Recent evidence suggests that autophagy may favor fibrosis through enhanced differentiation of fibroblasts in myofibroblasts. Here, we sought to characterize the mediators and signaling pathways implicated in autophagy-induced myofibroblast differentiation. Fibroblasts, serum starved for up to 4 d, showed increased LC3-II/-I ratios and decreased SQSTM1/p62 levels. Autophagy was associated with acquisition of markers of myofibroblast differentiation including increased protein levels of ACTA2/αSMA (actin, α 2, smooth muscle, aorta), enhanced gene and protein levels of COL1A1 (collagen, type I, α 1) and COL3A1, and the formation of stress fibers. Inhibiting autophagy with 3 different class I phosphoinositide 3-kinase and class III phosphatidylinositol 3-kinase (PtdIns3K) inhibitors or through ATG7 silencing prevented myofibroblast differentiation. Autophagic fibroblasts showed increased expression and secretion of CTGF (connective tissue growth factor), and CTGF silencing prevented myofibroblast differentiation. Phosphorylation of the MTORC1 target RPS6KB1/p70S6K kinase was abolished in starved fibroblasts. Phosphorylation of AKT at Ser473, a MTORC2 target, was reduced after initiation of starvation but was followed by spontaneous rephosphorylation after 2 d of starvation, suggesting the reactivation of MTORC2 with sustained autophagy. Inhibiting MTORC2 activation with long-term exposure to rapamycin or by silencing RICTOR, a central component of the MTORC2 complex abolished AKT rephosphorylation. Both RICTOR silencing and rapamycin treatment prevented CTGF and ACTA2 upregulation, demonstrating the central role of MTORC2 activation in CTGF induction and myofibroblast differentiation. Finally, inhibition of autophagy with PtdIns3K inhibitors or ATG7 silencing blocked AKT rephosphorylation. Collectively, these results identify autophagy as a novel activator of MTORC2 signaling leading to CTGF induction and myofibroblast differentiation.
Recent evidence suggests that autophagy may favor fibrosis through enhanced differentiation of fibroblasts in myofibroblasts. Here, we sought to characterize the mediators and signaling pathways implicated in autophagy-induced myofibroblast differentiation. Fibroblasts, serum starved for up to 4 d, showed increased LC3-II/-I ratios and decreased SQSTM1/p62 levels. Autophagy was associated with acquisition of markers of myofibroblast differentiation including increased protein levels of ACTA2/αSMA (actin, α 2, smooth muscle, aorta), enhanced gene and protein levels of COL1A1 (collagen, type I, α 1) and COL3A1, and the formation of stress fibers. Inhibiting autophagy with 3 different class I phosphoinositide 3-kinase and class III phosphatidylinositol 3-kinase (PtdIns3K) inhibitors or through ATG7 silencing prevented myofibroblast differentiation. Autophagic fibroblasts showed increased expression and secretion of CTGF (connective tissue growth factor), and CTGF silencing prevented myofibroblast differentiation. Phosphorylation of the MTORC1 target RPS6KB1/p70S6K kinase was abolished in starved fibroblasts. Phosphorylation of AKT at Ser473, a MTORC2 target, was reduced after initiation of starvation but was followed by spontaneous rephosphorylation after 2 d of starvation, suggesting the reactivation of MTORC2 with sustained autophagy. Inhibiting MTORC2 activation with long-term exposure to rapamycin or by silencing RICTOR, a central component of the MTORC2 complex abolished AKT rephosphorylation. Both RICTOR silencing and rapamycin treatment prevented CTGF and ACTA2 upregulation, demonstrating the central role of MTORC2 activation in CTGF induction and myofibroblast differentiation. Finally, inhibition of autophagy with PtdIns3K inhibitors or ATG7 silencing blocked AKT rephosphorylation. Collectively, these results identify autophagy as a novel activator of MTORC2 signaling leading to CTGF induction and myofibroblast differentiation.
In most, if not all, organs, tissue repair follows a stereotypical sequence of events that includes the differentiation of resident fibroblasts and stromal cells into myofibroblasts. In turn, differentiated myofibroblasts produce increased amounts of extracellular matrix (ECM) components such as COL1A1 and COL3A1 and acquire a contractile phenotype through enhanced expression of ACTA2 and formation of stress fibers. Myofibroblasts are key effectors of tissue repair and, under the influence of appropriate extracellular signals, favor tissue remodeling and wound closure. In fibrotic disorders, persistent myofibroblast accumulation fuels inappropriate ECM deposition, contracture, tissue deformation, and loss of function. TGFB (transforming growth factor, β) is one of the first mediators shown to mediate both initiation and perpetuation of myofibroblast differentiation. TGFB gene and protein expression are increased in an array of fibrotic disorders including pulmonary fibrosis, liver cirrhosis, chronic renal failure, and systemic sclerosis. In the past decade, a large body of evidence has demonstrated that CTGF/CCN2, is another central mediator of myofibroblast differentiation and fibrosis. CTGF expression is activated downstream of TGFB-dependent SMAD signaling and various reports point to CTGF as a key activator of myofibroblast differentiation. Also, the secretion of CTGF enhances TGFB signaling through increased receptor and cell-surface binding and SMAD phosphorylation favoring an autocrine fibrogenic amplification loop. Increased expression of CTGF has also been reported in a wide variety of fibrotic conditions including liver, renal and pulmonary fibrosis, and systemic sclerosis. More recently, different reports have shown that, in certain systems, CTGF can induce and sustain myofibroblast differentiation and development of fibrosis through TGFB-independent pathways. The pathways that foster CTGF overexpression independently of TGFB-signaling remain incompletely characterized but appear to involve, at least in part, responses to stress and hypoxia.Autophagy is a highly conserved catabolic pathway activated in response to stress or starvation. During autophagy, damaged organelles and selected proteins are sequestered within autophagosomes and targeted for degradation following autophagosome-lysosome fusion as a means of sustaining metabolism. Autophagy is initiated by MTORC1 inhibition, which facilitates activation of the PIK3C3/VPS34-PIK3R4-AMBRA1 complex required for initiation of autophagosome formation. Recent studies have highlighted a correlation between dysregulated autophagy and the development of fibrosis. Both up- and downregulation of autophagy have been associated with fibrosis in various organs, highlighting the potentially diverse functional role that autophagy may play in the various phases of response to stress and tissue repair. In models of liver fibrosis, reduced autophagy was shown to prevent differentiation of hepatic stellate cells into myofibroblast-like cells, therefore leading to reduced fibrogenesis. Fibrogenic cells of kidney and lung origin have also been shown to rely on autophagy to maintain an activated and fibrogenic phenotype. However, the signaling pathways and central mediators linking autophagy to myofibroblast differentiation and fibrosis remain largely undefined. Whether autophagy leads to fibrosis or prevents the onset of fibrosis is probably, at least in part, related to the cell compartments that are engaging the autophagic response and the downstream signaling pathways that may be triggered by the autophagic program.Here, we sought to characterize the impact of autophagy on myofibroblast differentiation. We report that, in fibroblasts, prolonged autophagy is associated with inhibition of MTORC1 activation and, unexpectedly, enhanced MTORC2 activation, which in turn triggers CTGF-dependent myofibroblast differentiation.
Results
Autophagy is central to myofibroblast differentiation induced by prolonged starvation
To evaluate the functional importance of growth factor deprivation in the simultaneous activation of autophagy and myofibroblast differentiation, humanembryonic lung fibroblasts were exposed to serum-free (starvation) medium (SS). LC3-II/-I ratios increased rapidly in starved fibroblasts () and were further increased in the presence of bafilomycin A1, an inhibitor of vacuolar-type H+-ATPases essential for the acidification of autophagic vacuoles (). Infection with a baculovirus vector expressing GFP-LC3B revealed enhanced accumulation of LC3+ puncta in starved fibroblasts, which was further increased by bafilomycin A1 (). Protein levels of SQSTM1, an autophagic substrate, decreased after 4 h of starvation and remained low thereafter (). Markers of autophagy in starved cells were increased compared with cells maintained in normal culture conditions for up to 7 d (Fig. S1A, S1B). Collectively, these results suggest a sustained enhanced autophagic flux in serum-starved fibroblasts.
Figure 1.
(See previous page). Starvation induces autophagy and myofibroblast differentiation. (A) Upper panel: Western blot showing LC3B-I and -II protein levels in WI-38 fibroblasts exposed to serum-free (starvation) medium (SS). Lower panel: Densitometric analysis of LC3B-II relative to LC3B-I normalized to time 0 (representative of 4 independent experiments, *P < 0.05 t = 0 vs 1 h). (B) Western blot showing LC3B-I and -II protein levels in WI-38 fibroblasts at baseline, starved for 4 h or 1 d and exposed to DMSO (V) or bafilomycin A1 (20 nM; Baf). Representative of 3 independent experiments. (C) Evaluation of LC3B puncta by confocal microscopy in WI-38 fibroblasts infected with a baculovirus vector expressing GFP-LC3B and exposed to normal conditions (medium with 10% FBS; N), serum-free medium with DMSO (V) or serum-free medium with bafilomycin A1 (20 nM) for 1 d. Representative of 3 independent experiments. (D) Upper panel: Western blot showing SQSTM1 and tubulin (TUBA) protein levels in starved WI-38 fibroblasts. Lower panel: Densitometric analysis of SQSTM1 protein levels relative to tubulin. Data are presented as mean ± s.e.m. (representative of 4 independent experiments, *p = 0.02 4 h vs 2 d and 4 h vs 4 d). (E) Upper panel: Western blot showing ACTA2 protein levels in WI-38 fibroblasts exposed to SS medium or grown under normal conditions (N). Tubulin was used as a loading control. Lower panel: Densitometric analysis of ACTA2 protein levels relative to tubulin normalized to time 0 (representative of 4 independent experiments; *p = 0.0170 SS vs N at 4 d). (F) Evaluation of the myofibroblast markers ACTA2 (red) and stress fiber (green) by immunofluorescence microscopy in cells grown in normal medium (N) or maintained without serum (SS) for 4 d. Representative of 3 independent experiments. (G) Real-time qPCR evaluation of mRNA levels of COL1A1 and COL3A1 after 4 d in N or SS. GAPDH was used as the reference gene (***P < 0.001 N vs SS, representative of 2 independent experiments performed in triplicate).
(See previous page). Starvation induces autophagy and myofibroblast differentiation. (A) Upper panel: Western blot showing LC3B-I and -II protein levels in WI-38 fibroblasts exposed to serum-free (starvation) medium (SS). Lower panel: Densitometric analysis of LC3B-II relative to LC3B-I normalized to time 0 (representative of 4 independent experiments, *P < 0.05 t = 0 vs 1 h). (B) Western blot showing LC3B-I and -II protein levels in WI-38 fibroblasts at baseline, starved for 4 h or 1 d and exposed to DMSO (V) or bafilomycin A1 (20 nM; Baf). Representative of 3 independent experiments. (C) Evaluation of LC3B puncta by confocal microscopy in WI-38 fibroblasts infected with a baculovirus vector expressing GFP-LC3B and exposed to normal conditions (medium with 10% FBS; N), serum-free medium with DMSO (V) or serum-free medium with bafilomycin A1 (20 nM) for 1 d. Representative of 3 independent experiments. (D) Upper panel: Western blot showing SQSTM1 and tubulin (TUBA) protein levels in starved WI-38 fibroblasts. Lower panel: Densitometric analysis of SQSTM1 protein levels relative to tubulin. Data are presented as mean ± s.e.m. (representative of 4 independent experiments, *p = 0.02 4 h vs 2 d and 4 h vs 4 d). (E) Upper panel: Western blot showing ACTA2 protein levels in WI-38 fibroblasts exposed to SS medium or grown under normal conditions (N). Tubulin was used as a loading control. Lower panel: Densitometric analysis of ACTA2 protein levels relative to tubulin normalized to time 0 (representative of 4 independent experiments; *p = 0.0170 SS vs N at 4 d). (F) Evaluation of the myofibroblast markers ACTA2 (red) and stress fiber (green) by immunofluorescence microscopy in cells grown in normal medium (N) or maintained without serum (SS) for 4 d. Representative of 3 independent experiments. (G) Real-time qPCR evaluation of mRNA levels of COL1A1 and COL3A1 after 4 d in N or SS. GAPDH was used as the reference gene (***P < 0.001 N vs SS, representative of 2 independent experiments performed in triplicate).We then evaluated whether markers of myofibroblast differentiation were modulated in association with autophagy. Protein levels of ACTA2 increased significantly after 4 d of serum starvation (). After 4 d, serum-starved fibroblasts also showed enhanced ACTA2 protein levels and the presence of organized stress fibers by immunofluorescence microscopy (). COL1A1 and COL3A1 mRNA levels () and proCOL1A1 protein levels (Fig. S1C) also increased in starved fibroblasts. Similarly, in mouse embryonic fibroblasts and adult human lung fibroblasts, we found an association between increased autophagy upon long-term serum starvation and evidence of myofibroblast differentiation (Fig. S1D). Fibroblasts maintained in normal culture conditions for up to 7 d did not show evidence of myofibroblast differentiation (Fig. S1B).To analyze the functional role of autophagy in myofibroblast differentiation, we inhibited the autophagic response in starved fibroblasts with 3-methyladenine (3-MA), wortmanmin (W) or LY294002 (LY). In starved cells these chemicals inhibit PtdIns3K. All 3 inhibitors prevented enhanced LC3-II/-I ratios upon starvation () and also prevented upregulation of ACTA2 (
and S2A, S2B) and pro-COL1A1 (Fig. S2C). Autophagy inhibition also prevented the formation of stress fibers and reduced collagen mRNA synthesis (). Inhibiting autophagy through silencing of the key autophagic gene ATG7 prevented myofibroblast differentiation () further supporting the central role of autophagy in triggering pathways leading to myofibroblast differentiation. We also considered the potential role of cell death in our system. In previous work, we showed that WI-38 fibroblasts serum starved for up to 7 d maintained low levels of apoptosis and no sign of necrosis. Also, PARP cleavage, another read-out of apoptotic cell death, is not enhanced in fibroblasts serum starved for 4 or 7 d (Fig. S2D). Collectively, these results suggest that cell death-dependent pathways are unlikely contributors to the association between autophagy and myofibroblast differentiation.
Figure 2.
Autophagy induces myofibroblast differentiation in starved fibroblasts. (A) Western blot showing LC3B-I and -II protein levels in WI-38 fibroblasts at baseline or starved in the presence of 3-methyladenine (1 mM; 3-MA), wortmannin (100 nM; W), LY294002 (5 μM; LY) or vehicle (V) for 4 h. Representative of 4 independent experiments. (B) Western blot showing ACTA2 protein levels in WI-38 fibroblasts at baseline or starved and incubated with the same inhibitors as in A for 4 d. Representative of 4 independent experiments. (C) Evaluation of the myofibroblast markers ACTA2 (red) and stress fiber formation (green) by immunofluorescence microscopy in fibroblasts exposed to SS in the presence of LY or V for 4 d. Cell nuclei are visualized in blue. ACTA2 and stress fiber staining of fibroblasts grown in normal medium or starved for 4 d from the same experiment are shown in . Representative of 3 independent experiments. (D) COL1A1 and COL3A1 mRNA levels evaluated by real time qPCR in WI-38 fibroblasts serum starved for 4 d in the presence of the PtdIns3K inhibitor LY or vehicle. GAPDH was used as the reference gene (***P < 0.001 V vs LY for COL1A1 and **P < 0.01 V vs LY for COL3A1). Collagen mRNA levels of fibroblasts grown in normal medium or starved for 4 d from the same experiment are shown in . Representative of 2 independent experiments performed in triplicate. (E) Left panel: Western blot showing ATG7, SQSTM1 and tubulin (TUBA) protein levels in WI-38 fibroblasts starved for 2 d post-nucleofection with control siRNA (siCTL) or ATG7 siRNA (siATG7). Representative of 3 independent experiments. Right panel: Densitometric analysis of SQSTM1 protein level relative to tubulin (representative of 3 independent experiments, *p = 0.0318) in WI-38 fibroblasts silenced for ATG7 expression (ATG7 silencing is effective at 80.6% ± 6.0%, representative of 3 independent experiments, ***P < 0.0001). (F) Left panel: Western blot showing ATG7, ACTA2, and tubulin (TUBA) protein levels in WI-38 fibroblasts starved for 4 d post-nucleofection with control siRNA (siCTL) or ATG7 siRNA (siATG7). Representative of 4 independent experiments. Right panel: Densitometric analysis of ACTA2 level relative to tubulin (***p = 0.0005 representative of 4 independent experiments) in WI-38 fibroblasts silenced for ATG7 expression (ATG7 silencing is effective at 87.4% ± 4.4%, from 4 independent experiments, ***P < 0.0001).
Autophagy induces myofibroblast differentiation in starved fibroblasts. (A) Western blot showing LC3B-I and -II protein levels in WI-38 fibroblasts at baseline or starved in the presence of 3-methyladenine (1 mM; 3-MA), wortmannin (100 nM; W), LY294002 (5 μM; LY) or vehicle (V) for 4 h. Representative of 4 independent experiments. (B) Western blot showing ACTA2 protein levels in WI-38 fibroblasts at baseline or starved and incubated with the same inhibitors as in A for 4 d. Representative of 4 independent experiments. (C) Evaluation of the myofibroblast markers ACTA2 (red) and stress fiber formation (green) by immunofluorescence microscopy in fibroblasts exposed to SS in the presence of LY or V for 4 d. Cell nuclei are visualized in blue. ACTA2 and stress fiber staining of fibroblasts grown in normal medium or starved for 4 d from the same experiment are shown in . Representative of 3 independent experiments. (D) COL1A1 and COL3A1 mRNA levels evaluated by real time qPCR in WI-38 fibroblasts serum starved for 4 d in the presence of the PtdIns3K inhibitor LY or vehicle. GAPDH was used as the reference gene (***P < 0.001 V vs LY for COL1A1 and **P < 0.01 V vs LY for COL3A1). Collagen mRNA levels of fibroblasts grown in normal medium or starved for 4 d from the same experiment are shown in . Representative of 2 independent experiments performed in triplicate. (E) Left panel: Western blot showing ATG7, SQSTM1 and tubulin (TUBA) protein levels in WI-38 fibroblasts starved for 2 d post-nucleofection with control siRNA (siCTL) or ATG7 siRNA (siATG7). Representative of 3 independent experiments. Right panel: Densitometric analysis of SQSTM1 protein level relative to tubulin (representative of 3 independent experiments, *p = 0.0318) in WI-38 fibroblasts silenced for ATG7 expression (ATG7 silencing is effective at 80.6% ± 6.0%, representative of 3 independent experiments, ***P < 0.0001). (F) Left panel: Western blot showing ATG7, ACTA2, and tubulin (TUBA) protein levels in WI-38 fibroblasts starved for 4 d post-nucleofection with control siRNA (siCTL) or ATG7 siRNA (siATG7). Representative of 4 independent experiments. Right panel: Densitometric analysis of ACTA2 level relative to tubulin (***p = 0.0005 representative of 4 independent experiments) in WI-38 fibroblasts silenced for ATG7 expression (ATG7 silencing is effective at 87.4% ± 4.4%, from 4 independent experiments, ***P < 0.0001).
TGFB-independent and CTGF-dependent pathways control autophagy-induced myofibroblast differentiation
We then sought to characterize the mediators implicated in autophagy-induced myofibroblast differentiation. TGFB is a classical inducer of myofibroblast differentiation, and fibrogenic signaling downstream of TGFB involves the SMAD family of transcriptional activators. To determine if TGFB signaling is implicated in autophagy-induced myofibroblast differentiation, SMAD2 phosphorylation was evaluated by immunoblotting in serum-starved fibroblasts. Serum starvation failed to induce SMAD2 phosphorylation, whereas exposure to recombinant TGFB1 induced strong SMAD2 phosphorylation (
and S3A). Since TGFB can trigger fibrogenic signals through noncanonical SMAD-independent pathways, we also evaluated ACTA2 protein levels in serum-starved fibroblasts in the presence of antibodies neutralizing all TGFB1, 2 and 3 isoforms or isotype-matched control. Recombinant TGFB1 was used as a positive control for the neutralizing capacity of the anti-TGFB antibody. Anti-TGFB neutralization failed to reduce myofibroblast differentiation in starved fibroblasts (
lane 2) but effectively dampened ACTA2 overexpression induced by recombinant TGFB1 (
lane 5). Collectively, these results suggest that autophagy elicits myofibroblast differentiation largely through TGFB-independent pathways.
Figure 3.
(See previous page). Myofibroblast differentiation induced by starvation is dependent on CTGF upregulation. (A) Western blot showing phosphorylated SMAD2 and total SMAD2/3 in WI-38 fibroblasts cultured under normal conditions (N), serum starved (SS) or incubated with human recombinant TGFB1 (2 ng/ml) in SS for 1 or 3 d. Incubation with TGFB1 was used as a positive control for SMAD signaling. Representative of 3 independent experiments. (B) Upper panel: Western blot showing ACTA2 protein levels in WI-38 fibroblasts exposed to SS for 4 d in the presence of a neutralizing antibody (NAb) against pan-TGFB, or isotype-matched control (iso), both at 10 ug/ml. Recombinant human TGFB1 (0.1 ng/ml) was used as a positive control for the neutralizing activity of the pan-TGFB antibody. Representative of 4 independent experiments. Lower panel: Densitometric analysis of ACTA2 relative to tubulin (TUBA) protein levels (representative of 4 independent experiments, *p = 0.03 neutralizing antibody vs iso in the presence of TGFB1, *p = 0.03 SS vs TGFB1 in SS). (C) Evaluation of CTGF expression by real time qPCR in WI-38 fibroblasts exposed to serum-free medium (SS) or grown in normal condition (N) for 4 d (**p = 0.002). Representative of 2 independent experiments performed in triplicate. (D) Upper panel: Western blot showing intracellular CTGF protein levels in WI-38 fibroblasts at baseline, starved for up to 4 d or maintained in normal medium for 4 d. Representative of 8 independent experiments. Lower panel: Densitometric analysis of intracellular CTGF relative to tubulin protein levels normalized to time 0 (representative of 8 independent experiments, *p = 0.01 1d vs 4 d and 2 d vs 4 d in SS). (E) Upper panel: Evaluation of extracellular CTGF by WB in media conditioned by WI-38 fibroblasts exposed to SS for 0, 2 or 4 d. Representative of 8 independent experiments. Lower panel: Densitometric analysis of extracellular CTGF (representative of 8 independent experiments, *p = 0.01 2 d vs 4 d). (F) Upper panel: Western blot showing intracellular CTGF and ACTA2 protein levels in WI-38 fibroblasts exposed to SS for 5 d post-transfection with control siRNA (siCTL) or siRNA specific to CTGF (siCTGF). Representative of 5 independent experiments. Lower panel: Densitometric analysis of ACTA2 level relative to tubulin (representative of 5 independent experiments, **p = 0.004) in WI-38 fibroblasts silenced for CTGF expression (CTGF silencing is effective at 77.3% ± 4.8%, representative of 5 independent experiments, ***p = 0.0002).
(See previous page). Myofibroblast differentiation induced by starvation is dependent on CTGF upregulation. (A) Western blot showing phosphorylated SMAD2 and total SMAD2/3 in WI-38 fibroblasts cultured under normal conditions (N), serum starved (SS) or incubated with human recombinant TGFB1 (2 ng/ml) in SS for 1 or 3 d. Incubation with TGFB1 was used as a positive control for SMAD signaling. Representative of 3 independent experiments. (B) Upper panel: Western blot showing ACTA2 protein levels in WI-38 fibroblasts exposed to SS for 4 d in the presence of a neutralizing antibody (NAb) against pan-TGFB, or isotype-matched control (iso), both at 10 ug/ml. Recombinant humanTGFB1 (0.1 ng/ml) was used as a positive control for the neutralizing activity of the pan-TGFB antibody. Representative of 4 independent experiments. Lower panel: Densitometric analysis of ACTA2 relative to tubulin (TUBA) protein levels (representative of 4 independent experiments, *p = 0.03 neutralizing antibody vs iso in the presence of TGFB1, *p = 0.03 SS vs TGFB1 in SS). (C) Evaluation of CTGF expression by real time qPCR in WI-38 fibroblasts exposed to serum-free medium (SS) or grown in normal condition (N) for 4 d (**p = 0.002). Representative of 2 independent experiments performed in triplicate. (D) Upper panel: Western blot showing intracellular CTGF protein levels in WI-38 fibroblasts at baseline, starved for up to 4 d or maintained in normal medium for 4 d. Representative of 8 independent experiments. Lower panel: Densitometric analysis of intracellular CTGF relative to tubulin protein levels normalized to time 0 (representative of 8 independent experiments, *p = 0.01 1d vs 4 d and 2 d vs 4 d in SS). (E) Upper panel: Evaluation of extracellular CTGF by WB in media conditioned by WI-38 fibroblasts exposed to SS for 0, 2 or 4 d. Representative of 8 independent experiments. Lower panel: Densitometric analysis of extracellular CTGF (representative of 8 independent experiments, *p = 0.01 2 d vs 4 d). (F) Upper panel: Western blot showing intracellular CTGF and ACTA2 protein levels in WI-38 fibroblasts exposed to SS for 5 d post-transfection with control siRNA (siCTL) or siRNA specific to CTGF (siCTGF). Representative of 5 independent experiments. Lower panel: Densitometric analysis of ACTA2 level relative to tubulin (representative of 5 independent experiments, **p = 0.004) in WI-38 fibroblasts silenced for CTGF expression (CTGF silencing is effective at 77.3% ± 4.8%, representative of 5 independent experiments, ***p = 0.0002).CTGF is increasingly recognized as a downstream integrator of various fibrogenic stimuli and a specific marker of fibrotic tissues. Hence, we evaluated if starvation modulates CTGF mRNA and protein levels. Prolonged starvation led to a significant increase in CTGF mRNA level (). There was an initial decrease in cellular CTGF protein levels upon initiation of starvation. This was followed, after 2 and 4 d of starvation, with a progressive increase in CTGF levels (
and S3B). Also, extracellular release of CTGF rose over time in serum-starved fibroblasts (). We then investigated the functional importance of CTGF in starvation-induced myofibroblast differentiation. Blocking CTGF upregulation with siRNAs significantly lowered ACTA2 protein levels in autophagic fibroblasts (), establishing a central role for CTGF in myofibroblast-differentiation triggered by starvation.To test whether autophagy is an upstream regulator of CTGF expression in starved cells, we inhibited autophagy with PtdIns3K inhibitors and evaluated intracellular and extracellular CTGF protein levels. LY294002 (), 3-MA and wortmannin (Fig. S4) all prevented upregulation of intracellular CTGF protein levels in fibroblasts serum starved for 4 d. CTGF secretion () and CTGF mRNA levels () were also significantly reduced in fibroblasts serum starved in the presence of LY294002. To further characterize the importance of the autophagic process in regulating CTGF levels, we inhibited autophagy through ATG7 silencing. Again, inhibition of autophagy prevented CTGF upregulation (). Collectively, these results confirm that autophagy is an upstream regulator of CTGF expression.
Figure 4.
Autophagy is central for CTGF upregulation in starved fibroblasts. (A) Upper panel: Western blot showing intracellular CTGF protein levels in serum-starved WI-38 fibroblasts incubated with the autophagy inhibitor LY294002 5 uM (LY) or vehicle (V) for 4 d. Representative of 4 independent experiments. Lower panel: Densitometric analysis of intracellular CTGF protein levels relative to tubulin (representative of 4 independent experiments, *p = 0.0286). (B) Upper panel: Western blot of extracellular CTGF protein levels in media conditioned by starved WI-38 fibroblasts in the presence of the inhibitor LY294002 5 uM (LY) or vehicle (V) for 4 d. Representative of 4 independent experiments. Lower panel: Densitometric analysis of extracellular CTGF protein levels (representative of 4 independent experiments, *p = 0.03 V vs LY at 4 d). (C) Evaluation of CTGF expression by qPCR in WI-38 fibroblasts exposed to serum-free medium (SS) in the presence of LY294002 5 uM (LY) or vehicle (V) for 4 d (**p = 0.0036). CTGF expression was normalized to GAPDH. CTGF mRNA levels of fibroblasts grown in normal medium or starved for 4 d from the same experiment are shown in . Representative of 2 independent experiments performed in triplicate. (D) Left panel: Western blot showing ATG7, CTGF and tubulin (TUBA) protein levels in WI-38 fibroblasts exposed to SS for 4 d post-nucleofection with control siRNA (siCTL) or siRNA specific to ATG7 (siATG7). Representative of 4 independent experiments. Right panel: Densitometric analysis of CTGF level relative to tubulin (**p = 0.0087 representative of 4 independent experiments) in WI-38 fibroblasts silenced for ATG7 expression (ATG7 silencing is effective at 87.4% ± 4.4%, representative of 4 independent experiments, *** P < 0.0001).
Autophagy is central for CTGF upregulation in starved fibroblasts. (A) Upper panel: Western blot showing intracellular CTGF protein levels in serum-starved WI-38 fibroblasts incubated with the autophagy inhibitor LY294002 5 uM (LY) or vehicle (V) for 4 d. Representative of 4 independent experiments. Lower panel: Densitometric analysis of intracellular CTGF protein levels relative to tubulin (representative of 4 independent experiments, *p = 0.0286). (B) Upper panel: Western blot of extracellular CTGF protein levels in media conditioned by starved WI-38 fibroblasts in the presence of the inhibitor LY294002 5 uM (LY) or vehicle (V) for 4 d. Representative of 4 independent experiments. Lower panel: Densitometric analysis of extracellular CTGF protein levels (representative of 4 independent experiments, *p = 0.03 V vs LY at 4 d). (C) Evaluation of CTGF expression by qPCR in WI-38 fibroblasts exposed to serum-free medium (SS) in the presence of LY294002 5 uM (LY) or vehicle (V) for 4 d (**p = 0.0036). CTGF expression was normalized to GAPDH. CTGF mRNA levels of fibroblasts grown in normal medium or starved for 4 d from the same experiment are shown in . Representative of 2 independent experiments performed in triplicate. (D) Left panel: Western blot showing ATG7, CTGF and tubulin (TUBA) protein levels in WI-38 fibroblasts exposed to SS for 4 d post-nucleofection with control siRNA (siCTL) or siRNA specific to ATG7 (siATG7). Representative of 4 independent experiments. Right panel: Densitometric analysis of CTGF level relative to tubulin (**p = 0.0087 representative of 4 independent experiments) in WI-38 fibroblasts silenced for ATG7 expression (ATG7 silencing is effective at 87.4% ± 4.4%, representative of 4 independent experiments, *** P < 0.0001).
Implication of the MTORC1 and MTORC2 pathways in autophagy-induced myofibroblast differentiation
Inhibition of MTOR signaling prevents myofibroblast differentiation in other systems. We therefore considered the possibility that MTOR-dependent pathways could be implicated in autophagy-induced myofibroblast differentiation. Phosphorylation of the MTORC1 downstream target RPS6KB1 was rapidly and durably decreased in serum-starved fibroblasts (
and S5A). Phorphorylation of the MTORC2 target AKT at Ser473 initially decreased upon initiation of serum starvation (). However, after 2 d of serum starvation, AKT was progressively rephosphorylated at Ser473 (), suggesting the reactivation of MTORC2 with prolonged starvation.
Figure 5.
Activation of MTORC2 signaling in starved fibroblasts. (A) Upper panel: Western blot showing phosphorylation of AKT Ser473 (AKT p) and total AKT (AKT t) in WI-38 fibroblasts at baseline and exposed to serum-free medium (SS) for up to 4 d. Representative of 5 independent experiments. Lower panel: Densitometric analysis of AKT p relative to AKT t normalized to time 0 (representative of 5 independent experiments, *p = 0.0189 2 d vs 4 d and *p = 0.0238 1d vs 4 d). (B) Upper panel: Western blot showing phosphorylation of RPS6KB1 (MTORC1 downstream target) and phosphorylation of AKT Ser473 (MTORC2 target) in WI-38 fibroblasts at baseline and starved (SS) for up to 4 d in the presence of rapamycin (10 nM; R) or vehicle (V). Total AKT level was also evaluated by WB. Ponceau Red staining was used as loading control. Representative of 4 independent experiments. Middle panel: Densitometric analysis of phosphorylated RPS6KB1 relative to tubulin (representative of 4 independent experiments, *p = 0.0286 V vs R at 10 min). Data were normalized to baseline. Lower panel: Densitometric analysis of AKT p relative to AKT t (representative of 4 independent experiments, *p = 0.0237 V vs R at d 4). Data were normalized to baseline. (C) Upper panel: Western blot showing LC3B-I and -II protein levels in WI-38 fibroblasts at baseline or exposed to SS for 4 h, 2 d or 4 d in the presence of rapamycin (10 nM; R) or vehicle (V). Representative of 5 independent experiments. Lower panel: Densitometric analysis of LC3B-II relative to LC3B-I (representative of 5 independent experiments; *p = 0.0456 V vs R at 4 h, *p = 0.0444 V vs R at 2 d, *p = 0.0266 V vs R at 4 d).
Activation of MTORC2 signaling in starved fibroblasts. (A) Upper panel: Western blot showing phosphorylation of AKTSer473 (AKT p) and total AKT (AKT t) in WI-38 fibroblasts at baseline and exposed to serum-free medium (SS) for up to 4 d. Representative of 5 independent experiments. Lower panel: Densitometric analysis of AKT p relative to AKT t normalized to time 0 (representative of 5 independent experiments, *p = 0.0189 2 d vs 4 d and *p = 0.0238 1d vs 4 d). (B) Upper panel: Western blot showing phosphorylation of RPS6KB1 (MTORC1 downstream target) and phosphorylation of AKTSer473 (MTORC2 target) in WI-38 fibroblasts at baseline and starved (SS) for up to 4 d in the presence of rapamycin (10 nM; R) or vehicle (V). Total AKT level was also evaluated by WB. Ponceau Red staining was used as loading control. Representative of 4 independent experiments. Middle panel: Densitometric analysis of phosphorylated RPS6KB1 relative to tubulin (representative of 4 independent experiments, *p = 0.0286 V vs R at 10 min). Data were normalized to baseline. Lower panel: Densitometric analysis of AKT p relative to AKT t (representative of 4 independent experiments, *p = 0.0237 V vs R at d 4). Data were normalized to baseline. (C) Upper panel: Western blot showing LC3B-I and -II protein levels in WI-38 fibroblasts at baseline or exposed to SS for 4 h, 2 d or 4 d in the presence of rapamycin (10 nM; R) or vehicle (V). Representative of 5 independent experiments. Lower panel: Densitometric analysis of LC3B-II relative to LC3B-I (representative of 5 independent experiments; *p = 0.0456 V vs R at 4 h, *p = 0.0444 V vs R at 2 d, *p = 0.0266 V vs R at 4 d).We then evaluated the impact of rapamycin on phosphorylation of MTORC1 and MTORC2 targets, autophagy, and myofibroblast differentiation. Rapamycin induces autophagy by interacting with FKBP12 leading to MTORC1 inhibition whereas long-term exposures to rapamycin can, in certain circumstances, inhibit MTORC2 by preventing formation of new MTORC2 complexes. In starved and unstarved fibroblasts, rapamycin decreased RPS6KB1 phosphorylation confirming its MTORC1 inhibitory activity (
and S5B) and enhanced autophagy with increased LC3-II/-I ratios or decreased SQSTM1 protein levels (
and S5B). Rapamycin also significantly decreased AKT rephosphorylation at Ser473 in fibroblasts that were serum starved for longer than 2 d () whereas, in unstarved fibroblasts, rapamycin did not reduce and rather enhanced MTORC2 activity, as demonstrated with increased AKT phosphorylation (Fig. S5B). This translated into enhanced myofibroblast differentiation with increased expression of CTGF and ACTA2 (Fig. S5B). This result is consistent with previous reports showing that rapamycin preferentially inhibits MTORC1 vs MTORC2 and that MTORC1 blockade can release MTORC1-dependent inhibition of MTORC2. However, in starved cells, rapamycin decreased MTORC2 activity leading to inhibition of myofibroblast differentiation. Rapamycin prevented the upregulation of both ACTA2 and intracellular CTGF protein levels in serum-starved fibroblasts () and also significantly reduced CTGF secretion (). Serum-starved fibroblasts exposed to rapamycin also showed reduced COL1A1 mRNA level () and proCOL1A1 protein level (Fig. S6A). We also exposed starved cells to Torin 1, a dual inhibitor of the MTOR complexes. Torin 1 inhibited MTORC1 and MTORC2 activities, reduced CTGF secretion and ACTA2 and proCOL1A1 synthesis (Fig. S6B, S6C, S6D). Collectively, these results suggest that MTORC2 activity is likely central for autophagy-induced myofibroblast differentiation.
Figure 6.
Blockade of autophagy-induced myofibroblast differentiation by rapamycin. (A) Upper panel: Western blot showing ACTA2 and intracellular CTGF protein levels in serum-starved WI-38 fibroblasts incubated with the MTOR inhibitor rapamycin (10 nM; R) or vehicle (V) for 4 d. Representative of 5 independent experiments. Middle panel: Densitometric analysis of ACTA2 protein levels relative to tubulin (representative of 5 independent experiments; *p = 0.0189). Lower panel: Densitometric analysis of intracellular CTGF protein levels relative to tubulin (representative of 5 independent experiments, *p = 0.0485). (B) Upper panel: Western blot showing extracellular CTGF protein levels in media conditioned by WI-38 fibroblasts starved in the presence of rapamycin (R) or vehicle (V) for 4 d. Representative of 5 independent experiments. Lower panel: Densitometric analysis of extracellular CTGF, representative of 5 independent experiments, ***P < 0.0001 V vs R. (C) Evaluation of the expression of the myofibroblast marker COL1A1 by real-time qPCR in WI-38 fibroblasts serum starved for 4 d in the presence of rapamycin (10 nM; R) or vehicle (V) (**p = 0.005 V vs R). Collagen mRNA levels of fibroblasts grown in normal medium or starved for 4 d from the same experiment are shown in . Representative of 2 independent experiments performed in triplicate. (D) Effects of MTORC2 inhibition by RICTOR silencing on levels of downstream target AKT phosphorylation, myofibroblast marker ACTA2, and intracellular CTGF. Left panel: Cells were incubated in SS for 4 d after electroporation with control siRNA (siCTL) or siRICTOR. Cell lysates were analyzed by WB. Inhibition of RICTOR expression (82.3 +/- 17.3%, representative of 4 independent experiments, ***P < 0.0001) was achieved over siCTL. Right upper panel: Densitometric analysis of AKT p relative to total AKT (representative of 4 independent experiments; ***p = 0.0002). Right middle panel: Densitometric analysis of ACTA2 relative to tubulin (representative of 4 independent experiments; ***p = 0.0003). Right lower panel: Densitometric analysis of intracellular CTGF relative to tubulin (representative of 4 independent experiments; *p = 0.0286). (E) Upper panel: Evaluation of extracellular CTGF by WB in conditioned media from the experiment described in (C). Lower panel: Densitometric analysis of extracellular CTGF (representative of 4 independent experiments; *p = 0.0286).
Blockade of autophagy-induced myofibroblast differentiation by rapamycin. (A) Upper panel: Western blot showing ACTA2 and intracellular CTGF protein levels in serum-starved WI-38 fibroblasts incubated with the MTOR inhibitor rapamycin (10 nM; R) or vehicle (V) for 4 d. Representative of 5 independent experiments. Middle panel: Densitometric analysis of ACTA2 protein levels relative to tubulin (representative of 5 independent experiments; *p = 0.0189). Lower panel: Densitometric analysis of intracellular CTGF protein levels relative to tubulin (representative of 5 independent experiments, *p = 0.0485). (B) Upper panel: Western blot showing extracellular CTGF protein levels in media conditioned by WI-38 fibroblasts starved in the presence of rapamycin (R) or vehicle (V) for 4 d. Representative of 5 independent experiments. Lower panel: Densitometric analysis of extracellular CTGF, representative of 5 independent experiments, ***P < 0.0001 V vs R. (C) Evaluation of the expression of the myofibroblast marker COL1A1 by real-time qPCR in WI-38 fibroblasts serum starved for 4 d in the presence of rapamycin (10 nM; R) or vehicle (V) (**p = 0.005 V vs R). Collagen mRNA levels of fibroblasts grown in normal medium or starved for 4 d from the same experiment are shown in . Representative of 2 independent experiments performed in triplicate. (D) Effects of MTORC2 inhibition by RICTOR silencing on levels of downstream target AKT phosphorylation, myofibroblast marker ACTA2, and intracellular CTGF. Left panel: Cells were incubated in SS for 4 d after electroporation with control siRNA (siCTL) or siRICTOR. Cell lysates were analyzed by WB. Inhibition of RICTOR expression (82.3 +/- 17.3%, representative of 4 independent experiments, ***P < 0.0001) was achieved over siCTL. Right upper panel: Densitometric analysis of AKT p relative to total AKT (representative of 4 independent experiments; ***p = 0.0002). Right middle panel: Densitometric analysis of ACTA2 relative to tubulin (representative of 4 independent experiments; ***p = 0.0003). Right lower panel: Densitometric analysis of intracellular CTGF relative to tubulin (representative of 4 independent experiments; *p = 0.0286). (E) Upper panel: Evaluation of extracellular CTGF by WB in conditioned media from the experiment described in (C). Lower panel: Densitometric analysis of extracellular CTGF (representative of 4 independent experiments; *p = 0.0286).To explore further the importance of MTORC2 activation in autophagy-induced myofibroblast differentiation, RICTOR, an integral component of the MTORC2 complex, was silenced. RICTOR silencing in serum-starved fibroblasts prevented AKT phosphorylation at Ser473 (). RICTOR silencing also blocked ACTA2 upregulation (). This was associated with reduced intracellular CTGF protein levels and reduced secretion of CTGF (). Silencing RPTOR, a constituent of the MTORC1 complex, in starved fibroblasts did not modulate ACTA2 and CTGF levels (Fig. S6E). Collectively, these results identify MTORC2 activation as a central regulator of CTGF upregulation and myofibroblast differentiation in serum-starved fibroblasts.
Autophagy is a novel activator of MTORC2-signaling
We then sought to evaluate whether autophagy per se was central to MTORC2 activation in our system. Blocking autophagy in starved fibroblasts with 3-MA, wortmannin or LY294002 significantly reduced phosphorylation of AKT at Ser473 (), but did not modulate MTORC1 activity (Fig. S7A, S7B). To rule out the possibility that these autophagy inhibitors could directly alter MTORC2 activity independently of autophagy, we also evaluated the impact of ATG7 silencing on Ser473 AKT phosphorylation. ATG7 silencing reduced AKT phosphorylation in starved fibroblasts (), demonstrating the importance of the autophagic response in triggering MTORC2 activation. Also, in starved fibroblasts silenced for ATG7, transduction with a constitutively active AKT construct enhanced myofibroblast differentiation, with increased protein levels of CTGF and ACTA2 (Fig. S7C). Collectively, these results identify sustained autophagy as a novel activator of MTORC2-dependent signaling leading to enhanced CTGF expression and secretion which in turn fosters myofibroblast differentiation ().
Figure 7.
Autophagy is essential for MTORC2 activity induced by serum starvation. (A) Upper panel: Evaluation of AKT Ser473 phosphorylation (AKT p) and total AKT (AKT t) by WB in WI-38 fibroblasts at baseline or exposed to SS plus vehicle for 2 d or maintained in SS with the autophagy inhibitors 3-methyladenine (1 mM; 3-MA), wortmannin (100 nM; W), or LY294002 (5 μM; LY). Representative of 4 independent experiments. Lower left panel: Densitometric analysis of AKT p relative to AKT t in cells exposed to DMSO or 3-MA (representative of 4 independent experiments, *p = 0.0286). Lower right panel: Densitometric analysis of AKT p relative to AKT t in cells exposed to DMSO or LY (representative of 4 independent experiments, *p = 0.0114 V vs LY at d 2). (B) Upper panel: Evaluation of AKT Ser473 phosphorylation (AKT p) and total AKT (AKT t) by WB in WI-38 fibroblasts exposed to SS for 2 d post-transfection with control siRNA (siCTL) or siRNA specific to ATG7 (siATG7). Representative of 3 independent experiments. Lower panel: Densitometric analysis of AKT p protein level relative to AKT t (representative of 3 independent experiments, ***P < 0.0001) in WI-38 fibroblasts silenced for ATG7 expression (ATG7 silencing is effective at 80.6% ± 6.0%, representative of 3 independent experiments, ***P < 0.0001).
Figure 8.
Long-term autophagy favors MTORC2 activation leading to enhanced CTGF production and myofibroblast differentiation. Short-term serum starvation inactivates MTORC1 and MTORC2 signaling leading to dephosphorylation of RPS6KB1 (Thr389) and AKT (Ser473). MTORC1 inhibition induces autophagy, demonstrated by a higher LC3B-II/-I ratio and lower SQSTM1 level. Rapamycin increases autophagy by further inhibiting MTORC1. A sustained autophagic response is responsible for the MTORC2 reactivation when fibroblasts are starved for 2 d or more (long term), as measured by rephosphorylation of AKT at Ser473. In turn, MTORC2 activity drives the production and secretion of the pro-fibrotic cytokine CTGF leading to myofibroblast differentiation. Long-term exposure to rapamycin inactivates MTORC1 leading to an increased autophagic response, but prevents MTORC2 activation and downstream CTGF induction and myofibroblast differentiation.
Autophagy is essential for MTORC2 activity induced by serum starvation. (A) Upper panel: Evaluation of AKTSer473 phosphorylation (AKT p) and total AKT (AKT t) by WB in WI-38 fibroblasts at baseline or exposed to SS plus vehicle for 2 d or maintained in SS with the autophagy inhibitors 3-methyladenine (1 mM; 3-MA), wortmannin (100 nM; W), or LY294002 (5 μM; LY). Representative of 4 independent experiments. Lower left panel: Densitometric analysis of AKT p relative to AKT t in cells exposed to DMSO or 3-MA (representative of 4 independent experiments, *p = 0.0286). Lower right panel: Densitometric analysis of AKT p relative to AKT t in cells exposed to DMSO or LY (representative of 4 independent experiments, *p = 0.0114 V vs LY at d 2). (B) Upper panel: Evaluation of AKTSer473 phosphorylation (AKT p) and total AKT (AKT t) by WB in WI-38 fibroblasts exposed to SS for 2 d post-transfection with control siRNA (siCTL) or siRNA specific to ATG7 (siATG7). Representative of 3 independent experiments. Lower panel: Densitometric analysis of AKT p protein level relative to AKT t (representative of 3 independent experiments, ***P < 0.0001) in WI-38 fibroblasts silenced for ATG7 expression (ATG7 silencing is effective at 80.6% ± 6.0%, representative of 3 independent experiments, ***P < 0.0001).Long-term autophagy favors MTORC2 activation leading to enhanced CTGF production and myofibroblast differentiation. Short-term serum starvation inactivates MTORC1 and MTORC2 signaling leading to dephosphorylation of RPS6KB1 (Thr389) and AKT (Ser473). MTORC1 inhibition induces autophagy, demonstrated by a higher LC3B-II/-I ratio and lower SQSTM1 level. Rapamycin increases autophagy by further inhibiting MTORC1. A sustained autophagic response is responsible for the MTORC2 reactivation when fibroblasts are starved for 2 d or more (long term), as measured by rephosphorylation of AKT at Ser473. In turn, MTORC2 activity drives the production and secretion of the pro-fibrotic cytokine CTGF leading to myofibroblast differentiation. Long-term exposure to rapamycin inactivates MTORC1 leading to an increased autophagic response, but prevents MTORC2 activation and downstream CTGF induction and myofibroblast differentiation.
Discussion
Mounting evidence suggests that dysregulated autophagy plays a central role in abnormal repair processes. Fibrosis, a maladaptive form of tissue remodeling, is characterized by the sustained presence of myofibroblasts defined by an enhanced capacity to produce ECM components and to exert a tensile force on the ECM. This leads to ECM thickening and contraction, loss of the normal tissue architecture, and loss of function. Fibrosis characterizes most forms of chronic organ failure including liver cirrhosis, renal failure, and pulmonary fibrosis. Both enhanced and decreased autophagy have been linked to fibrosis, suggesting that the timing of the autophagic process, the cell types at play and the downstream pathways triggered by autophagy weave a complex interplay of responses that may be either beneficial or detrimental to tissue repair. In murine models of liver injury, genetic invalidation of the central autophagic gene ATG7 specifically in hepatic stellate cells prevents their myofibroblast differentiation and significantly decreases liver fibrosis. An association between the activation of autophagy and acquisition of myofibroblast markers has also been documented in renal mesangial cells and pulmonary fibroblasts. However, the use of the MTOR inhibitor rapamycin, a classical inducer of autophagy, in models of renal, pulmonary, and skin fibrosis prevents or decreases fibrotic indices including myofibroblast differentiation. Here, we sought to characterize the pathways linking autophagy with myofibroblast differentiation in stromal cells and to define the various levels of crosstalk between autophagy and MTOR-dependent signaling regulating myofibroblast differentiation. Using starvation as a classical inducer of autophagy in fibroblasts, we demonstrate not only temporal relations between sustained autophagy and myofibroblast differentiation but a central role for autophagy in triggering myofibroblast differentiation. Preventing development of autophagy through inhibition of PtdIns3K with LY294002, wortmannin or 3-MA blocked myofibroblast differentiation. Inhibiting autophagy through ATG7 silencing also prevented myofibroblast differentiation.Our results demonstrate that in a pure fibroblast system, autophagy enhances myofibroblast differentiation through TGFB-independent pathways. Indeed, we observed no evidence of SMAD signaling in our system. Also, neutralizing antibodies against all active isoforms of TGFB failed to prevent autophagy-induced myofibroblast differentiation while effectively blocking TGFB-induced differentiation. These results do not, however, rule out a potential contribution of TGFB in vivo where the draw of immune cells to the sites of tissue remodeling could accentuate myofibroblast differentiation via TGFB-dependent pathways. Nonetheless, our results demonstrate that in fibroblasts, autophagy triggers an intrinsic program of myofibroblast differentiation largely dependent on the upregulation of CTGF expression and secretion. Several lines of evidence support the central role of CTGF in inducing autophagy-dependent myofibroblast differentiation. Starvation initially decreased CTGF levels but prolonged starvation favored CTGF re-expression. Inhibiting autophagy in starved fibroblasts, either through PtdIns3K inhibition or ATG7 silencing, prevented re-expression of CTGF. Finally, silencing CTGF in starved fibroblasts blocked myofibroblast differentiation.CTGF is a cysteine-rich 38-kDa member of the CCN early-response gene family that was first described as an important downstream effector of TGFB and a potentiator of TGFB's fibrogenic actions. Mounting evidence gathered over the past decade has demonstrated that CTGF can initiate fibrogenic responses independently of TGFB. CTGF is increasingly recognized as a central fibrogenic mediator upregulated in a variety of fibrotic disorders and is overexpressed prior to and in association with fibrosis development. CTGF acts as a matricellular protein rather than a conventional growth factor, interacting with multidomain structures in association with various cell surface receptors (integrins, proteoglycans, low-density lipoprotein receptor-related protein). CTGF-neutralizing antibodies prevent renal and pulmonary fibrosis and reduction of CTGF expression by antisense treatment ameliorates renal tubulo-interstitial fibrosis and prevents myofibroblast differentiation of hepatic stellate cells. In humans, CTGF is upregulated in various chronic fibrotic disorders, including liver fibrosis, systemic sclerosis, diabetic nephropathy, and chronic allograft nephropathy.Our results also highlight the central importance of MTORC2 in autophagy-induced myofibroblast differentiation. In our system, phosphorylation of the MTORC1 downstream target RPS6KB1 was low in starved fibroblasts and exposure to rapamycin or Torin 1 further reduced RPS6KB1 phosphorylation. The pattern of MTORC2 activation in starved fibroblasts, monitored by AKT phosphorylation at serine 473, was quite distinct. As expected, AKT phosphorylation rapidly decreased upon starvation but was followed by spontaneous rephosphorylation after 2 d. In starved cells, blocking MTORC2 activity, with rapamycin, Torin 1 or RICTOR silencing, prevented myofibroblast differentiation. In unstarved cells, however, rapamycin inhibited MTORC1 and triggered autophagy, but failed to reduce AKT phosphorylation. In this context, rapamycin treatment enhanced MTORC2 activity and enhanced myofibroblast differentiation. These results are consistent with previous reports showing that rapamycin preferentially inhibits MTORC1 vs MTORC2 and that MTORC1 blockade can release MTORC1-dependent inhibition of MTORC2. However, in a situation where MTORC1 activity is absent, such as starvation, prolonged rapamycin treatment can display inhibitory activity toward MTORC2.To further define the importance of autophagy in MTORC2 activation, we inhibited autophagy in starved fibroblasts with inhibitors of PtdIns3K or by silencing ATG7. Both methods concurred in demonstrating a central role for autophagy in MTORC2 activation. Also, when ATG7 silenced starved cells were transduced with a constitutively active AKT construct, myofibroblast differentiation was enhanced. These results demonstrated that MTORC2 is active downstream of autophagy and drives myofibroblast differentiation.The conventional dogma proposes that MTORC1 regulates mRNA translation and cellular proliferation while MTORC2 activation regulates reorganization of the actin cytoskeleton. Our results demonstrate that long-term MTORC2 activation leads to important changes in gene and protein expression patterns in fibroblasts, favoring the development of a fibrogenic microenvironment. These results are in line with recent reports demonstrating that MTORC2 can regulate expression of stress and hypoxia-induced proteins of potential importance in controlling cellular adaptation to external stress. Our results further support the notion that MTORC2 can act as an upstream regulator of stress-induced proteins and identify CTGF as a novel downstream product of MTORC2 signaling.Our results are consistent with the work of Hernandez-Gea V et al., showing that autophagy of hepatic stellate cells enhances liver fibrosis. Our results may, however, be seen as contradictory to work published by Araya and colleagues demonstrating an inhibitory function for autophagy in myofibroblast differentiation of pulmonary fibroblasts. A number of reasons could explain this discrepancy, including differences in duration of autophagy and autophagy inducers. Both studies, however, highlight the importance of MTOR-dependent pathways in controlling myofibroblast differentiation. Also, our work highlights the importance of duration of autophagy on myofibroblast differentiation. In our system, short-term autophagy (up to 24 h) did not activate MTORC2, and failed to increase CTGF secretion and myofibroblast differentiation. Prolonged autophagy, however, induced MTORC2 activation, which in turn promoted CTGF secretion and myofibroblast differentiation ().In summary, the present results lend further support for a key role for sustained autophagy as a central regulator of myofibroblast differentiation. Long-term starvation, while repressing MTORC1 activation, triggers activation of the MTORC2 complex, culminating in enhanced synthesis and secretion of the fibrogenic mediator CTGF, which in turn initiates a program of myofibroblast differentiation. These results provide novel insights into the fibrogenic molecular pathways triggered by the autophagic program and highlight new potential targets of intervention for preventing maladaptive myofibroblast differentiation.
Materials and Methods
Cell culture
WI-38 human fibroblasts from normal embryonic lung tissue were purchased from the American Type Culture Collection (CCL-75), grown in fibroblast basal medium (Lonza, CC-3131) supplemented with 10% inactivated fetal bovine serum (FBS; Wisent, 090150) (normal medium [N]) and used between passages 6 and 8. Normal human lung fibroblasts (Lonza, CC-2512) and mouse embryonic fibroblasts (ATCC, CRL-2214) were grown in DMEM (Wisent, 319-005-CL) with 10% FBS. For growth factor deprivation, the fibroblasts were washed twice with phosphate-buffered saline (PBS; Wisent, 311-425-CL) before being exposed to serum-free medium. The media were replaced every other day. Conditioned cell culture media were centrifuged at 1,200 g for 15 min at 4°C and kept at −20°C for further analysis. The cells were plated at a density of 20,000 cells/cm2 in 6-well plates and exposed to experimental conditions or vehicle when they reached 80–90% confluency.
Immunoblotting
Cellular proteins were extracted, separated by electrophoresis, transferred to nitrocellulose membranes and probed, as described previously. To compare levels of secreted proteins, 3 ml of conditioned medium were concentrated by centrifugation in a 5,000 molecular weight cut-off Vivaspin 500 system (Sartorius Stedim Biotech, VS0112) at 15,000 g, followed by electrophoresis and protein gel blotting (WB). The antibodies used for WB were anti-ACTA2/αSMA (Sigma-Aldrich, A2547), anti-CTGF (Santa Cruz Biotechnology, sc-14939), anti-LC3B (Novus, NB600-1384), anti-mouseSQSTM1/p62 (MBL, PM045B), anti-humanSQSTM1/p62 (Cell Signaling Technology, 8025), anti-phospho-RPS6KB1/p70S6K (Thr389; Cell Signaling Technology, 9205), anti-phospho-AKT (Ser473; Cell Signaling Technology, 9271) and anti-AKT (Cell Signaling Technology, 9272), anti-RICTOR (Cell Signaling Technology, 2114), anti-RPTOR (Cell Signaling Technology, 2280), anti-PARP (Cell Signaling Technology, 9542), anti-phospho-SMAD2 (Millipore, AB3849) and anti-SMAD2/3 (Millipore, 07-408), anti-proCOL1A1/collagentype I (Meridian, T59103R), anti-ATG7 (R&D Systems, MAB6608), and anti-HA (Roche Applied Science, 11 666 606 001). Membranes were stained with Ponceau S Red (Sigma, P-3504) as loading control, or, alternatively, after initial probing, they were stripped and re-probed with anti-α-tubulin (Calbiochem, CP06). Densitometric analyses were conducted with AlphaImager, version 3.2 (Alpha Innotech Corporation, San Leandro, CA, USA). Data are expressed in arbitrary units.
Immunofluorescence microscopy
Cells were grown in 8-well glass slides (Nalge Nunc, Lab-Tek II 154534), rinsed twice with PBS and fixed with 4% paraformaldehyde. The slides were washed 3 times with PBS before permeabilization and after each subsequent step. Permeabilization was done with 0.1% Triton X-100 (Sigma, T9284) in PBS for 15 min. Chamber slides were blocked with PBS/10% donkey serum (Sigma, D9663)/1% BSA (Sigma, A9647)/0.1% Tween 20 (Sigma, P1379) for 15 min. For ACTA2 staining, cells were incubated with mouse monoclonal antibody (Sigma-Aldrich, A2547) and Alexa 594-labeled anti-mouse Ab (Molecular Probes, A21203), each for 60 min at room temperature in blocking buffer. For stress fiber characterization, the slides were incubated with phalloidin-FITC (Sigma-Aldrich, P5282) for 60 min at room temperature in blocking buffer. Nuclei were stained with TO-PRO 3 (Molecular Probes, T3605). The cells were then visualized under a Leica SP5 confocal microscope and analyzed with Leica LAS AF software (Leica Microsystems, Concord, ON, Canada).
GFP-LC3B expression
We used the Premo Autophagy Sensor GFP-LC3B BacMam 2.0 Expression vector Kit from Invitrogen (P36235) and followed instructions provided by the manufacturer. In brief, WI-38 fibroblasts were plated in 8-well glass slides (Nalge Nunc, Lab-Tek II 154534). When they reached 40,000 cells/well, they were infected with GFP-LC3B-containing baculovirus at a multiplicity of infection of 30 in normal medium. After overnight incubation, the slides were washed twice with PBS and exposed to experimental conditions for 24 h. The cells were then fixed with paraformaldehyde (4%) and nuclei were stained with 0.5 ug/ml DAPI (Invitrogen, D3571). Cells were observed using a Olympus multiphoton FV-1000 MER confocal microscope.
Small interfering RNAs (siRNAs)
For silencing of CTGF, WI-38 fibroblasts were plated in 6-well plates at 20,000 cells per cm2. When the cells were near confluency, they were transfected with oligofectamine (6 μl/well; Invitrogen, 12252-011) and siRNAs at a final concentration of 200 nM annealed oligonucleotides in cell culture medium without serum. Two d post-transfection, the medium was changed and the cells were maintained under experimental conditions (without serum) for 5 d, with medium changed every 2 d, followed by evaluation of myofibroblast differentiation. Pre-designed oligonucleotides for humanCTGF (ON-TARGETplus SMARTpool L-012633-01) and control siRNA (ON-TARGETplus non-targeting siRNA D-001810-01) were obtained from Dharmacon Research and Thermo Fisher Scientific.For ATG7, RICTOR, and RPTOR silencing, fibroblasts grown in normal conditions were harvested by trypsinization and separated in aliquots of 1.5 million cells. Separate aliquots were transfected with siRICTOR (Dharmacon, L-016984-00), siATG7 (Dharmacon, L-020112-00), siRPTOR (Dharmacon, L-004107-00), or siControl (Dharmacon, D-001810-03). We used the Amaxa Nucleofector electroporator (Amaxa, Gaithersburg, MD, USA) and the Nucleofector electroporation kit for WI-38 (Lonza, VCA-1001) according to the manufacturer's guidelines. The final concentration of siRNA was 150 pmol of siRNA/reaction. After electroporation, each cellular aliquot was plated in 2 wells of a 6-well plate in normal medium for 24 h. The media were then changed for experimental condition (medium without serum) after 2 washes with PBS. The cells were harvested at different time points for western blot analysis. For 4 d in SS, the media were changed at d 2.
Adenoviral vector system for overexpression of constitutively active AKT
For activation of AKT, WI-38 fibroblasts were infected with an adenovirus vector encoding a constitutively active AKT construct (Ad-CA-AKT [Myr], Vector Biolabs, 1020). A commercially available adenovirus vector (Ad-CMV-null, Vector Biolabs, 1300) was used as control. Cells were infected at a multiplicity of infection of 2 in normal medium for 6 h, followed by electroporation with siATG7 or control, as described above.
RNA preparation and quantitative polymerase chain reaction (qPCR)
Total RNA from WI-38 fibroblasts was prepared with the RNeasy kit from Qiagen Inc. (74134). cDNA synthesis was completed according to the M-MLV-RT First-Strand Synthesis protocol (Invitrogen, 28025-013) with a starting amount of 1 μg RNA and reverse transcription with random hexamers (Invitrogen, 48190-011). PCR was performed with a Rotor-gene 3000 Real-Time Centrifugal DNA Amplification System (Corbett Tumor Tissues Research, Sydney, Australia). Quantitect™ SYBR Green PCR (Qiagen, 204143) reaction mixture was employed according to the manufacturer's instructions. Serial dilutions generated a standard curve for each gene tested, to define the efficiency of real time qPCR. All experiments, including positive and negative controls, were run in triplicate. The primer sequences were: CTGF fw 5′- TTGGCCCAGACCCAACTATG, rev 5′-CAGGAGGCGTTGTCATTGGT; COL1A1 fw 5′- CCTCAAGGGCTCCAACGAG, rev 5′ TCAATCACTGTCTTGCCCCA; COL3A1 fw 5′- AACACGCAAGGCTGTGAGACT, rev 5′- GCCAACGTCCACACCAAATT; GAPDH fw 5′- TGCACCACCAACTGCTTAGC, rev 5′- GGCATGGACTGTGGTCATGAG.
Reagents
Recombinant humanTGFB1 (100-B), pan-TGFB1/2/3-blocking antibody (AB-100-NA) and isotype controls (AB-105-C) were obtained from R&D Systems. LY294002 (440202) and 3-methyladenine (189490) were purchased from Calbiochem, and rapamycin (R0395), wortmannin (W3144) and bafilomycin A1 (B1793) from Sigma. Torin 1 (4247) was obtained from TOCRIS bioscience. All other reagents were from Sigma Chemicals.
Statistical analysis
The results, expressed as means ± SEM, were analyzed by unpaired Student t test or the Mann-Whitney test as appropriate. P < 0.05 was considered significant for all tests.
Authors: James J Tomasek; Giulio Gabbiani; Boris Hinz; Christine Chaponnier; Robert A Brown Journal: Nat Rev Mol Cell Biol Date: 2002-05 Impact factor: 94.444
Authors: O Cheng; R Thuillier; E Sampson; G Schultz; P Ruiz; X Zhang; P S T Yuen; R B Mannon Journal: Am J Transplant Date: 2006-08-04 Impact factor: 8.086
Authors: Debra F Higgins; Mangatt P Biju; Yasuhiro Akai; Anton Wutz; Randall S Johnson; Volker H Haase Journal: Am J Physiol Renal Physiol Date: 2004-08-17
Authors: Aikaterini Lampada; James O'Prey; Gyorgy Szabadkai; Kevin M Ryan; Daniel Hochhauser; Paolo Salomoni Journal: Cell Death Differ Date: 2017-05-05 Impact factor: 15.828
Authors: Daniel J Klionsky; Kotb Abdelmohsen; Akihisa Abe; Md Joynal Abedin; Hagai Abeliovich; Abraham Acevedo Arozena; Hiroaki Adachi; Christopher M Adams; Peter D Adams; Khosrow Adeli; Peter J Adhihetty; Sharon G Adler; Galila Agam; Rajesh Agarwal; Manish K Aghi; Maria Agnello; Patrizia Agostinis; Patricia V Aguilar; Julio Aguirre-Ghiso; Edoardo M Airoldi; Slimane Ait-Si-Ali; Takahiko Akematsu; Emmanuel T Akporiaye; Mohamed Al-Rubeai; Guillermo M Albaiceta; Chris Albanese; Diego Albani; Matthew L Albert; Jesus Aldudo; Hana Algül; Mehrdad Alirezaei; Iraide Alloza; Alexandru Almasan; Maylin Almonte-Beceril; Emad S Alnemri; Covadonga Alonso; Nihal Altan-Bonnet; Dario C Altieri; Silvia Alvarez; Lydia Alvarez-Erviti; Sandro Alves; Giuseppina Amadoro; Atsuo Amano; Consuelo Amantini; Santiago Ambrosio; Ivano Amelio; Amal O Amer; Mohamed Amessou; Angelika Amon; Zhenyi An; Frank A Anania; Stig U Andersen; Usha P Andley; Catherine K Andreadi; Nathalie Andrieu-Abadie; Alberto Anel; David K Ann; Shailendra Anoopkumar-Dukie; Manuela Antonioli; Hiroshi Aoki; Nadezda Apostolova; Saveria Aquila; Katia Aquilano; Koichi Araki; Eli Arama; Agustin Aranda; Jun Araya; Alexandre Arcaro; Esperanza Arias; Hirokazu Arimoto; Aileen R Ariosa; Jane L Armstrong; Thierry Arnould; Ivica Arsov; Katsuhiko Asanuma; Valerie Askanas; Eric Asselin; Ryuichiro Atarashi; Sally S Atherton; Julie D Atkin; Laura D Attardi; Patrick Auberger; Georg Auburger; Laure Aurelian; Riccardo Autelli; Laura Avagliano; Maria Laura Avantaggiati; Limor Avrahami; Suresh Awale; Neelam Azad; Tiziana Bachetti; Jonathan M Backer; Dong-Hun Bae; Jae-Sung Bae; Ok-Nam Bae; Soo Han Bae; Eric H Baehrecke; Seung-Hoon Baek; Stephen Baghdiguian; Agnieszka Bagniewska-Zadworna; Hua Bai; Jie Bai; Xue-Yuan Bai; Yannick Bailly; Kithiganahalli Narayanaswamy Balaji; Walter Balduini; Andrea Ballabio; Rena Balzan; Rajkumar Banerjee; Gábor Bánhegyi; Haijun Bao; Benoit Barbeau; Maria D Barrachina; Esther Barreiro; Bonnie Bartel; Alberto Bartolomé; Diane C Bassham; Maria Teresa Bassi; Robert C Bast; Alakananda Basu; Maria Teresa Batista; Henri Batoko; Maurizio Battino; Kyle Bauckman; Bradley L Baumgarner; K Ulrich Bayer; Rupert Beale; Jean-François Beaulieu; George R Beck; Christoph Becker; J David Beckham; Pierre-André Bédard; Patrick J Bednarski; Thomas J Begley; Christian Behl; Christian Behrends; Georg Mn Behrens; Kevin E Behrns; Eloy Bejarano; Amine Belaid; Francesca Belleudi; Giovanni Bénard; Guy Berchem; Daniele Bergamaschi; Matteo Bergami; Ben Berkhout; Laura Berliocchi; Amélie Bernard; Monique Bernard; Francesca Bernassola; Anne Bertolotti; Amanda S Bess; Sébastien Besteiro; Saverio Bettuzzi; Savita Bhalla; Shalmoli Bhattacharyya; Sujit K Bhutia; Caroline Biagosch; Michele Wolfe Bianchi; Martine Biard-Piechaczyk; Viktor Billes; Claudia Bincoletto; Baris Bingol; Sara W Bird; Marc Bitoun; Ivana Bjedov; Craig Blackstone; Lionel Blanc; Guillermo A Blanco; Heidi Kiil Blomhoff; Emilio Boada-Romero; Stefan Böckler; Marianne Boes; Kathleen Boesze-Battaglia; Lawrence H Boise; Alessandra Bolino; Andrea Boman; Paolo Bonaldo; Matteo Bordi; Jürgen Bosch; Luis M Botana; Joelle Botti; German Bou; Marina Bouché; Marion Bouchecareilh; Marie-Josée Boucher; Michael E Boulton; Sebastien G Bouret; Patricia Boya; Michaël Boyer-Guittaut; Peter V Bozhkov; Nathan Brady; Vania Mm Braga; Claudio Brancolini; Gerhard H Braus; José M Bravo-San Pedro; Lisa A Brennan; Emery H Bresnick; Patrick Brest; Dave Bridges; Marie-Agnès Bringer; Marisa Brini; Glauber C Brito; Bertha Brodin; Paul S Brookes; Eric J Brown; Karen Brown; Hal E Broxmeyer; Alain Bruhat; Patricia Chakur Brum; John H Brumell; Nicola Brunetti-Pierri; Robert J Bryson-Richardson; Shilpa Buch; Alastair M Buchan; Hikmet Budak; Dmitry V Bulavin; Scott J Bultman; Geert Bultynck; Vladimir Bumbasirevic; Yan Burelle; Robert E Burke; Margit Burmeister; Peter Bütikofer; Laura Caberlotto; Ken Cadwell; Monika Cahova; Dongsheng Cai; Jingjing Cai; Qian Cai; Sara Calatayud; Nadine Camougrand; Michelangelo Campanella; Grant R Campbell; Matthew Campbell; Silvia Campello; Robin Candau; Isabella Caniggia; Lavinia Cantoni; Lizhi Cao; Allan B Caplan; Michele Caraglia; Claudio Cardinali; Sandra Morais Cardoso; Jennifer S Carew; Laura A Carleton; Cathleen R Carlin; Silvia Carloni; Sven R Carlsson; Didac Carmona-Gutierrez; Leticia Am Carneiro; Oliana Carnevali; Serena Carra; Alice Carrier; Bernadette Carroll; Caty Casas; Josefina Casas; Giuliana Cassinelli; Perrine Castets; Susana Castro-Obregon; Gabriella Cavallini; Isabella Ceccherini; Francesco Cecconi; Arthur I Cederbaum; Valentín Ceña; Simone Cenci; Claudia Cerella; Davide Cervia; Silvia Cetrullo; Hassan Chaachouay; Han-Jung Chae; Andrei S Chagin; Chee-Yin Chai; Gopal Chakrabarti; Georgios Chamilos; Edmond Yw Chan; Matthew Tv Chan; Dhyan Chandra; Pallavi Chandra; Chih-Peng Chang; Raymond Chuen-Chung Chang; Ta Yuan Chang; John C Chatham; Saurabh Chatterjee; Santosh Chauhan; Yongsheng Che; Michael E Cheetham; Rajkumar Cheluvappa; Chun-Jung Chen; Gang Chen; Guang-Chao Chen; Guoqiang Chen; Hongzhuan Chen; Jeff W Chen; Jian-Kang Chen; Min Chen; Mingzhou Chen; Peiwen Chen; Qi Chen; Quan Chen; Shang-Der Chen; Si Chen; Steve S-L Chen; Wei Chen; Wei-Jung Chen; Wen Qiang Chen; Wenli Chen; Xiangmei Chen; Yau-Hung Chen; Ye-Guang Chen; Yin Chen; Yingyu Chen; Yongshun Chen; Yu-Jen Chen; Yue-Qin Chen; Yujie Chen; Zhen Chen; Zhong Chen; Alan Cheng; Christopher Hk Cheng; Hua Cheng; Heesun Cheong; Sara Cherry; Jason Chesney; Chun Hei Antonio Cheung; Eric Chevet; Hsiang Cheng Chi; Sung-Gil Chi; Fulvio Chiacchiera; Hui-Ling Chiang; Roberto Chiarelli; Mario Chiariello; Marcello Chieppa; Lih-Shen Chin; Mario Chiong; Gigi Nc Chiu; Dong-Hyung Cho; Ssang-Goo Cho; William C Cho; Yong-Yeon Cho; Young-Seok Cho; Augustine Mk Choi; Eui-Ju Choi; Eun-Kyoung Choi; Jayoung Choi; Mary E Choi; Seung-Il Choi; Tsui-Fen Chou; Salem Chouaib; Divaker Choubey; Vinay Choubey; Kuan-Chih Chow; Kamal Chowdhury; Charleen T Chu; Tsung-Hsien Chuang; Taehoon Chun; Hyewon Chung; Taijoon Chung; Yuen-Li Chung; Yong-Joon Chwae; Valentina Cianfanelli; Roberto Ciarcia; Iwona A Ciechomska; Maria Rosa Ciriolo; Mara Cirone; Sofie Claerhout; Michael J Clague; Joan Clària; Peter Gh Clarke; Robert Clarke; Emilio Clementi; Cédric Cleyrat; Miriam Cnop; Eliana M Coccia; Tiziana Cocco; Patrice Codogno; Jörn Coers; Ezra Ew Cohen; David Colecchia; Luisa Coletto; Núria S Coll; Emma Colucci-Guyon; Sergio Comincini; Maria Condello; Katherine L Cook; Graham H Coombs; Cynthia D Cooper; J Mark Cooper; Isabelle Coppens; Maria Tiziana Corasaniti; Marco Corazzari; Ramon Corbalan; Elisabeth Corcelle-Termeau; Mario D Cordero; Cristina Corral-Ramos; Olga Corti; Andrea Cossarizza; Paola Costelli; Safia Costes; Susan L Cotman; Ana Coto-Montes; Sandra Cottet; Eduardo Couve; Lori R Covey; L Ashley Cowart; Jeffery S Cox; Fraser P Coxon; Carolyn B Coyne; Mark S Cragg; Rolf J Craven; Tiziana Crepaldi; Jose L Crespo; Alfredo Criollo; Valeria Crippa; Maria Teresa Cruz; Ana Maria Cuervo; Jose M Cuezva; Taixing Cui; Pedro R Cutillas; Mark J Czaja; Maria F Czyzyk-Krzeska; Ruben K Dagda; Uta Dahmen; Chunsun Dai; Wenjie Dai; Yun Dai; Kevin N Dalby; Luisa Dalla Valle; Guillaume Dalmasso; Marcello D'Amelio; Markus Damme; Arlette Darfeuille-Michaud; Catherine Dargemont; Victor M Darley-Usmar; Srinivasan Dasarathy; Biplab Dasgupta; Srikanta Dash; Crispin R Dass; Hazel Marie Davey; Lester M Davids; David Dávila; Roger J Davis; Ted M Dawson; Valina L Dawson; Paula Daza; Jackie de Belleroche; Paul de Figueiredo; Regina Celia Bressan Queiroz de Figueiredo; José de la Fuente; Luisa De Martino; Antonella De Matteis; Guido Ry De Meyer; Angelo De Milito; Mauro De Santi; Wanderley de Souza; Vincenzo De Tata; Daniela De Zio; Jayanta Debnath; Reinhard Dechant; Jean-Paul Decuypere; Shane Deegan; Benjamin Dehay; Barbara Del Bello; Dominic P Del Re; Régis Delage-Mourroux; Lea Md Delbridge; Louise Deldicque; Elizabeth Delorme-Axford; Yizhen Deng; Joern Dengjel; Melanie Denizot; Paul Dent; Channing J Der; Vojo Deretic; Benoît Derrien; Eric Deutsch; Timothy P Devarenne; Rodney J Devenish; Sabrina Di Bartolomeo; Nicola Di Daniele; Fabio Di Domenico; Alessia Di Nardo; Simone Di Paola; Antonio Di Pietro; Livia Di Renzo; Aaron DiAntonio; Guillermo Díaz-Araya; Ines Díaz-Laviada; Maria T Diaz-Meco; Javier Diaz-Nido; Chad A Dickey; Robert C Dickson; Marc Diederich; Paul Digard; Ivan Dikic; Savithrama P Dinesh-Kumar; Chan Ding; Wen-Xing Ding; Zufeng Ding; Luciana Dini; Jörg Hw Distler; Abhinav Diwan; Mojgan Djavaheri-Mergny; Kostyantyn Dmytruk; Renwick Cj Dobson; Volker Doetsch; Karol Dokladny; Svetlana Dokudovskaya; Massimo Donadelli; X Charlie Dong; Xiaonan Dong; Zheng Dong; Terrence M Donohue; Kelly S Doran; Gabriella D'Orazi; Gerald W Dorn; Victor Dosenko; Sami Dridi; Liat Drucker; Jie Du; Li-Lin Du; Lihuan Du; André du Toit; Priyamvada Dua; Lei Duan; Pu Duann; Vikash Kumar Dubey; Michael R Duchen; Michel A Duchosal; Helene Duez; Isabelle Dugail; Verónica I Dumit; Mara C Duncan; Elaine A Dunlop; William A Dunn; Nicolas Dupont; Luc Dupuis; Raúl V Durán; Thomas M Durcan; Stéphane Duvezin-Caubet; Umamaheswar Duvvuri; Vinay Eapen; Darius Ebrahimi-Fakhari; Arnaud Echard; Leopold Eckhart; Charles L Edelstein; Aimee L Edinger; Ludwig Eichinger; Tobias Eisenberg; Avital Eisenberg-Lerner; N Tony Eissa; Wafik S El-Deiry; Victoria El-Khoury; Zvulun Elazar; Hagit Eldar-Finkelman; Chris Jh Elliott; Enzo Emanuele; Urban Emmenegger; Nikolai Engedal; Anna-Mart Engelbrecht; Simone Engelender; Jorrit M Enserink; Ralf Erdmann; Jekaterina Erenpreisa; Rajaraman Eri; Jason L Eriksen; Andreja Erman; Ricardo Escalante; Eeva-Liisa Eskelinen; Lucile Espert; Lorena Esteban-Martínez; Thomas J Evans; Mario Fabri; Gemma Fabrias; Cinzia Fabrizi; Antonio Facchiano; Nils J Færgeman; Alberto Faggioni; W Douglas Fairlie; Chunhai Fan; Daping Fan; Jie Fan; Shengyun Fang; Manolis Fanto; Alessandro Fanzani; Thomas Farkas; Mathias Faure; Francois B Favier; Howard Fearnhead; Massimo Federici; Erkang Fei; Tania C Felizardo; Hua Feng; Yibin Feng; Yuchen Feng; Thomas A Ferguson; Álvaro F Fernández; Maite G Fernandez-Barrena; Jose C Fernandez-Checa; Arsenio Fernández-López; Martin E Fernandez-Zapico; Olivier Feron; Elisabetta Ferraro; Carmen Veríssima Ferreira-Halder; Laszlo Fesus; Ralph Feuer; Fabienne C Fiesel; Eduardo C Filippi-Chiela; Giuseppe Filomeni; Gian Maria Fimia; John H Fingert; Steven Finkbeiner; Toren Finkel; Filomena Fiorito; Paul B Fisher; Marc Flajolet; Flavio Flamigni; Oliver Florey; Salvatore Florio; R Andres Floto; Marco Folini; Carlo Follo; Edward A Fon; Francesco Fornai; Franco Fortunato; Alessandro Fraldi; Rodrigo Franco; Arnaud Francois; Aurélie François; Lisa B Frankel; Iain Dc Fraser; Norbert Frey; Damien G Freyssenet; Christian Frezza; Scott L Friedman; Daniel E Frigo; Dongxu Fu; José M Fuentes; Juan Fueyo; Yoshio Fujitani; Yuuki Fujiwara; Mikihiro Fujiya; Mitsunori Fukuda; Simone Fulda; Carmela Fusco; Bozena Gabryel; Matthias Gaestel; Philippe Gailly; Malgorzata Gajewska; Sehamuddin Galadari; Gad Galili; Inmaculada Galindo; Maria F Galindo; Giovanna Galliciotti; Lorenzo Galluzzi; Luca Galluzzi; Vincent Galy; Noor Gammoh; Sam Gandy; Anand K Ganesan; Swamynathan Ganesan; Ian G Ganley; Monique Gannagé; Fen-Biao Gao; Feng Gao; Jian-Xin Gao; Lorena García Nannig; Eleonora García Véscovi; Marina Garcia-Macía; Carmen Garcia-Ruiz; Abhishek D Garg; Pramod Kumar Garg; Ricardo Gargini; Nils Christian Gassen; Damián Gatica; Evelina Gatti; Julie Gavard; Evripidis Gavathiotis; Liang Ge; Pengfei Ge; Shengfang Ge; Po-Wu Gean; Vania Gelmetti; Armando A Genazzani; Jiefei Geng; Pascal Genschik; Lisa Gerner; Jason E Gestwicki; David A Gewirtz; Saeid Ghavami; Eric Ghigo; Debabrata Ghosh; Anna Maria Giammarioli; Francesca Giampieri; Claudia Giampietri; Alexandra Giatromanolaki; Derrick J Gibbings; Lara Gibellini; Spencer B Gibson; Vanessa Ginet; Antonio Giordano; Flaviano Giorgini; Elisa Giovannetti; Stephen E Girardin; Suzana Gispert; Sandy Giuliano; Candece L Gladson; Alvaro Glavic; Martin Gleave; Nelly Godefroy; Robert M Gogal; Kuppan Gokulan; Gustavo H Goldman; Delia Goletti; Michael S Goligorsky; Aldrin V Gomes; Ligia C Gomes; Hernando Gomez; Candelaria Gomez-Manzano; Rubén Gómez-Sánchez; Dawit Ap Gonçalves; Ebru Goncu; Qingqiu Gong; Céline Gongora; Carlos B Gonzalez; Pedro Gonzalez-Alegre; Pilar Gonzalez-Cabo; Rosa Ana González-Polo; Ing Swie Goping; Carlos Gorbea; Nikolai V Gorbunov; Daphne R Goring; Adrienne M Gorman; Sharon M Gorski; Sandro Goruppi; Shino Goto-Yamada; Cecilia Gotor; Roberta A Gottlieb; Illana Gozes; Devrim Gozuacik; Yacine Graba; Martin Graef; Giovanna E Granato; Gary Dean Grant; Steven Grant; Giovanni Luca Gravina; Douglas R Green; Alexander Greenhough; Michael T Greenwood; Benedetto Grimaldi; Frédéric Gros; Charles Grose; Jean-Francois Groulx; Florian Gruber; Paolo Grumati; Tilman Grune; Jun-Lin Guan; Kun-Liang Guan; Barbara Guerra; Carlos Guillen; Kailash Gulshan; Jan Gunst; Chuanyong Guo; Lei Guo; Ming Guo; Wenjie Guo; Xu-Guang Guo; Andrea A Gust; Åsa B Gustafsson; Elaine Gutierrez; Maximiliano G Gutierrez; Ho-Shin Gwak; Albert Haas; James E Haber; Shinji Hadano; Monica Hagedorn; David R Hahn; Andrew J Halayko; Anne Hamacher-Brady; Kozo Hamada; Ahmed Hamai; Andrea Hamann; Maho Hamasaki; Isabelle Hamer; Qutayba Hamid; Ester M Hammond; Feng Han; Weidong Han; James T Handa; John A Hanover; Malene Hansen; Masaru Harada; Ljubica Harhaji-Trajkovic; J Wade Harper; Abdel Halim Harrath; Adrian L Harris; James Harris; Udo Hasler; Peter Hasselblatt; Kazuhisa Hasui; Robert G Hawley; Teresa S Hawley; Congcong He; Cynthia Y He; Fengtian He; Gu He; Rong-Rong He; Xian-Hui He; You-Wen He; Yu-Ying He; Joan K Heath; Marie-Josée Hébert; Robert A Heinzen; Gudmundur Vignir Helgason; Michael Hensel; Elizabeth P Henske; Chengtao Her; Paul K Herman; Agustín Hernández; Carlos Hernandez; Sonia Hernández-Tiedra; Claudio Hetz; P Robin Hiesinger; Katsumi Higaki; Sabine Hilfiker; Bradford G Hill; Joseph A Hill; William D Hill; Keisuke Hino; Daniel Hofius; Paul Hofman; Günter U Höglinger; Jörg Höhfeld; Marina K Holz; Yonggeun Hong; David A Hood; Jeroen Jm Hoozemans; Thorsten Hoppe; Chin Hsu; Chin-Yuan Hsu; Li-Chung Hsu; Dong Hu; Guochang Hu; Hong-Ming Hu; Hongbo Hu; Ming Chang Hu; Yu-Chen Hu; Zhuo-Wei Hu; Fang Hua; Ya Hua; Canhua Huang; Huey-Lan Huang; Kuo-How Huang; Kuo-Yang Huang; Shile Huang; Shiqian Huang; Wei-Pang Huang; Yi-Ran Huang; Yong Huang; Yunfei Huang; Tobias B Huber; Patricia Huebbe; Won-Ki Huh; Juha J Hulmi; Gang Min Hur; James H Hurley; Zvenyslava Husak; Sabah Na Hussain; Salik Hussain; Jung Jin Hwang; Seungmin Hwang; Thomas Is Hwang; Atsuhiro Ichihara; Yuzuru Imai; Carol Imbriano; Megumi Inomata; Takeshi Into; Valentina Iovane; Juan L Iovanna; Renato V Iozzo; Nancy Y Ip; Javier E Irazoqui; Pablo Iribarren; Yoshitaka Isaka; Aleksandra J Isakovic; Harry Ischiropoulos; Jeffrey S Isenberg; Mohammad Ishaq; Hiroyuki Ishida; Isao Ishii; Jane E Ishmael; Ciro Isidoro; Ken-Ichi Isobe; Erika Isono; Shohreh Issazadeh-Navikas; Koji Itahana; Eisuke Itakura; Andrei I Ivanov; Anand Krishnan V Iyer; José M Izquierdo; Yotaro Izumi; Valentina Izzo; Marja Jäättelä; Nadia Jaber; Daniel John Jackson; William T Jackson; Tony George Jacob; Thomas S Jacques; Chinnaswamy Jagannath; Ashish Jain; Nihar Ranjan Jana; Byoung Kuk Jang; Alkesh Jani; Bassam Janji; Paulo Roberto Jannig; Patric J Jansson; Steve Jean; Marina Jendrach; Ju-Hong Jeon; Niels Jessen; Eui-Bae Jeung; Kailiang Jia; Lijun Jia; Hong Jiang; Hongchi Jiang; Liwen Jiang; Teng Jiang; Xiaoyan Jiang; Xuejun Jiang; Xuejun Jiang; Ying Jiang; Yongjun Jiang; Alberto Jiménez; Cheng Jin; Hongchuan Jin; Lei Jin; Meiyan Jin; Shengkan Jin; Umesh Kumar Jinwal; Eun-Kyeong Jo; Terje Johansen; Daniel E Johnson; Gail Vw Johnson; James D Johnson; Eric Jonasch; Chris Jones; Leo Ab Joosten; Joaquin Jordan; Anna-Maria Joseph; Bertrand Joseph; Annie M Joubert; Dianwen Ju; Jingfang Ju; Hsueh-Fen Juan; Katrin Juenemann; Gábor Juhász; Hye Seung Jung; Jae U Jung; Yong-Keun Jung; Heinz Jungbluth; Matthew J Justice; Barry Jutten; Nadeem O Kaakoush; Kai Kaarniranta; Allen Kaasik; Tomohiro Kabuta; Bertrand Kaeffer; Katarina Kågedal; Alon Kahana; Shingo Kajimura; Or Kakhlon; Manjula Kalia; Dhan V Kalvakolanu; Yoshiaki Kamada; Konstantinos Kambas; Vitaliy O Kaminskyy; Harm H Kampinga; Mustapha Kandouz; Chanhee Kang; Rui Kang; Tae-Cheon Kang; Tomotake Kanki; Thirumala-Devi Kanneganti; Haruo Kanno; Anumantha G Kanthasamy; Marc Kantorow; Maria Kaparakis-Liaskos; Orsolya Kapuy; Vassiliki Karantza; Md Razaul Karim; Parimal Karmakar; Arthur Kaser; Susmita Kaushik; Thomas Kawula; A Murat Kaynar; Po-Yuan Ke; Zun-Ji Ke; John H Kehrl; Kate E Keller; Jongsook Kim Kemper; Anne K Kenworthy; Oliver Kepp; Andreas Kern; Santosh Kesari; David Kessel; Robin Ketteler; Isis do Carmo Kettelhut; Bilon Khambu; Muzamil Majid Khan; Vinoth Km Khandelwal; Sangeeta Khare; Juliann G Kiang; Amy A Kiger; Akio Kihara; Arianna L Kim; Cheol Hyeon Kim; Deok Ryong Kim; Do-Hyung Kim; Eung Kweon Kim; Hye Young Kim; Hyung-Ryong Kim; Jae-Sung Kim; Jeong Hun Kim; Jin Cheon Kim; Jin Hyoung Kim; Kwang Woon Kim; Michael D Kim; Moon-Moo Kim; Peter K Kim; Seong Who Kim; Soo-Youl Kim; Yong-Sun Kim; Yonghyun Kim; Adi Kimchi; Alec C Kimmelman; Tomonori Kimura; Jason S King; Karla Kirkegaard; Vladimir Kirkin; Lorrie A Kirshenbaum; Shuji Kishi; Yasuo Kitajima; Katsuhiko Kitamoto; Yasushi Kitaoka; Kaio Kitazato; Rudolf A Kley; Walter T Klimecki; Michael Klinkenberg; Jochen Klucken; Helene Knævelsrud; Erwin Knecht; Laura Knuppertz; Jiunn-Liang Ko; Satoru Kobayashi; Jan C Koch; Christelle Koechlin-Ramonatxo; Ulrich Koenig; Young Ho Koh; Katja Köhler; Sepp D Kohlwein; Masato Koike; Masaaki Komatsu; Eiki Kominami; Dexin Kong; Hee Jeong Kong; Eumorphia G Konstantakou; Benjamin T Kopp; Tamas Korcsmaros; Laura Korhonen; Viktor I Korolchuk; Nadya V Koshkina; Yanjun Kou; Michael I Koukourakis; Constantinos Koumenis; Attila L Kovács; Tibor Kovács; Werner J Kovacs; Daisuke Koya; Claudine Kraft; Dimitri Krainc; Helmut Kramer; Tamara Kravic-Stevovic; Wilhelm Krek; Carole Kretz-Remy; Roswitha Krick; Malathi Krishnamurthy; Janos Kriston-Vizi; Guido Kroemer; Michael C Kruer; Rejko Kruger; Nicholas T Ktistakis; Kazuyuki Kuchitsu; Christian Kuhn; Addanki Pratap Kumar; Anuj Kumar; Ashok Kumar; Deepak Kumar; Dhiraj Kumar; Rakesh Kumar; Sharad Kumar; Mondira Kundu; Hsing-Jien Kung; Atsushi Kuno; Sheng-Han Kuo; Jeff Kuret; Tino Kurz; Terry Kwok; Taeg Kyu Kwon; Yong Tae Kwon; Irene Kyrmizi; Albert R La Spada; Frank Lafont; Tim Lahm; Aparna Lakkaraju; Truong Lam; Trond Lamark; Steve Lancel; Terry H Landowski; Darius J R Lane; Jon D Lane; Cinzia Lanzi; Pierre Lapaquette; Louis R Lapierre; Jocelyn Laporte; Johanna Laukkarinen; Gordon W Laurie; Sergio Lavandero; Lena Lavie; Matthew J LaVoie; Betty Yuen Kwan Law; Helen Ka-Wai Law; Kelsey B Law; Robert Layfield; Pedro A Lazo; Laurent Le Cam; Karine G Le Roch; Hervé Le Stunff; Vijittra Leardkamolkarn; Marc Lecuit; Byung-Hoon Lee; Che-Hsin Lee; Erinna F Lee; Gyun Min Lee; He-Jin Lee; Hsinyu Lee; Jae Keun Lee; Jongdae Lee; Ju-Hyun Lee; Jun Hee Lee; Michael Lee; Myung-Shik Lee; Patty J Lee; Sam W Lee; Seung-Jae Lee; Shiow-Ju Lee; Stella Y Lee; Sug Hyung Lee; Sung Sik Lee; Sung-Joon Lee; Sunhee Lee; Ying-Ray Lee; Yong J Lee; Young H Lee; Christiaan Leeuwenburgh; Sylvain Lefort; Renaud Legouis; Jinzhi Lei; Qun-Ying Lei; David A Leib; Gil Leibowitz; Istvan Lekli; Stéphane D Lemaire; John J Lemasters; Marius K Lemberg; Antoinette Lemoine; Shuilong Leng; Guido Lenz; Paola Lenzi; Lilach O Lerman; Daniele Lettieri Barbato; Julia I-Ju Leu; Hing Y Leung; Beth Levine; Patrick A Lewis; Frank Lezoualc'h; Chi Li; Faqiang Li; Feng-Jun Li; Jun Li; Ke Li; Lian Li; Min Li; Min Li; Qiang Li; Rui Li; Sheng Li; Wei Li; Wei Li; Xiaotao Li; Yumin Li; Jiqin Lian; Chengyu Liang; Qiangrong Liang; Yulin Liao; Joana Liberal; Pawel P Liberski; Pearl Lie; Andrew P Lieberman; Hyunjung Jade Lim; Kah-Leong Lim; Kyu Lim; Raquel T Lima; Chang-Shen Lin; Chiou-Feng Lin; Fang Lin; Fangming Lin; Fu-Cheng Lin; Kui Lin; Kwang-Huei Lin; Pei-Hui Lin; Tianwei Lin; Wan-Wan Lin; Yee-Shin Lin; Yong Lin; Rafael Linden; Dan Lindholm; Lisa M Lindqvist; Paul Lingor; Andreas Linkermann; Lance A Liotta; Marta M Lipinski; Vitor A Lira; Michael P Lisanti; Paloma B Liton; Bo Liu; Chong Liu; Chun-Feng Liu; Fei Liu; Hung-Jen Liu; Jianxun Liu; Jing-Jing Liu; Jing-Lan Liu; Ke Liu; Leyuan Liu; Liang Liu; Quentin Liu; Rong-Yu Liu; Shiming Liu; Shuwen Liu; Wei Liu; Xian-De Liu; Xiangguo Liu; Xiao-Hong Liu; Xinfeng Liu; Xu Liu; Xueqin Liu; Yang Liu; Yule Liu; Zexian Liu; Zhe Liu; Juan P Liuzzi; Gérard Lizard; Mila Ljujic; Irfan J Lodhi; Susan E Logue; Bal L Lokeshwar; Yun Chau Long; Sagar Lonial; Benjamin Loos; Carlos López-Otín; Cristina López-Vicario; Mar Lorente; Philip L Lorenzi; Péter Lõrincz; Marek Los; Michael T Lotze; Penny E Lovat; Binfeng Lu; Bo Lu; Jiahong Lu; Qing Lu; She-Min Lu; Shuyan Lu; Yingying Lu; Frédéric Luciano; Shirley Luckhart; John Milton Lucocq; Paula Ludovico; Aurelia Lugea; Nicholas W Lukacs; Julian J Lum; Anders H Lund; Honglin Luo; Jia Luo; Shouqing Luo; Claudio Luparello; Timothy Lyons; Jianjie Ma; Yi Ma; Yong Ma; Zhenyi Ma; Juliano Machado; Glaucia M Machado-Santelli; Fernando Macian; Gustavo C MacIntosh; Jeffrey P MacKeigan; Kay F Macleod; John D MacMicking; Lee Ann MacMillan-Crow; Frank Madeo; Muniswamy Madesh; Julio Madrigal-Matute; Akiko Maeda; Tatsuya Maeda; Gustavo Maegawa; Emilia Maellaro; Hannelore Maes; Marta Magariños; Kenneth Maiese; Tapas K Maiti; Luigi Maiuri; Maria Chiara Maiuri; Carl G Maki; Roland Malli; Walter Malorni; Alina Maloyan; Fathia Mami-Chouaib; Na Man; Joseph D Mancias; Eva-Maria Mandelkow; Michael A Mandell; Angelo A Manfredi; Serge N Manié; Claudia Manzoni; Kai Mao; Zixu Mao; Zong-Wan Mao; Philippe Marambaud; Anna Maria Marconi; Zvonimir Marelja; Gabriella Marfe; Marta Margeta; Eva Margittai; Muriel Mari; Francesca V Mariani; Concepcio Marin; Sara Marinelli; Guillermo Mariño; Ivanka Markovic; Rebecca Marquez; Alberto M Martelli; Sascha Martens; Katie R Martin; Seamus J Martin; Shaun Martin; Miguel A Martin-Acebes; Paloma Martín-Sanz; Camille Martinand-Mari; Wim Martinet; Jennifer Martinez; Nuria Martinez-Lopez; Ubaldo Martinez-Outschoorn; Moisés Martínez-Velázquez; Marta Martinez-Vicente; Waleska Kerllen Martins; Hirosato Mashima; James A Mastrianni; Giuseppe Matarese; Paola Matarrese; Roberto Mateo; Satoaki Matoba; Naomichi Matsumoto; Takehiko Matsushita; Akira Matsuura; Takeshi Matsuzawa; Mark P Mattson; Soledad Matus; Norma Maugeri; Caroline Mauvezin; Andreas Mayer; Dusica Maysinger; Guillermo D Mazzolini; Mary Kate McBrayer; Kimberly McCall; Craig McCormick; Gerald M McInerney; Skye C McIver; Sharon McKenna; John J McMahon; Iain A McNeish; Fatima Mechta-Grigoriou; Jan Paul Medema; Diego L Medina; Klara Megyeri; Maryam Mehrpour; Jawahar L Mehta; Yide Mei; Ute-Christiane Meier; Alfred J Meijer; Alicia Meléndez; Gerry Melino; Sonia Melino; Edesio Jose Tenorio de Melo; Maria A Mena; Marc D Meneghini; Javier A Menendez; Regina Menezes; Liesu Meng; Ling-Hua Meng; Songshu Meng; Rossella Menghini; A Sue Menko; Rubem Fs Menna-Barreto; Manoj B Menon; Marco A Meraz-Ríos; Giuseppe Merla; Luciano Merlini; Angelica M Merlot; Andreas Meryk; Stefania Meschini; Joel N Meyer; Man-Tian Mi; Chao-Yu Miao; Lucia Micale; Simon Michaeli; Carine Michiels; Anna Rita Migliaccio; Anastasia Susie Mihailidou; Dalibor Mijaljica; Katsuhiko Mikoshiba; Enrico Milan; Leonor Miller-Fleming; Gordon B Mills; Ian G Mills; Georgia Minakaki; Berge A Minassian; Xiu-Fen Ming; Farida Minibayeva; Elena A Minina; Justine D Mintern; Saverio Minucci; Antonio Miranda-Vizuete; Claire H Mitchell; Shigeki Miyamoto; Keisuke Miyazawa; Noboru Mizushima; Katarzyna Mnich; Baharia Mograbi; Simin Mohseni; Luis Ferreira Moita; Marco Molinari; Maurizio Molinari; Andreas Buch Møller; Bertrand Mollereau; Faustino Mollinedo; Marco Mongillo; Martha M Monick; Serena Montagnaro; Craig Montell; Darren J Moore; Michael N Moore; Rodrigo Mora-Rodriguez; Paula I Moreira; Etienne Morel; Maria Beatrice Morelli; Sandra Moreno; Michael J Morgan; Arnaud Moris; Yuji Moriyasu; Janna L Morrison; Lynda A Morrison; Eugenia Morselli; Jorge Moscat; Pope L Moseley; Serge Mostowy; Elisa Motori; Denis Mottet; Jeremy C Mottram; Charbel E-H Moussa; Vassiliki E Mpakou; Hasan Mukhtar; Jean M Mulcahy Levy; Sylviane Muller; Raquel Muñoz-Moreno; Cristina Muñoz-Pinedo; Christian Münz; Maureen E Murphy; James T Murray; Aditya Murthy; Indira U Mysorekar; Ivan R Nabi; Massimo Nabissi; Gustavo A Nader; Yukitoshi Nagahara; Yoshitaka Nagai; Kazuhiro Nagata; Anika Nagelkerke; Péter Nagy; Samisubbu R Naidu; Sreejayan Nair; Hiroyasu Nakano; Hitoshi Nakatogawa; Meera Nanjundan; Gennaro Napolitano; Naweed I Naqvi; Roberta Nardacci; Derek P Narendra; Masashi Narita; Anna Chiara Nascimbeni; Ramesh Natarajan; Luiz C Navegantes; Steffan T Nawrocki; Taras Y Nazarko; Volodymyr Y Nazarko; Thomas Neill; Luca M Neri; Mihai G Netea; Romana T Netea-Maier; Bruno M Neves; Paul A Ney; Ioannis P Nezis; Hang Tt Nguyen; Huu Phuc Nguyen; Anne-Sophie Nicot; Hilde Nilsen; Per Nilsson; Mikio Nishimura; Ichizo Nishino; Mireia Niso-Santano; Hua Niu; Ralph A Nixon; Vincent Co Njar; Takeshi Noda; Angelika A Noegel; Elsie Magdalena Nolte; Erik Norberg; Koenraad K Norga; Sakineh Kazemi Noureini; Shoji Notomi; Lucia Notterpek; Karin Nowikovsky; Nobuyuki Nukina; Thorsten Nürnberger; Valerie B O'Donnell; Tracey O'Donovan; Peter J O'Dwyer; Ina Oehme; Clara L Oeste; Michinaga Ogawa; Besim Ogretmen; Yuji Ogura; Young J Oh; Masaki Ohmuraya; Takayuki Ohshima; Rani Ojha; Koji Okamoto; Toshiro Okazaki; F Javier Oliver; Karin Ollinger; Stefan Olsson; Daniel P Orban; Paulina Ordonez; Idil Orhon; Laszlo Orosz; Eyleen J O'Rourke; Helena Orozco; Angel L Ortega; Elena Ortona; Laura D Osellame; Junko Oshima; Shigeru Oshima; Heinz D Osiewacz; Takanobu Otomo; Kinya Otsu; Jing-Hsiung James Ou; Tiago F Outeiro; Dong-Yun Ouyang; Hongjiao Ouyang; Michael Overholtzer; Michelle A Ozbun; P Hande Ozdinler; Bulent Ozpolat; Consiglia Pacelli; Paolo Paganetti; Guylène Page; Gilles Pages; Ugo Pagnini; Beata Pajak; Stephen C Pak; Karolina Pakos-Zebrucka; Nazzy Pakpour; Zdena Palková; Francesca Palladino; Kathrin Pallauf; Nicolas Pallet; Marta Palmieri; Søren R Paludan; Camilla Palumbo; Silvia Palumbo; Olatz Pampliega; Hongming Pan; Wei Pan; Theocharis Panaretakis; Aseem Pandey; Areti Pantazopoulou; Zuzana Papackova; Daniela L Papademetrio; Issidora Papassideri; Alessio Papini; Nirmala Parajuli; Julian Pardo; Vrajesh V Parekh; Giancarlo Parenti; Jong-In Park; Junsoo Park; Ohkmae K Park; Roy Parker; Rosanna Parlato; Jan B Parys; Katherine R Parzych; Jean-Max Pasquet; Benoit Pasquier; Kishore Bs Pasumarthi; Daniel Patschan; Cam Patterson; Sophie Pattingre; Scott Pattison; Arnim Pause; Hermann Pavenstädt; Flaminia Pavone; Zully Pedrozo; Fernando J Peña; Miguel A Peñalva; Mario Pende; Jianxin Peng; Fabio Penna; Josef M Penninger; Anna Pensalfini; Salvatore Pepe; Gustavo Js Pereira; Paulo C Pereira; Verónica Pérez-de la Cruz; María Esther Pérez-Pérez; Diego Pérez-Rodríguez; Dolores Pérez-Sala; Celine Perier; Andras Perl; David H Perlmutter; Ida Perrotta; Shazib Pervaiz; Maija Pesonen; Jeffrey E Pessin; Godefridus J Peters; Morten Petersen; Irina Petrache; Basil J Petrof; Goran Petrovski; James M Phang; Mauro Piacentini; Marina Pierdominici; Philippe Pierre; Valérie Pierrefite-Carle; Federico Pietrocola; Felipe X Pimentel-Muiños; Mario Pinar; Benjamin Pineda; Ronit Pinkas-Kramarski; Marcello Pinti; Paolo Pinton; Bilal Piperdi; James M Piret; Leonidas C Platanias; Harald W Platta; Edward D Plowey; Stefanie Pöggeler; Marc Poirot; Peter Polčic; Angelo Poletti; Audrey H Poon; Hana Popelka; Blagovesta Popova; Izabela Poprawa; Shibu M Poulose; Joanna Poulton; Scott K Powers; Ted Powers; Mercedes Pozuelo-Rubio; Krisna Prak; Reinhild Prange; Mark Prescott; Muriel Priault; Sharon Prince; Richard L Proia; Tassula Proikas-Cezanne; Holger Prokisch; Vasilis J Promponas; Karin Przyklenk; Rosa Puertollano; Subbiah Pugazhenthi; Luigi Puglielli; Aurora Pujol; Julien Puyal; Dohun Pyeon; Xin Qi; Wen-Bin Qian; Zheng-Hong Qin; Yu Qiu; Ziwei Qu; Joe Quadrilatero; Frederick Quinn; Nina Raben; Hannah Rabinowich; Flavia Radogna; Michael J Ragusa; Mohamed Rahmani; Komal Raina; Sasanka Ramanadham; Rajagopal Ramesh; Abdelhaq Rami; Sarron Randall-Demllo; Felix Randow; Hai Rao; V Ashutosh Rao; Blake B Rasmussen; Tobias M Rasse; Edward A Ratovitski; Pierre-Emmanuel Rautou; Swapan K Ray; Babak Razani; Bruce H Reed; Fulvio Reggiori; Markus Rehm; Andreas S Reichert; Theo Rein; David J Reiner; Eric Reits; Jun Ren; Xingcong Ren; Maurizio Renna; Jane Eb Reusch; Jose L Revuelta; Leticia Reyes; Alireza R Rezaie; Robert I Richards; Des R Richardson; Clémence Richetta; Michael A Riehle; Bertrand H Rihn; Yasuko Rikihisa; Brigit E Riley; Gerald Rimbach; Maria Rita Rippo; Konstantinos Ritis; Federica Rizzi; Elizete Rizzo; Peter J Roach; Jeffrey Robbins; Michel Roberge; Gabriela Roca; Maria Carmela Roccheri; Sonia Rocha; Cecilia Mp Rodrigues; Clara I Rodríguez; Santiago Rodriguez de Cordoba; Natalia Rodriguez-Muela; Jeroen Roelofs; Vladimir V Rogov; Troy T Rohn; Bärbel Rohrer; Davide Romanelli; Luigina Romani; Patricia Silvia Romano; M Isabel G Roncero; Jose Luis Rosa; Alicia Rosello; Kirill V Rosen; Philip Rosenstiel; Magdalena Rost-Roszkowska; Kevin A Roth; Gael Roué; Mustapha Rouis; Kasper M Rouschop; Daniel T Ruan; Diego Ruano; David C Rubinsztein; Edmund B Rucker; Assaf Rudich; Emil Rudolf; Ruediger Rudolf; Markus A Ruegg; Carmen Ruiz-Roldan; Avnika Ashok Ruparelia; Paola Rusmini; David W Russ; Gian Luigi Russo; Giuseppe Russo; Rossella Russo; Tor Erik Rusten; Victoria Ryabovol; Kevin M Ryan; Stefan W Ryter; David M Sabatini; Michael Sacher; Carsten Sachse; Michael N Sack; Junichi Sadoshima; Paul Saftig; Ronit Sagi-Eisenberg; Sumit Sahni; Pothana Saikumar; Tsunenori Saito; Tatsuya Saitoh; Koichi Sakakura; Machiko Sakoh-Nakatogawa; Yasuhito Sakuraba; María Salazar-Roa; Paolo Salomoni; Ashok K Saluja; Paul M Salvaterra; Rosa Salvioli; Afshin Samali; Anthony Mj Sanchez; José A Sánchez-Alcázar; Ricardo Sanchez-Prieto; Marco Sandri; Miguel A Sanjuan; Stefano Santaguida; Laura Santambrogio; Giorgio Santoni; Claudia Nunes Dos Santos; Shweta Saran; Marco Sardiello; Graeme Sargent; Pallabi Sarkar; Sovan Sarkar; Maria Rosa Sarrias; Minnie M Sarwal; Chihiro Sasakawa; Motoko Sasaki; Miklos Sass; Ken Sato; Miyuki Sato; Joseph Satriano; Niramol Savaraj; Svetlana Saveljeva; Liliana Schaefer; Ulrich E Schaible; Michael Scharl; Hermann M Schatzl; Randy Schekman; Wiep Scheper; Alfonso Schiavi; Hyman M Schipper; Hana Schmeisser; Jens Schmidt; Ingo Schmitz; Bianca E Schneider; E Marion Schneider; Jaime L Schneider; Eric A Schon; Miriam J Schönenberger; Axel H Schönthal; Daniel F Schorderet; Bernd Schröder; Sebastian Schuck; Ryan J Schulze; Melanie Schwarten; Thomas L Schwarz; Sebastiano Sciarretta; Kathleen Scotto; A Ivana Scovassi; Robert A Screaton; Mark Screen; Hugo Seca; Simon Sedej; Laura Segatori; Nava Segev; Per O Seglen; Jose M Seguí-Simarro; Juan Segura-Aguilar; Ekihiro Seki; Christian Sell; Iban Seiliez; Clay F Semenkovich; Gregg L Semenza; Utpal Sen; Andreas L Serra; Ana Serrano-Puebla; Hiromi Sesaki; Takao Setoguchi; Carmine Settembre; John J Shacka; Ayesha N Shajahan-Haq; Irving M Shapiro; Shweta Sharma; Hua She; C-K James Shen; Chiung-Chyi Shen; Han-Ming Shen; Sanbing Shen; Weili Shen; Rui Sheng; Xianyong Sheng; Zu-Hang Sheng; Trevor G Shepherd; Junyan Shi; Qiang Shi; Qinghua Shi; Yuguang Shi; Shusaku Shibutani; Kenichi Shibuya; Yoshihiro Shidoji; Jeng-Jer Shieh; Chwen-Ming Shih; Yohta Shimada; Shigeomi Shimizu; Dong Wook Shin; Mari L Shinohara; Michiko Shintani; Takahiro Shintani; Tetsuo Shioi; Ken Shirabe; Ronit Shiri-Sverdlov; Orian Shirihai; Gordon C Shore; Chih-Wen Shu; Deepak Shukla; Andriy A Sibirny; Valentina Sica; Christina J Sigurdson; Einar M Sigurdsson; Puran Singh Sijwali; Beata Sikorska; Wilian A Silveira; Sandrine Silvente-Poirot; Gary A Silverman; Jan Simak; Thomas Simmet; Anna Katharina Simon; Hans-Uwe Simon; Cristiano Simone; Matias Simons; Anne Simonsen; Rajat Singh; Shivendra V Singh; Shrawan K Singh; Debasish Sinha; Sangita Sinha; Frank A Sinicrope; Agnieszka Sirko; Kapil Sirohi; Balindiwe Jn Sishi; Annie Sittler; Parco M Siu; Efthimios Sivridis; Anna Skwarska; Ruth Slack; Iva Slaninová; Nikolai Slavov; Soraya S Smaili; Keiran Sm Smalley; Duncan R Smith; Stefaan J Soenen; Scott A Soleimanpour; Anita Solhaug; Kumaravel Somasundaram; Jin H Son; Avinash Sonawane; Chunjuan Song; Fuyong Song; Hyun Kyu Song; Ju-Xian Song; Wei Song; Kai Y Soo; Anil K Sood; Tuck Wah Soong; Virawudh Soontornniyomkij; Maurizio Sorice; Federica Sotgia; David R Soto-Pantoja; Areechun Sotthibundhu; Maria João Sousa; Herman P Spaink; Paul N Span; Anne Spang; Janet D Sparks; Peter G Speck; Stephen A Spector; Claudia D Spies; Wolfdieter Springer; Daret St Clair; Alessandra Stacchiotti; Bart Staels; Michael T Stang; Daniel T Starczynowski; Petro Starokadomskyy; Clemens Steegborn; John W Steele; Leonidas Stefanis; Joan Steffan; Christine M Stellrecht; Harald Stenmark; Tomasz M Stepkowski; Stęphan T Stern; Craig Stevens; Brent R Stockwell; Veronika Stoka; Zuzana Storchova; Björn Stork; Vassilis Stratoulias; Dimitrios J Stravopodis; Pavel Strnad; Anne Marie Strohecker; Anna-Lena Ström; Per Stromhaug; Jiri Stulik; Yu-Xiong Su; Zhaoliang Su; Carlos S Subauste; Srinivasa Subramaniam; Carolyn M Sue; Sang Won Suh; Xinbing Sui; Supawadee Sukseree; David Sulzer; Fang-Lin Sun; Jiaren Sun; Jun Sun; Shi-Yong Sun; Yang Sun; Yi Sun; Yingjie Sun; Vinod Sundaramoorthy; Joseph Sung; Hidekazu Suzuki; Kuninori Suzuki; Naoki Suzuki; Tadashi Suzuki; Yuichiro J Suzuki; Michele S Swanson; Charles Swanton; Karl Swärd; Ghanshyam Swarup; Sean T Sweeney; Paul W Sylvester; Zsuzsanna Szatmari; Eva Szegezdi; Peter W Szlosarek; Heinrich Taegtmeyer; Marco Tafani; Emmanuel Taillebourg; Stephen Wg Tait; Krisztina Takacs-Vellai; Yoshinori Takahashi; Szabolcs Takáts; Genzou Takemura; Nagio Takigawa; Nicholas J Talbot; Elena Tamagno; Jerome Tamburini; Cai-Ping Tan; Lan Tan; Mei Lan Tan; Ming Tan; Yee-Joo Tan; Keiji Tanaka; Masaki Tanaka; Daolin Tang; Dingzhong Tang; Guomei Tang; Isei Tanida; Kunikazu Tanji; Bakhos A Tannous; Jose A Tapia; Inmaculada Tasset-Cuevas; Marc Tatar; Iman Tavassoly; Nektarios Tavernarakis; Allen Taylor; Graham S Taylor; Gregory A Taylor; J Paul Taylor; Mark J Taylor; Elena V Tchetina; Andrew R Tee; Fatima Teixeira-Clerc; Sucheta Telang; Tewin Tencomnao; Ba-Bie Teng; Ru-Jeng Teng; Faraj Terro; Gianluca Tettamanti; Arianne L Theiss; Anne E Theron; Kelly Jean Thomas; Marcos P Thomé; Paul G Thomes; Andrew Thorburn; Jeremy Thorner; Thomas Thum; Michael Thumm; Teresa Lm Thurston; Ling Tian; Andreas Till; Jenny Pan-Yun Ting; Vladimir I Titorenko; Lilach Toker; Stefano Toldo; Sharon A Tooze; Ivan Topisirovic; Maria Lyngaas Torgersen; Liliana Torosantucci; Alicia Torriglia; Maria Rosaria Torrisi; Cathy Tournier; Roberto Towns; Vladimir Trajkovic; Leonardo H Travassos; Gemma Triola; Durga Nand Tripathi; Daniela Trisciuoglio; Rodrigo Troncoso; Ioannis P Trougakos; Anita C Truttmann; Kuen-Jer Tsai; Mario P Tschan; Yi-Hsin Tseng; Takayuki Tsukuba; Allan Tsung; Andrey S Tsvetkov; Shuiping Tu; Hsing-Yu Tuan; Marco Tucci; David A Tumbarello; Boris Turk; Vito Turk; Robin Fb Turner; Anders A Tveita; Suresh C Tyagi; Makoto Ubukata; Yasuo Uchiyama; Andrej Udelnow; Takashi Ueno; Midori Umekawa; Rika Umemiya-Shirafuji; Benjamin R Underwood; Christian Ungermann; Rodrigo P Ureshino; Ryo Ushioda; Vladimir N Uversky; Néstor L Uzcátegui; Thomas Vaccari; Maria I Vaccaro; Libuše Váchová; Helin Vakifahmetoglu-Norberg; Rut Valdor; Enza Maria Valente; Francois Vallette; Angela M Valverde; Greet Van den Berghe; Ludo Van Den Bosch; Gijs R van den Brink; F Gisou van der Goot; Ida J van der Klei; Luc Jw van der Laan; Wouter G van Doorn; Marjolein van Egmond; Kenneth L van Golen; Luc Van Kaer; Menno van Lookeren Campagne; Peter Vandenabeele; Wim Vandenberghe; Ilse Vanhorebeek; Isabel Varela-Nieto; M Helena Vasconcelos; Radovan Vasko; Demetrios G Vavvas; Ignacio Vega-Naredo; Guillermo Velasco; Athanassios D Velentzas; Panagiotis D Velentzas; Tibor Vellai; Edo Vellenga; Mikkel Holm Vendelbo; Kartik Venkatachalam; Natascia Ventura; Salvador Ventura; Patrícia St Veras; Mireille Verdier; Beata G Vertessy; Andrea Viale; Michel Vidal; Helena L A Vieira; Richard D Vierstra; Nadarajah Vigneswaran; Neeraj Vij; Miquel Vila; Margarita Villar; Victor H Villar; Joan Villarroya; Cécile Vindis; Giampietro Viola; Maria Teresa Viscomi; Giovanni Vitale; Dan T Vogl; Olga V Voitsekhovskaja; Clarissa von Haefen; Karin von Schwarzenberg; Daniel E Voth; Valérie Vouret-Craviari; Kristina Vuori; Jatin M Vyas; Christian Waeber; Cheryl Lyn Walker; Mark J Walker; Jochen Walter; Lei Wan; Xiangbo Wan; Bo Wang; Caihong Wang; Chao-Yung Wang; Chengshu Wang; Chenran Wang; Chuangui Wang; Dong Wang; Fen Wang; Fuxin Wang; Guanghui Wang; Hai-Jie Wang; Haichao Wang; Hong-Gang Wang; Hongmin Wang; Horng-Dar Wang; Jing Wang; Junjun Wang; Mei Wang; Mei-Qing Wang; Pei-Yu Wang; Peng Wang; Richard C Wang; Shuo Wang; Ting-Fang Wang; Xian Wang; Xiao-Jia Wang; Xiao-Wei Wang; Xin Wang; Xuejun Wang; Yan Wang; Yanming Wang; Ying Wang; Ying-Jan Wang; Yipeng Wang; Yu Wang; Yu Tian Wang; Yuqing Wang; Zhi-Nong Wang; Pablo Wappner; Carl Ward; Diane McVey Ward; Gary Warnes; Hirotaka Watada; Yoshihisa Watanabe; Kei Watase; Timothy E Weaver; Colin D Weekes; Jiwu Wei; Thomas Weide; Conrad C Weihl; Günther Weindl; Simone Nardin Weis; Longping Wen; Xin Wen; Yunfei Wen; Benedikt Westermann; Cornelia M Weyand; Anthony R White; Eileen White; J Lindsay Whitton; Alexander J Whitworth; Joëlle Wiels; Franziska Wild; Manon E Wildenberg; Tom Wileman; Deepti Srinivas Wilkinson; Simon Wilkinson; Dieter Willbold; Chris Williams; Katherine Williams; Peter R Williamson; Konstanze F Winklhofer; Steven S Witkin; Stephanie E Wohlgemuth; Thomas Wollert; Ernst J Wolvetang; Esther Wong; G William Wong; Richard W Wong; Vincent Kam Wai Wong; Elizabeth A Woodcock; Karen L Wright; Chunlai Wu; Defeng Wu; Gen Sheng Wu; Jian Wu; Junfang Wu; Mian Wu; Min Wu; Shengzhou Wu; William Kk Wu; Yaohua Wu; Zhenlong Wu; Cristina Pr Xavier; Ramnik J Xavier; Gui-Xian Xia; Tian Xia; Weiliang Xia; Yong Xia; Hengyi Xiao; Jian Xiao; Shi Xiao; Wuhan Xiao; Chuan-Ming Xie; Zhiping Xie; Zhonglin Xie; Maria Xilouri; Yuyan Xiong; Chuanshan Xu; Congfeng Xu; Feng Xu; Haoxing Xu; Hongwei Xu; Jian Xu; Jianzhen Xu; Jinxian Xu; Liang Xu; Xiaolei Xu; Yangqing Xu; Ye Xu; Zhi-Xiang Xu; Ziheng Xu; Yu Xue; Takahiro Yamada; Ai Yamamoto; Koji Yamanaka; Shunhei Yamashina; Shigeko Yamashiro; Bing Yan; Bo Yan; Xianghua Yan; Zhen Yan; Yasuo Yanagi; Dun-Sheng Yang; Jin-Ming Yang; Liu Yang; Minghua Yang; Pei-Ming Yang; Peixin Yang; Qian Yang; Wannian Yang; Wei Yuan Yang; Xuesong Yang; Yi Yang; Ying Yang; Zhifen Yang; Zhihong Yang; Meng-Chao Yao; Pamela J Yao; Xiaofeng Yao; Zhenyu Yao; Zhiyuan Yao; Linda S Yasui; Mingxiang Ye; Barry Yedvobnick; Behzad Yeganeh; Elizabeth S Yeh; Patricia L Yeyati; Fan Yi; Long Yi; Xiao-Ming Yin; Calvin K Yip; Yeong-Min Yoo; Young Hyun Yoo; Seung-Yong Yoon; Ken-Ichi Yoshida; Tamotsu Yoshimori; Ken H Young; Huixin Yu; Jane J Yu; Jin-Tai Yu; Jun Yu; Li Yu; W Haung Yu; Xiao-Fang Yu; Zhengping Yu; Junying Yuan; Zhi-Min Yuan; Beatrice Yjt Yue; Jianbo Yue; Zhenyu Yue; David N Zacks; Eldad Zacksenhaus; Nadia Zaffaroni; Tania Zaglia; Zahra Zakeri; Vincent Zecchini; Jinsheng Zeng; Min Zeng; Qi Zeng; Antonis S Zervos; Donna D Zhang; Fan Zhang; Guo Zhang; Guo-Chang Zhang; Hao Zhang; Hong Zhang; Hong Zhang; Hongbing Zhang; Jian Zhang; Jian Zhang; Jiangwei Zhang; Jianhua Zhang; Jing-Pu Zhang; Li Zhang; Lin Zhang; Lin Zhang; Long Zhang; Ming-Yong Zhang; Xiangnan Zhang; Xu Dong Zhang; Yan Zhang; Yang Zhang; Yanjin Zhang; Yingmei Zhang; Yunjiao Zhang; Mei Zhao; Wei-Li Zhao; Xiaonan Zhao; Yan G Zhao; Ying Zhao; Yongchao Zhao; Yu-Xia Zhao; Zhendong Zhao; Zhizhuang J Zhao; Dexian Zheng; Xi-Long Zheng; Xiaoxiang Zheng; Boris Zhivotovsky; Qing Zhong; Guang-Zhou Zhou; Guofei Zhou; Huiping Zhou; Shu-Feng Zhou; Xu-Jie Zhou; Hongxin Zhu; Hua Zhu; Wei-Guo Zhu; Wenhua Zhu; Xiao-Feng Zhu; Yuhua Zhu; Shi-Mei Zhuang; Xiaohong Zhuang; Elio Ziparo; Christos E Zois; Teresa Zoladek; Wei-Xing Zong; Antonio Zorzano; Susu M Zughaier Journal: Autophagy Date: 2016 Impact factor: 16.016
Figure 1.
Figure 2.
Figure 3.
Figure 4.
Figure 5.
Figure 6.
Figure 7.
Figure 8.