin. We confirmed that vinculin and membrane-bound β-catenin are co-expressed in normal tissues and that their expression is partially decreased or lost in CRC tissues. Moreover, our results indicated that vinculin restoration accumulates β-catenin on the cell membrane and that silencing vinculin benefits the translocation of β-catenin. Finally, vinculin-induced cell migration and invasion were reversed by β-catenin. Taken together, these results establish a functional connection between vinculin and β-catenin and confirm that vinculin functions as an anti-metastatic protein in CRC cells by affecting the subcellular location of β-catenin. Vinculin expression has been associated with squamous cell tumours, and vinculin loss might predict high metaplastic ability and poor prognosis [12]. A recent study also revealed that the expression of cytoskeletal proteins, including vinculin, talin and tensin, was downregulated and correlated with carcinogenesis, invasion and metastasis of CRC, irrespective of its relative limited-case capacity [15]. As an important binding partner and a specific activator of vinculin, β-catenin has been found to be associated with CRC survival in several studies [31, 41–43]. The decreased localisation of β-catenin on the cell membrane combined with its increased expression in the cytoplasm and nucleus may be involved in abnormal E-cad expression. This expression pattern also coincides with the poor clinical prognosis of patients with CRC [31]. Our results indicated that vinculin was associated with membrane-bound β-catenin in CRC. Through analysing the relationship between vinculin or β-catenin and various clinicopathological features, we found that decreased expression of vinculin and β-catenin in the cell membrane is correlated with poor differentiation, extensive tumour invasion and a high incidence of metastasis. Moreover, our analysis of survival of the four groups of CRC patients further revealed that the loss of vinculin together with decreased membrane-bound β-catenin predicted the lowest level of survival. Most importantly, we found that lack of vinculin expression was independently associated with poor prognosis in colon cancer. Recently, the concept of the epithelial–mesenchymal transition (EMT), which was first reported in early embryonic morphogenesis [44], has been extended to cancer progression and metastasis [45]. During EMT, non-motile, polarised epithelial cells embedded via cell-cell junctions in a cell collective dissolve their cell-cell junctions and convert into individual, non-polarised, motile and invasive mesenchymal cells [46]. Typically, cancer cells experiencing this process show decreased levels of epithelial cell-cell adhesion molecules such as E-cad [28] and increased levels of mesenchymal cell-cell adhesion molecules such as VIM [29]. Several studies indicated that vinculin strengthens the mechanical links between adhesion complexes (containing E-cad, β-catenin and α-catenin) and the actin cytoskeleton. It has been reported that vinculin plays a role in the establishment or regulation of the E-cad-based cell adhesion complex in breast cancer cells by directly interacting with β-catenin [22]. Recent studies also suggest that vinculin is part of a protein complex on the cytoplasmic face of E-cad, which includes β-catenin and its binding partners MAGI-2 and α-catenin [38]. Researchers further confirmed that this complex is required to stabilise a famous tumour suppressor PTEN [39]. Taken together, these results suggest that vinculin, through interactions with β-catenin on the cell membrane, may act as an anti-metastatic factor in carcinogenesis. Based on these findings and our results that suggest a positive correlation between vinculin and β-catenin, we hypothesised that the loss of vinculin and β-catenin at the cell surface may be an advantage for EMT and metastasis in CRC. To test this hypothesis, two markers, i.e., E-cad and VIM, which represent epithelial and mesenchymal differentiation, respectively, were examined in CRC cells and tissues, respectively. We found that restoration of vinculin induced the upregulation of E-cad and the downregulation of VIM in CRC cells, while silencing vinculin in CRC cells decreased E-cad expression and increased VIM expression. Using IHC on CRC microarrays, we further identified positive E-cad staining in cancer tissues stained with high vinculin expression and membrane-bound β-catenin, whereas VIM staining was negative. Conversely, the tissues with low expression of vinculin and the absence of membrane-bound β-catenin showed low levels of E-cad and extremely high levels of VIM. These phenomena further suggest that vinculin has multiple roles in EMT and CRC metastasis.

Conclusion

We have demonstrated that vinculin is significantly downregulated in highly metastatic cells and tissues. Vinculin overexpression can inhibit CRC cell migration, invasion and metastasis both in vitro and in vivo. Furthermore, vinculin functions as an anti-metastatic protein, and in CRC cells, it functions at least partially by regulating the subcellular location of β-catenin. Furthermore, the loss of vinculin expression is independently associated with poor prognosis in CRC. Hence, we believe that vinculin could be a potential new target in the development of therapies for CRC.

Materials and methods

Cell culture and tissue collection

HIEC, HCT116, Caco2 and HT29 cells were cultured in RPMI-1640 medium (Thermo Scientific HyClone, Beijing, China). SW480 and SW620 cells were maintained in DMEM (HyClone). Paired samples of primary CRC, adjacent normal tissues and lymph node metastatic tissues were obtained from patients who had undergone CRC surgery at Xijing Hospital, Xi’an, China. All samples were clinically and pathologically shown to be correctly labelled. This study was approved by the Hospital’s Protection of Human Subjects Committee, and informed consent was obtained from every patient.

Patients

This study included 228 patients with CRC who underwent surgical therapy at Tianjin Medical University Cancer Institute and Hospital between 2004 and 2008. Paired samples of primary CRC and adjacent normal tissues were obtained from these patients with written informed consent for research purposes. The use of human tissues in this study was approved by the institutional review board of the Fourth Military Medical University and was performed in accordance with the international guidelines for the use of human tissues. Clinical data (including gender, age, grade, stage, tumour depth, differentiation, lymph node and organ metastasis status) were obtained from each patient’s medical records. The average age of the group was 61.4 years (range: 18–85 years). A 3-year follow-up was performed on the patients for survival analysis from the date of surgery until the date of death or last follow-up, which ranged from 1 month to 36 months. All patients received postoperative chemotherapy using a fluorouracil-based regimen without neoadjuvant chemotherapy, radiation therapy or immunotherapy. The cases lost to follow-up or those who died of a cause other than CRC were treated as censored data for the analysis of survival rates. Ethical approval to perform this study was obtained from the local Human Research Ethics Committee.

Western blot analysis

Total proteins were prepared from fresh frozen tissue or cultured cell samples by complete cell lysis (Roche, Mannheim, Germany) with protease and phosphatase inhibitors. Cytoplasmic proteins and nuclear proteins were isolated using the Nuclear and Cytoplasmic Protein Extraction Kit (Beyotime, Jiangsu, China). Denatured proteins (20–50 μg) were separated on SDS-PAGE gels and transferred to nitrocellulose membranes. The following primary antibodies were used: vinculin (Millipore, Darmstadt, Germany), β-actin (Sigma-Aldrich Inc., St. Louis, MO, US), β-catenin (BD Bioscience, San Jose, CA, US), Histone (Santa Cruz Biotechnology, Santa Cruz, US), E-cad (Cell Signaling Technology, Boston, MA, US) and VIM (Santa Cruz). The bands were scanned using the ChemiDocXRS+ Imaging System (Bio-Rad) and quantified using Quantity One v4.6.2 software (Bio-Rad).

Real-time quantitative RT–PCR (qRT-PCR)

Total RNA extraction, quality control and one-step qRT-PCR were performed as previously reported [47]. The data were normalised using glyceraldehyde-3-phosphate dehydrogenase (GAPDH) as a reference gene. The PCR primers for vinculin and GAPDH were as follows: vinculin-forward 5′- CCAAAACATGTCTCCTATATCCTGG-3′, vinculin-reverse 5′- GAAGTGTCCTTCAGACAGGG -3′; and GAPDH-forward 5′-ATGTC GTGGAGTCTACTGGC-3′, GAPDH-reverse 5′-TGACCTTGCCCACAGCCTTG-3′. Reverse Transcription PCR was performed using the PrimeScript RT reagent Kit (TaKaRa, Dalian, China) following the manufacturer′s instruction. Quantitative Real-time PCR was performed using the SYBR Premix Ex Taq II (TaKaRa) and measured using a LightCycler 480 system (Roche, Basel, Switzerland). Expression of GAPDH was used as an internal control. 2-△△CT referred to the fold of the RNA expression of one sample compared to the calibration sample.

Lentivirus infection and oligonucleotide transfection

The overexpression and siRNA constructs of vinculin and β-catenin were purchased from GeneChem (Shanghai, China). The constructs containing the vinculin and β-catenin CDS or siRNA sequence and 100 bases of the upstream and downstream regions flanking these sequences were inserted into the pGCSIL-GFP vector. Target cells (1 × 105) were subcultured in 24-well plates and infected with 2 × 107 lentivirus-transducing units in the presence of 5 μg/ml polybrene. Empty lentiviral vector was used as the negative control.

Migration and invasion assays

For the migration assays, infected cells were harvested and resuspended in serum-free DMEM medium, and 2 × 105 cells were placed into Boyden chambers (Corning, MA, USA) with an 8.0-μm pore membrane. For invasion assays, 2 × 105 cells were placed into chambers coated with 150 μg of Matrigel (BD Biosciences, Maryland, USA). The chambers were then inserted into the wells of a 24-well plate and incubated for 48 h in DMEM medium with 10% FBS before examination. The cells remaining on the upper surface of the membranes were removed, while the cells adhering to the lower surface were fixed, stained in a dye solution containing 0.05% crystal violet and counted under a microscope (Olympus Corp., Tokyo, Japan) to calculate their relative numbers, as described before [48]. The results of three independent experiments were averaged.

In vivometastasis assays

For the in vivo metastasis assays, 2 × 106 SW620 cells infected with vinculin vector lentivirus and SW480 cells infected with vinculin siRNA lentivirus were suspended in 200 μl PBS and injected into the tail vein of nude mice (10 in each group, female nu/nu). After 4 weeks, the mice were sacrificed, and tumour tissues derived from various organs were dissected and examined histologically. The nude mice were provided by the Experimental Animal Center of the Fourth Military Medical University. All animal studies complied with the Fourth Military Medical University animal use guidelines and by the protocols approved by the Fourth Military Medical University Animal Care Committee.

Immunofluorescence

Indirect immunofluorescence staining for β-catenin in stable SW480 and SW620 cells was performed as previously described [49].

Tissue microarrays

Colorectal cancer tissues or adjacent non-cancerous tissues were made into tissue microarrays using a Tissue Microarrayer (Beecher Instruments, Silver Spring, USA ™) according to the manufacturer’s instructions. Briefly, core tissue biopsies (2 mm in diameter) were taken from representative areas of individual, paraffin-embedded tissues. The staining results of the different areas in these tissue array blocks showed excellent agreement. Two to three cores from each case were chosen for analysis. We defined an adequate case as a tumour that occupied 10% of the core area.

Immunohistochemistry (IHC)

Immunohistochemistry (IHC) was performed on formalin-fixed, paraffin-embedded primary CRC and adjacent normal tissues as described previously [50]. Briefly, the slides were subjected to antigen retrieval in Target Retrieval Solution, pH 9 (DAKO) with PT Link (DAKO). Tissues were incubated in a mouse monoclonal antibody against vinculin (Millipore, dilution 1:50), β-catenin (BD, dilution 1:100), E-cad (Cell Signal Technology, dilution 1:100) or VIM (Santa Cruz, dilution 1:100). Negative controls were incubated with mouse or rabbit IgGs (DAKO). The percentage of positive cells was divided into four grades (percentage cores) [51]: <1% (0), 1–25% (1), 26–50% (2), 51–75% (3) and >75% (4). The intensity of staining was divided into four grades (intensity scores): negative (0), weak (1), moderate (2) and strong (3). The histological score (H-score) was determined using the following formula: overall scores = percentage score × intensity score. For the vinculin and EMT markers (E-cad and VIM), less than 10% positive staining was deemed negative [51]. For membrane-bound β-catenin, tumours were considered positive if >50% of the cells exhibited membrane-bound expression of the protein and negative if the expression was below 50%. However, in reality, staining for membrane-bound β-catenin was very homogenous, with a majority of tumours being either strongly positive for membrane-bound β-catenin, with nearly 100% of the cells expressing β-catenin at the membrane, or completely negative, with <5% of cells exhibiting immune-reactivity for β-catenin at the cell membrane [49].

Statistical methods

Continuous data are presented as the means ± s.e.m., and two groups were compared using Student’s unpaired t-test. The correlation coefficient between the expression of vinculin and β-catenin was estimated using the Spearman correlation method. The chi-squared value was used to confirm the correlation between EMT markers and vinculin or β-catenin. The association between clinicopathological variables and vinculin/β-catenin expression were examined by χ2 tests. The categorical data were analysed by a Fisher’s exact test. Overall survival (OS) curves were analysed using the Kaplan–Meier method, and differences were examined using log-rank tests. Cox’s proportional hazard regression test was used to estimate univariate and multivariate hazard ratios for prognosis. P values were two sided, and those <0.05 were considered statistically significant. All analyses were performed with the SPSS software (version 14.0). Additional file 1: Table S1: Expression of vinculin and β-catenin in CRC and adjacent tissues(n = 228). Analysis by chi-square criterion test or Fisher’s exact test. (DOC 32 KB) Additional file 2: Table S2: Correlation of vinculin and β-catenin expression in CRC and adjacent tissues(n = 228). Analysis by chi-square criterion test or Fisher’s exact test. (DOC 29 KB) Additional file 3: Table S3: Correlation of vinculin and β-catenin with EMT indicators in CRC tissues (n = 228). Analysis by chi-square criterion or Fisher’s exact test. (DOC 32 KB)
  51 in total

Review 1.  Wnt/β-catenin signaling and disease.

Authors:  Hans Clevers; Roel Nusse
Journal:  Cell       Date:  2012-06-08       Impact factor: 41.582

2.  Increased claudin-1 protein expression in hepatic metastatic lesions of colorectal cancer.

Authors:  Tetsushi Kinugasa; Yoshito Akagi; Takafumi Ochi; Natsuki Tanaka; Akihiko Kawahara; Yoshinobu Ishibashi; Yukito Gotanda; Keizo Yamaguchi; Ichitarou Shiratuchi; Yousuke Oka; Masayoshi Kage; Kazuo Shirouzu
Journal:  Anticancer Res       Date:  2012-06       Impact factor: 2.480

Review 3.  Tumor metastasis: molecular insights and evolving paradigms.

Authors:  Scott Valastyan; Robert A Weinberg
Journal:  Cell       Date:  2011-10-14       Impact factor: 41.582

4.  MicroRNA-7 functions as an anti-metastatic microRNA in gastric cancer by targeting insulin-like growth factor-1 receptor.

Authors:  X Zhao; W Dou; L He; S Liang; J Tie; C Liu; T Li; Y Lu; P Mo; Y Shi; K Wu; Y Nie; D Fan
Journal:  Oncogene       Date:  2012-05-21       Impact factor: 9.867

5.  β-catenin/TCF4 complex induces the epithelial-to-mesenchymal transition (EMT)-activator ZEB1 to regulate tumor invasiveness.

Authors:  Ester Sánchez-Tilló; Oriol de Barrios; Laura Siles; Miriam Cuatrecasas; Antoni Castells; Antonio Postigo
Journal:  Proc Natl Acad Sci U S A       Date:  2011-11-11       Impact factor: 11.205

6.  Migratory phenotypes of HSC-3 squamous carcinoma cell line induced by EGF and PMA: relevance to migration of loosening of adhesion and vinculin-associated focal contacts with prominent filopodia.

Authors:  E Kawahara; R Tokuda; I Nakanishi
Journal:  Cell Biol Int       Date:  1999       Impact factor: 3.612

7.  Nuclear expression of glycogen synthase kinase-3β and lack of membranous β-catenin is correlated with poor survival in colon cancer.

Authors:  Tavga Salim; Anita Sjölander; Janna Sand-Dejmek
Journal:  Int J Cancer       Date:  2013-03-09       Impact factor: 7.396

8.  MicroRNA-296-5p increases proliferation in gastric cancer through repression of Caudal-related homeobox 1.

Authors:  T Li; Y Y Lu; X D Zhao; H Q Guo; C H Liu; H Li; L Zhou; Y N Han; K C Wu; Y Z Nie; Y Q Shi; D M Fan
Journal:  Oncogene       Date:  2013-01-28       Impact factor: 9.867

9.  Vinculin regulates the recruitment and release of core focal adhesion proteins in a force-dependent manner.

Authors:  Alex Carisey; Ricky Tsang; Alexandra M Greiner; Nadja Nijenhuis; Nikki Heath; Alicja Nazgiewicz; Ralf Kemkemer; Brian Derby; Joachim Spatz; Christoph Ballestrem
Journal:  Curr Biol       Date:  2013-01-31       Impact factor: 10.834

10.  beta-Catenin protects the epidermis from mechanical stresses.

Authors:  Samriddha Ray; Henry P Foote; Terry Lechler
Journal:  J Cell Biol       Date:  2013-07-01       Impact factor: 10.539

View more
  26 in total

1.  Phosphoproteomics of colon cancer metastasis: comparative mass spectrometric analysis of the isogenic primary and metastatic cell lines SW480 and SW620.

Authors:  Alissa J Schunter; Xiaoshan Yue; Amanda B Hummon
Journal:  Anal Bioanal Chem       Date:  2016-12-16       Impact factor: 4.142

2.  Self-Assembled Peptide Habitats to Model Tumor Metastasis.

Authors:  Noora Al Balushi; Mitchell Boyd-Moss; Rasika M Samarasinghe; Aaqil Rifai; Stephanie J Franks; Kate Firipis; Benjamin M Long; Ian A Darby; David R Nisbet; Dodie Pouniotis; Richard J Williams
Journal:  Gels       Date:  2022-05-25

3.  High-fat diet induced cyclophilin B enhances STAT3/lncRNA-PVT1 feedforward loop and promotes growth and metastasis in colorectal cancer.

Authors:  Hanqing Guo; Kun Zhuang; Ning Ding; Rui Hua; Hailing Tang; Yue Wu; Zuyi Yuan; Ting Li; Shuixiang He
Journal:  Cell Death Dis       Date:  2022-10-20       Impact factor: 9.685

4.  Vinculin recruitment to α-catenin halts the differentiation and maturation of enterocyte progenitors to maintain homeostasis of the Drosophila intestine.

Authors:  Jerome Bohere; Buffy L Eldridge-Thomas; Golnar Kolahgar
Journal:  Elife       Date:  2022-10-21       Impact factor: 8.713

5.  Inside-out regulation of E-cadherin conformation and adhesion.

Authors:  Ramesh Koirala; Andrew Vae Priest; Chi-Fu Yen; Joleen S Cheah; Willem-Jan Pannekoek; Martijn Gloerich; Soichiro Yamada; Sanjeevi Sivasankar
Journal:  Proc Natl Acad Sci U S A       Date:  2021-07-27       Impact factor: 11.205

Review 6.  The shifting paradigm of colorectal cancer treatment: a look into emerging cancer stem cell-directed therapeutics to lead the charge toward complete remission.

Authors:  Jessica Kopenhaver; Madison Crutcher; Scott A Waldman; Adam E Snook
Journal:  Expert Opin Biol Ther       Date:  2021-05-24       Impact factor: 5.589

7.  BORIS Expression in Ovarian Cancer Precursor Cells Alters the CTCF Cistrome and Enhances Invasiveness through GALNT14.

Authors:  Joanna C Hillman; Elena M Pugacheva; Carter J Barger; Sirinapa Sribenja; Spencer Rosario; Mustafa Albahrani; Alexander M Truskinovsky; Aimee Stablewski; Song Liu; Dmitri I Loukinov; Gabriel E Zentner; Victor V Lobanenkov; Adam R Karpf; Michael J Higgins
Journal:  Mol Cancer Res       Date:  2019-07-10       Impact factor: 6.333

8.  First body of evidence suggesting a role of a tankyrase-binding motif (TBM) of vinculin (VCL) in epithelial cells.

Authors:  Salomé Vilchez Larrea; Wanda Mariela Valsecchi; Silvia H Fernández Villamil; Laura I Lafon Hughes
Journal:  PeerJ       Date:  2021-05-27       Impact factor: 2.984

9.  Alterations of Growth and Focal Adhesion Molecules in Human Breast Cancer Cells Exposed to the Random Positioning Machine.

Authors:  Jayashree Sahana; Thomas J Corydon; Markus Wehland; Marcus Krüger; Sascha Kopp; Daniela Melnik; Stefan Kahlert; Borna Relja; Manfred Infanger; Daniela Grimm
Journal:  Front Cell Dev Biol       Date:  2021-06-30

10.  Aligned Nanotopography Promotes a Migratory State in Glioblastoma Multiforme Tumor Cells.

Authors:  Alexander Beliveau; Gawain Thomas; Jiaxin Gong; Qi Wen; Anjana Jain
Journal:  Sci Rep       Date:  2016-05-18       Impact factor: 4.379

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.