Literature DB >> 25455860

PMI: a ΔΨm independent pharmacological regulator of mitophagy.

Daniel A East, Francesca Fagiani, James Crosby, Nikolaos D Georgakopoulos, Hélène Bertrand, Marjolein Schaap, Adrian Fowkes, Geoff Wells, Michelangelo Campanella.   

Abstract

Mitophagy is central to mitochondrial and cellular homeostasis and operates via the PINK1/Parkin pathway targeting mitochondria devoid of membrane potential (ΔΨm) to autophagosomes. Although mitophagy is recognized as a fundamental cellular process, selective pharmacologic modulators of mitophagy are almost nonexistent. We developed a compound that increases the expression and signaling of the autophagic adaptor molecule P62/SQSTM1 and forces mitochondria into autophagy. The compound, P62-mediated mitophagy inducer (PMI), activates mitophagy without recruiting Parkin or collapsing ΔΨm and retains activity in cells devoid of a fully functional PINK1/Parkin pathway. PMI drives mitochondria to a process of quality control without compromising the bio-energetic competence of the whole network while exposing just those organelles to be recycled. Thus, PMI circumvents the toxicity and some of the nonspecific effects associated with the abrupt dissipation of ΔΨm by ionophores routinely used to induce mitophagy and represents a prototype pharmacological tool to investigate the molecular mechanisms of mitophagy.

Entities:  

Mesh:

Substances:

Year:  2014        PMID: 25455860      PMCID: PMC4245710          DOI: 10.1016/j.chembiol.2014.09.019

Source DB:  PubMed          Journal:  Chem Biol        ISSN: 1074-5521


Introduction

Mitophagy (Kim et al., 2007) is the process by which damaged or dysfunctional mitochondria are selectively engulfed by autophagosomes and delivered to lysosomes to be degraded and recycled by the cell. The most well-recognized mechanism governing the recruitment of autophagosomes to mitochondria is that driven by the PINK1/Parkin pathway (Narendra and Youle, 2011). The PTEN-induced putative kinase 1 (PINK1) accumulates on the outer membrane of dysfunctional mitochondria where it triggers the recruitment of the E3 ubiquitin ligase Parkin (Jin et al., 2010, Narendra et al., 2010, Valente et al., 2004). Once localized to mitochondria, Parkin ubiquitinates several OMM proteins that are consequently targeted by P62/SQSTM1 (Geisler et al., 2010). P62 recognizes ubiquitinated substrates and acts as an adaptor molecule through direct interaction with autophagosome-associated LC3 driving the recruitment of autophagosomal membranes to the mitochondria (Pankiv et al., 2007). Several alternative Parkin-independent mechanisms are also suggested to play a part in mitophagy. Damaged mitochondria can increase FUNDC1 and Nix expression, which may in turn recruit autophagosomes to mitochondria by direct interaction with LC3 (Liu et al., 2012, Novak et al., 2010). Upon mitochondrial depolarization, the ubiquitin ligase Smurf1 also targets mitochondria to induce mitophagy and, recently, the roles of other ubiquitin ligases in mitophagy have been described (Ding and Yin, 2012, Fu et al., 2013, Lokireddy et al., 2012). Currently, there is a lack of practical and specific pharmacological tools to manipulate mitophagy and facilitate dissection of the molecular steps involved in the removal of mitochondria from the network via this pathway. Mitophagy is now recognized as a fundamental process in cellular homeostasis because its deficiency is linked to several neurodegenerative diseases and cancers (de Castro et al., 2010, Karbowski and Neutzner, 2012, Soengas, 2012, Wallace, 2012). The regulation of P62 expression is partly controlled by the transcription factor Nrf2 (nuclear factor erythroid 2-related factor 2), due to the presence of an antioxidant response element (ARE) in its promoter region (Ishii et al., 2000, Jain et al., 2010). Thus, compounds that induce Nrf2 activity have the potential to enhance P62 expression. A number of electrophilic natural products, including the isothiocyanate compound, sulforaphane, upregulate Nrf2 by interfering with its regulator protein, the redox sensitive ubiquitination facilitator Keap1 (Kelch-like ECH-associated protein 1) (Cheng et al., 2011, Hayes et al., 2010, Kensler et al., 2007). Sulforaphane and related compound 1 covalently modify cysteine residues in the intervening region of Keap1, which disrupts the ubiquitination, with subsequent destruction of Nrf2. This results in increased concentrations of Nrf2 and in the expression of a range of ARE-dependent gene products involved in phase II metabolism (e.g., glutathione synthesis and conjugation enzymes, NQO1, heme oxygenase-1, etc.) (Hayes et al., 2010, Hong et al., 2010, Zhu et al., 2008) and redox control (e.g., thioredoxin, thioredoxin reductase), in addition to P62 (Jain et al., 2010, Lau et al., 2010, Stępkowski and Kruszewski, 2011). Sulforaphane shows activity in a number of preclinical models of disease prevention, including protection against exposure to oxidizing agents and carcinogens (Kensler et al., 2013). However, the isothiocyanate class of compounds, along with other reactive Nrf2 inducing agents, is capable of interacting with a range of other cysteine-containing proteins within the cell, which can make dissecting their biological activity rather difficult. Based on this, we postulated that pharmacological inducers of Nrf2 that lack a covalent binding motif may upregulate Nrf2-dependent gene expression (including p62), and thereby have an effect on mitophagy, but may have less potential for cytotoxicity than sulforaphane (cytotoxic at concentrations above 10 μM in mouse embryonic fibroblast [MEF] cells). With this aim in mind, we identified P62-mediated mitophagy inducer (PMI) (HB229) as a molecule that upregulates P62 via stabilization of Nrf2 and promotes mitophagy. The compound appears to bypass the upstream steps of the mitophagic cascade, acts independently from the collapse of the ΔΨm, and does not mediate any apparent toxic effects on cells at the concentrations used in the assays.

Results

PMI Upregulates Nrf2 and ARE-Dependent Antioxidant Genes

To investigate the effect of PMI (Figure 1A, compound 2) on expression of antioxidant proteins, levels of two Nrf2-dependent gene products—heme oxygenase-1 (HO-1) and NAD(P)H dependent quinone oxidoreductase-1 (NQO1)—were assayed in mouse Hepa1c1c7 cells over time with western blotting. In these cells, the maximal level of cytoplasmic HO-1 expression was observed after 6 hr of PMI treatment, whereas elevated cytoplasmic NQO1 levels were not detected until 24 hr after PMI exposure (Figure 1B). Additionally, the induction of NQO1 enzymatic activity after treatment with the positive control inducer sulforaphane (Figure 1A, compound 1) and PMI was assayed. Both the electrophilic Nrf2-inducing agent sulforaphane and PMI showed similar abilities to induce NQO1 activity (Figure 1A). Although the CD (concentration causing a 2-fold induction of NQO1) was greater for PMI (0.6 μM) compared to sulforaphane (0.3 μM), the maximal induction of NQO1 at 10 μM was higher for PMI (3.7-fold) than sulforaphane (3.4-fold) (Figure 1C). To further understand the kinetics of Nrf2 activation, we monitored cellular Nrf2 levels in MEFs after treatment with PMI or sulforaphane over time as an indication of Nrf2 stabilization. With PMI treatment, maximum Nrf2 levels were observed after 6 hr and remained elevated at 24 hr after exposure. In contrast, incubation with sulforaphane produced a maximum elevation of Nrf2 at 3 hr that had diminished at 6 and 24 hr, although not back to the level of the control (Figure 1D).
Figure 1

PMI Stabilizes Nrf2 and Upregulates P62 Expression Activating Mitophagy

(A) Structures of compounds 1 (sulforaphane) and 2 (PMI); CD is the concentration of compound causing a doubling of the control level of NQO1 enzymatic activity.

(B) Western blot to show induction of Nrf2-dependent gene products versus time in Hepa1c1c7 cells (cytoplasmic) exposed to 10 μM PMI.

(C) Induction of NQO1 (NAD(P)H dependent quinone oxidoreductase-1) by compounds 1 (○) and 2 (●).

(D) Western blots to demonstrate Nrf2 stabilization in cells treated with either PMI (10 μM) or, sulforaphane (1 μM) versus time (E) RT-PCR analysis for estimation of p62 mRNA levels in MEFs following treatment with PMI versus time. Values are presented as arbitrary units normalized to 18 s RNA levels for each sample, n ≥ 3.

(F) Western blot to demonstrate P62 expression in MEF cells treated with DMSO vehicle control, 10 μM PMI, or 1 μM sulforaphane for 24 hr. Β-actin is shown as a loading control.

(G) Graph shows P62:β-actin ratio band density analysis, n = 3.

(H) Representative confocal images of β-subunit staining to highlight mitochondrial density in MEF cells treated with DMSO vehicle control or 10 μM PMI for 24 hr.

(I) Graph shows average mitochondrial area as a percentage of cell size, n ≥ 50.

(J) Western blot to demonstrate reduction in MTCO1 levels following 4 hr FCCP or 24 hr PMI exposure.

(K) Graph shows MTCO1:Tubulin ratio band density analysis normalized to control, n = 3.

All values are mean ± SEM, ∗p < 0.05, ∗∗p < 0.01, ∗∗∗p < 0.001.

PMI Stabilizes Nrf2 and Upregulates P62 Expression Activating Mitophagy (A) Structures of compounds 1 (sulforaphane) and 2 (PMI); CD is the concentration of compound causing a doubling of the control level of NQO1 enzymatic activity. (B) Western blot to show induction of Nrf2-dependent gene products versus time in Hepa1c1c7 cells (cytoplasmic) exposed to 10 μM PMI. (C) Induction of NQO1 (NAD(P)H dependent quinone oxidoreductase-1) by compounds 1 (○) and 2 (●). (D) Western blots to demonstrate Nrf2 stabilization in cells treated with either PMI (10 μM) or, sulforaphane (1 μM) versus time (E) RT-PCR analysis for estimation of p62 mRNA levels in MEFs following treatment with PMI versus time. Values are presented as arbitrary units normalized to 18 s RNA levels for each sample, n ≥ 3. (F) Western blot to demonstrate P62 expression in MEF cells treated with DMSO vehicle control, 10 μM PMI, or 1 μM sulforaphane for 24 hr. Β-actin is shown as a loading control. (G) Graph shows P62:β-actin ratio band density analysis, n = 3. (H) Representative confocal images of β-subunit staining to highlight mitochondrial density in MEF cells treated with DMSO vehicle control or 10 μM PMI for 24 hr. (I) Graph shows average mitochondrial area as a percentage of cell size, n ≥ 50. (J) Western blot to demonstrate reduction in MTCO1 levels following 4 hr FCCP or 24 hr PMI exposure. (K) Graph shows MTCO1:Tubulin ratio band density analysis normalized to control, n = 3. All values are mean ± SEM, ∗p < 0.05, ∗∗p < 0.01, ∗∗∗p < 0.001. Encouraged by these initial findings, we sought to test the capability of PMI to upregulate the Nrf2-dependent protein P62, an autophagic adaptor, deregulation of which is linked to several neurological pathologies (Geetha et al., 2012, Salminen et al., 2012). After exposure of MEF cells to 10 μM PMI or 1 μM sulforaphane, we monitored p62 mRNA levels over time using quantitative RT-PCR. There was a significant increase in p62 mRNA levels after 9 hr of PMI treatment (Figure 1E). Western blot analysis of cell lysates after 24 hr revealed cytosolic P62 protein levels in PMI-treated cells had increased 1.8-fold compared to untreated cells (Figures 1F and 1G), an increase statistically indistinguishable from the effect of sulforaphane (2.1-fold). Because P62 has a major role in mitochondrial autophagy, we investigated whether pharmacologically induced P62 overexpression could influence both macro and mitochondrial type autophagy induction.

PMI Promotes Mitochondrial LC3 Recruitment and Network Refinement

We monitored the conversion of LC3B-I to the lipidated LC3B-II in the cytoplasmic fraction of PMI- and vehicle-treated MEFs (Kabeya et al., 2000). Immunoblot analysis revealed no differences between the two treatments (Figures S1A and S1B available online). This experiment was repeated in the presence of Bafilomycin A1, which prevents the maturation of autophagic vacuoles as it inhibits the fusion of autophagosomes with lysosomes (Yoshimori et al., 1991), and is therefore a useful pharmacological tool to further investigate whether PMI interferes with the activation of general autophagy. However, in these experimental conditions, the level of LC3 lipidation (Klionsky et al., 2012) also remained unchanged after exposure to PMI, suggesting that PMI does not trigger any upregulation of general cellular autophagy. Although general autophagy appeared unaffected following PMI exposure, we were curious to test the effect of PMI on the specific removal of mitochondria by autophagy and hence the participation of P62 in mitophagy (Ding et al., 2010, Geisler et al., 2010, Huang et al., 2011). We initially examined the density of the mitochondrial network by immunofluorescence (Figures 1H and 1I). Cells treated with PMI for 24 hr were compared with untreated cells and a reduction in the network size measured via staining of the F1Fo-ATPsynthase (Abrahams et al., 1994) was noticeable in PMI-exposed cells, consistent with an alteration of mitochondrial network structure by the activation of selective autophagy. Additionally we monitored the levels of the mitochondrial inner membrane protein cytochrome c oxidase subunit I (CO1 or MTCO1) (Capaldi, 1990) after PMI and carbonyl cyanide 4-(trifluoromethoxy)phenylhydrazone (FCCP) (Heytler and Prichard, 1962) treatment as an indication of mitochondrial clearance (Figure 1J). Both PMI and FCCP treatment reduced the levels of MTCO1, although this was more pronounced with FCCP (Figure 1K). Unlike PMI treatment, exposure to sulforaphane did not cause a reduction in MTCO1 levels (Figures S1C and S1D). To further assess the role of LC3, we examined LC3-II levels in mitochondrial fractions with western blotting. Increased mitochondrial LC3-II was observed in cells treated with both PMI and FCCP (Figures 2A and 2B) whereas in p62−/− MEF cells, this increase was not detected (Figures 2C and 2D). Additionally we monitored the colocalization of mitochondria and LC3B in MEFs using high-resolution confocal imaging (Figure 2E). Under resting conditions, cells treated with PMI showed a dramatic increase in mitochondrial LC3B colocalization (PMI-DMSO: 3.31 ± 0.54 normalized fluorescence, units [n.f.]) compared to untreated conditions (control-DMSO: 1.00 ± 0.17 n.f.). However, when mitophagy was induced with FCCP, the increase in colocalization attributed to PMI was normalized; colocalization coefficients for FCCP-stimulated cells in both controls and PMI-treated conditions were approximately equal (control-FCCP 1.64 ± 0.20; PMI-FCCP 1.69 ± 0.18 n.f.); yet, as expected, with a significant induction of mitophagy compared to untreated conditions (control-DMSO: 1.00 ± 0.17 n.f.) (Figure 2F). In cells lacking Nrf2 (Nrf2 MEF), the observed increase in mitochondrial LC3 colocalization attributed to PMI was abolished (Figures S1E and S1F).
Figure 2

PMI Drives LC3 Mitochondrial Recruitment

(A and B) Western blot highlighting increased LC3-II in the mitochondrial fraction of WT MEFs treated with FCCP (A) and PMI quantified in (B); n = 3.

(C and D) Western blot highlighting no increase in LC3-II in the mitochondrial fraction of p62−/−MEFs treated with FCCP (C) and PMI quantified in (D) n = 3.

(E) Representative images of LC3 localization in MEF cells treated with DMSO vehicle control or 10 μM PMI for 24 hr, before and after treatment with FCCP (20 μM) for 4 hr. Scale bar represents 10 μm. A magnification of the merge images is shown in areas demarcated by the white box.

(F) Quantification of the degree of LC3:β-subunit colocalization in MEF cells. All values are mean ± SEM, ∗p < 0.05, ∗∗p < 0.01, ∗∗∗p < 0.001.

PMI Drives LC3 Mitochondrial Recruitment (A and B) Western blot highlighting increased LC3-II in the mitochondrial fraction of WT MEFs treated with FCCP (A) and PMI quantified in (B); n = 3. (C and D) Western blot highlighting no increase in LC3-II in the mitochondrial fraction of p62−/−MEFs treated with FCCP (C) and PMI quantified in (D) n = 3. (E) Representative images of LC3 localization in MEF cells treated with DMSO vehicle control or 10 μM PMI for 24 hr, before and after treatment with FCCP (20 μM) for 4 hr. Scale bar represents 10 μm. A magnification of the merge images is shown in areas demarcated by the white box. (F) Quantification of the degree of LC3:β-subunit colocalization in MEF cells. All values are mean ± SEM, ∗p < 0.05, ∗∗p < 0.01, ∗∗∗p < 0.001.

PMI Acts Downstream of the PINK1/Parkin Signaling Pathway

LC3-containing autophagosomes can be efficiently recruited to mitochondria by P62 (Ding et al., 2010, Geisler et al., 2010, Huang et al., 2011). To investigate if PMI treatment corresponded with increased mitochondrial-associated P62, a similar confocal imaging experiment was performed (Figure 3A) to measure colocalization of P62 with the mitochondrial network. In this case, a similar trend was observed (Figure 3B): under basal conditions, PMI-treated cells showed a substantial increase in mitochondrial P62 colocalization, relative to control, whereas this effect was normalized by addition of FCCP (control-DMSO 1.00 ± 0.10; PMI-DMSO 3.15 ± 0.33; control-FCCP 2.08 ± 0.28; PMI-FCCP 1.70 ± 0.27).
Figure 3

PMI-Induced Mitochondrial Recruitment of P62 Is Parkin Independent

(A) Representative images of P62 localization in MEF cells treated with DMSO vehicle control or 10 μM PMI for 24 hr, before and after treatment with FCCP (20 μM) for 4 hr. Scale bar represents 10 μm. A magnification of the merge images is shown in areas demarcated by the white box. Scale bar represents 10 μm.

(B) Quantification of the degree of p62:β-subunit: colocalization in MEF cells, n > 30.

(C) Representative images of Parkin localization in MEF cells treated with DMSO vehicle control or 10 μM PMI for 24 hr, before and after treatment with FCCP (20 μM) for 4 hr. Scale bar represents 10 μm. A magnification of the merge images is shown in areas demarcated by the white box. Scale bar represents 1 μm.

(D) Quantification of the degree of parkin:β-subunit colocalization in MEF cells, n > 30. All values are mean ± SEM, ∗∗p < 0.01, ∗∗∗p < 0.001.

PMI-Induced Mitochondrial Recruitment of P62 Is Parkin Independent (A) Representative images of P62 localization in MEF cells treated with DMSO vehicle control or 10 μM PMI for 24 hr, before and after treatment with FCCP (20 μM) for 4 hr. Scale bar represents 10 μm. A magnification of the merge images is shown in areas demarcated by the white box. Scale bar represents 10 μm. (B) Quantification of the degree of p62:β-subunit: colocalization in MEF cells, n > 30. (C) Representative images of Parkin localization in MEF cells treated with DMSO vehicle control or 10 μM PMI for 24 hr, before and after treatment with FCCP (20 μM) for 4 hr. Scale bar represents 10 μm. A magnification of the merge images is shown in areas demarcated by the white box. Scale bar represents 1 μm. (D) Quantification of the degree of parkin:β-subunit colocalization in MEF cells, n > 30. All values are mean ± SEM, ∗∗p < 0.01, ∗∗∗p < 0.001. During PINK1/Parkin-mediated mitophagy, mitochondrial P62 association occurs in response to Parkin mediated ubiquitination of OMM substrates (Jin and Youle, 2012). To examine whether the observed mitochondrial recruitment of P62 and LC3B were a consequence of a PMI-induced relocation of Parkin, further imaging experiments were performed (Figure 3C). In this case, MEFs incubated with PMI showed no increase in mitochondrial Parkin translocation compared to control (control-DMSO 1.00 ± 0.75; PMI-DMSO 0.88 ± 1.27). Instead, exposure to FCCP initiated a significant relocation of Parkin to mitochondria, in both untreated and PMI treated cells (control-FCCP 66.91 ± 24.22; PMI-FCCP 71.30 ± 14.38) (Figure 3D). This trend was inconsistent with that observed for LC3B and P62, suggesting that the action of PMI may occur downstream of Parkin. To further test this hypothesis, we assayed mitochondrial LC3 colocalization in Parkin knockdown MEFs and in pink1 knockout SH-SY5Y (Figures 4 and 5). Notably, in both cases, mitophagy was increased by PMI (Figure 4, wild-type [WT]: control-DMSO 1.00 ± 0.16; PMI-DMSO 1.65 ± 0.24; Parkin K/D: control-DMSO 0.44 ± 0.12; PMI-DMSO 1.12 ± 0.13 n.f.) (Figure 5, WT: control-DMSO 1.00 ± 0.10; PMI-DMSO 1.82 ± 0.21; pink1: control-DMSO 0.66 ± 0.05; PMI-DMSO 1.11 ± 0.06; control-FCCP 1.23 ± 0.07 PMI-FCCP 1.84 ± 0.11 n.f.).
Figure 4

In Parkin Knockdown Cells, PMI Promotes LC3 Mitochondrial Accumulation

(A) Representative images of LC3 localization in WT and Parkin knockdown MEF cells treated with DMSO vehicle control or 10 μM PMI for 24 hr. Scale bar represents 10 μm.

(B) A magnification of the merged images is shown in areas demarcated by the white box. Quantification of mitochondrial LC3 localization in WT and Parkin knockdown MEF cells treated with DMSO vehicle control or 10 μM PMI for 24 hr, n > 30. All values are mean ± SEM, ∗∗p < 0.01.

Figure 5

In PINK1 Knockout Cells, LC3 Is Recruited to Mitochondria by PMI

(A) Representative images of LC3 localization in WT and Pink1 knockout SH-SY5Y treated with DMSO vehicle control or 10 μM PMI for 24 hr. Scale bar represents 10 μm. A magnification of the merge images is shown in areas demarcated by the white box.

(B) Quantification of mitochondrial LC3 localization in WT and Pink1 knockout SH-SY5Y cells treated with DMSO vehicle control or 10 μM PMI for 24 hr, n > 30. All values are mean ± SEM, ∗∗p < 0.01.

In Parkin Knockdown Cells, PMI Promotes LC3 Mitochondrial Accumulation (A) Representative images of LC3 localization in WT and Parkin knockdown MEF cells treated with DMSO vehicle control or 10 μM PMI for 24 hr. Scale bar represents 10 μm. (B) A magnification of the merged images is shown in areas demarcated by the white box. Quantification of mitochondrial LC3 localization in WT and Parkin knockdown MEF cells treated with DMSO vehicle control or 10 μM PMI for 24 hr, n > 30. All values are mean ± SEM, ∗∗p < 0.01. In PINK1 Knockout Cells, LC3 Is Recruited to Mitochondria by PMI (A) Representative images of LC3 localization in WT and Pink1 knockout SH-SY5Y treated with DMSO vehicle control or 10 μM PMI for 24 hr. Scale bar represents 10 μm. A magnification of the merge images is shown in areas demarcated by the white box. (B) Quantification of mitochondrial LC3 localization in WT and Pink1 knockout SH-SY5Y cells treated with DMSO vehicle control or 10 μM PMI for 24 hr, n > 30. All values are mean ± SEM, ∗∗p < 0.01. This result suggests that PMI is still able to trigger mitophagy in the absence of PINK1 or Parkin, but also highlights that an intact PINK1/Parkin signaling pathway leads to more efficient mitochondrial clearance when triggered by PMI. This experimental outcome led us to investigate the effect of PMI on mitochondrial poly-ubiquitination.

PMI Positively Affects Mitochondrial Poly-Ubiquitination and Coupling

Poly-ubiquitination of mitochondrial OMM proteins by ubiquitin ligases flags damaged mitochondria for destruction (Geisler et al., 2010). When the mitochondrial fractions of cells treated with PMI and FCCP were analyzed for ubiquitination (Figure 6A), an increased level was observed compared to control conditions (Figure 6B). However, as per the previous analyses, an additive effect in cells treated with both PMI and FCCP was not detected (control-DMSO 1.00 ± 0.00; PMI-DMSO 2.11 ± 0.84; control-FCCP 2.89 ± 1.51 PMI-FCCP 2.66 ± 1.09).
Figure 6

PMI Mediates Poly-Ubiquitination of Mitochondria and Increases ΔΨm

(A) Western blot of mitochondrial fractions, highlighting mitochondrial ubiquitination in control or PMI-treated MEF cells before and after treatment with 20 mM FCCP.

(B) The graph shows total ubiquitin band density analysis relative to β-subunit loading control, n = 3.

(C) Representative confocal images depicting differences in ΔΨm when in MEF cells treated with DMSO vehicle control or 10 μM PMI for 24 hr and loaded with the cationic mitochondria selective probe TMRM (red) for 30 min. Scale bar represents 10 μm.

(D and E) Mean basal TMRM fluorescence quantification n > 10 (D) and shows representative traces of the effects of FCCP on mitochondrial membrane potential in treated with DMSO vehicle control or 10 μM PMI for 24 hr (E).

(F) Values of cytosolic ROS accumulation data collected in MEF cells by recording the rate of nuclear uptake of the O2− sensitive dye, dihydroethidium (DHE), n > 30.

(G) Mitochondrial ROS generation collected in MEF cells by recording fluorescence intensity of O2− sensitive, mitochondrial-specific dye, MitoSOX, n > 20. All values are mean ± SEM, ∗p < 0.05 ∗∗p < 0.01.

PMI Mediates Poly-Ubiquitination of Mitochondria and Increases ΔΨm (A) Western blot of mitochondrial fractions, highlighting mitochondrial ubiquitination in control or PMI-treated MEF cells before and after treatment with 20 mM FCCP. (B) The graph shows total ubiquitin band density analysis relative to β-subunit loading control, n = 3. (C) Representative confocal images depicting differences in ΔΨm when in MEF cells treated with DMSO vehicle control or 10 μM PMI for 24 hr and loaded with the cationic mitochondria selective probe TMRM (red) for 30 min. Scale bar represents 10 μm. (D and E) Mean basal TMRM fluorescence quantification n > 10 (D) and shows representative traces of the effects of FCCP on mitochondrial membrane potential in treated with DMSO vehicle control or 10 μM PMI for 24 hr (E). (F) Values of cytosolic ROS accumulation data collected in MEF cells by recording the rate of nuclear uptake of the O2− sensitive dye, dihydroethidium (DHE), n > 30. (G) Mitochondrial ROS generation collected in MEF cells by recording fluorescence intensity of O2− sensitive, mitochondrial-specific dye, MitoSOX, n > 20. All values are mean ± SEM, ∗p < 0.05 ∗∗p < 0.01. To further elucidate the mechanism by which PMI may be inducing mitophagy we tested aspects of mitochondrial physiology, which are directly involved in the activation of the process such as dissipation of the mitochondrial membrane potential (ΔΨm). ΔΨm was monitored in PMI-treated cells with tetramethylrhodamine, methyl ester (TMRM), using signal intensity as a function of membrane potential (Figures 6C and 6D). Notably, cells incubated with PMI had a higher resting ΔΨm (2.22 ± 0.14 n.f.) when compared to control cells (3.62 ± 0.31 n.f.), whereas the rate of FCCP-induced depolarization of ΔΨm was not affected (Figure 6E). Along with the measurements of ΔΨm, we then explored redox signaling. An excess of reactive oxygen species (ROS) may function as an autophagy trigger (Scherz-Shouval and Elazar, 2011) and dysfunctional mitochondria that overproduce ROS, are indeed selectively targeted by mitophagy (Kim et al., 2007). We therefore investigated the effect of PMI on mitochondrial and cellular ROS. Superoxide production was assayed in cells treated with PMI for 24 hr by monitoring the oxidation of the fluorescent probes mitoSOX and DHE to monitor mitochondrial and cytosolic ROS, respectively. While no disparity in cytosolic ROS production (Figure 6F) between treated and control cells was observed, ROS within mitochondria (Figure 6G) appeared moderately increased in cells exposed to PMI (control: 1.00 ± 0.04; PMI: 1.24 ± 0.09). A possible explanation of this is that PMI, by promoting segregation of defective mitochondria from the network via autophagy, could leave only those that are fully polarized, resulting in an overall increased rate of respiration within the remaining mitochondria. This may lead to the observed increase in mitochondrial ROS. This excess however is undetectable at the cytosolic level, possibly due to the concomitant upregulation of antioxidant mechanisms.

Discussion

The research devoted to the mechanisms underlying mitophagy has not been matched by the development of pharmacological tools to regulate the process. The prototypical approach to trigger mitophagy is based on the application of chemical ionophores: FCCP or carbonyl cyanide m-chlorophenyl hydrazone. These agents permeabilize the inner mitochondrial membrane to H+, destroying the H+ gradient, and in doing so, the electron transport chain of the oxidative phosphorylation system (Hirose et al., 1974). Although this protocol triggers fast and efficient depolarization of the organelle and PINK1/Parkin pathway activation (Kawajiri et al., 2010, Matsuda et al., 2010, Narendra et al., 2010), it has little physiological significance and has a number of adverse downstream effects (Padman et al., 2013). Recently, Jin and Youle have elegantly shown that the accumulation of misfolded proteins in mitochondria may suffice as a physiological molecular trigger for mitophagy activation without collapsing the ΔΨm (Jin and Youle, 2013). Additionally, the discovery that cardiolipin externalization on mitochondria acts as a surface marker of dysfunctional organelles (Chu et al., 2013) highlights the need for pharmacological tools acting by a different mechanism to ionophores, to better dissect the contribution of inner mitochondrial pathways to the efficiency of mitophagy. We therefore identified a compound that promotes the upregulation of P62 via stabilization of Nrf2 within treated cells (Baird and Dinkova-Kostova, 2011). This prototype molecule, which we called PMI, increases the expression of Nrf2-dependent gene products including P62, HO1, and NQO1 without perturbing mitochondrial function, the latter effect appears to distinguish the compound from some of the reported effects of sulforophane that exploits the same pathway. PMI increases the recruitment of LC3 to mitochondria without alteration to its lipidation or flux, an indication that this is not an effect on macro-autophagy (Figures 2B, 2F, 3B, and S1B). The absence of increased LC3 in the mitochondrial fractions of PMI-treated p62 MEFs serves to confine the effects to those associated with the presence of P62 (Figures 2B and 2D). This is further supported by the data from Nrf2 MEFs in which PMI-induced recruitment of LC3 to mitochondria is lost as expected, possibly due to the diminished P62 levels relative to the WT cells (Figures S1E and S1F). Notably, the mitochondrial relocalization of P62 and LC3 triggered by PMI was partially reduced when FCCP was added, suggesting that these two compounds may antagonize each other. By increasing P62 levels, PMI may promote the maximal recruitment of the “available” P62 to mitochondria, and, although the integrity of the PINK1/Parkin pathway (Kawajiri et al., 2010) is important for its action (see data in Figures 4 and 5), this is not its first site of intervention (Figures 3C and 3D). In cells challenged by PMI, FCCP may therefore drive a further stress by depolarizing ΔΨm that may become unsustainable for the autophagic machinery, thus diminishing the efficacy of PMI (Figures S1A and S1B). Nevertheless, simultaneous exposure to FCCP and PMI does not affect mitochondrial ubiquitination (Figures 6A and 6B), which was increased by PMI in line with the evidence indicating that P62 promotes a more dynamic ubiquitination of dysfunctional mitochondria by activating the ubiquitin ligase activity of TRAF6 that binds and stabilizes PINK1 on depolarized mitochondria (Murata et al., 2013, Wooten et al., 2005). Although we cannot rule out the possibility that the abrupt collapse of mitochondrial respiration caused by FCCP could be detrimental to PMI activity, the data obtained in (1) MEFs transiently downregulated for Parkin (MEF Parkin KD) as well as in (2) SH-SY5Y cells devoid of PINK1 (SH-SY5Y pink1 KO) highlight an alternative mechanism of action for PMI that is still capable of promoting mitochondrial recruitment of LC3 even if the PINK1/Parkin pathway is defective (Figures 4 and 5). In the working model depicted in Figure 7, we suggest that PMI determination of mitophagy may be made possible by redundant mitochondrial ubiquitination mechanisms that we have not identified but that could be the similar to those exploited by cells endogenously devoid of Parkin (e.g., HeLa) but that still preserve mitochondrial quality control (Denison et al., 2003, Pawlyk et al., 2003). The upregulation of the P62 pathway may represent a compensatory mechanism for defective mitophagy, making compounds related to PMI potential tools to restore mitophagy in pathological conditions in which the PINK1/Parkin pathway is impaired such as in Parkinson disease (Chu, 2010, Narendra et al., 2009). The null effect on mitophagy recorded for sulforaphane, despite its upregulation of P62 is intriguing. Sulforaphane and PMI have different time-dependent effects on Nrf2 stabilization, PMI has a slower onset of action, but a more sustained effect (Figure 1D), which may contribute to their differing effects on mitophagy. There is some evidence from the literature that sulforaphane has additional effects on mitochondria and mitochondrial biogenesis (Negrette-Guzmán M. et al., 2013), so it is possible that these may influence the mitophagic process. Alternatively, events in addition to P62 overexpression may be responsible for the effects of PMI. Further experiments will be required to fully elucidate and clarify the mode of action, and the factors that distinguish PMI from sulforaphane in the area of mitophagy.
Figure 7

The Proposed Working Model for PMI

(A) In healthy WT cells, a proportion of mitochondria will be destined for destruction due to age, damage, or dysfunction. Parkin-mediated ubiquitination (orange spheres) primes these mitochondria to enter the autophagic pathway and available P62 links them to LC3 (green spheres) and the growing autophagosome.

(B) In PMI-treated cells, P62 is more abundant therefore able to drive mitochondria into autophagy with increased efficiency.

(C) In cells where Parkin expression is reduced, a reduced number of mitochondria are primed for autophagy, so although P62 is overexpressed, the efficiency of mitophagy is reduced.

(D) Finally, in cells devoid of PINK1, Parkin is not recruited to mitochondria; however, redundant/alternative ubiquitin ligases may still be capable of ubiquitinating mitochondria, which can then be driven into autophagy by P62, albeit with reduced efficiency.

The Proposed Working Model for PMI (A) In healthy WT cells, a proportion of mitochondria will be destined for destruction due to age, damage, or dysfunction. Parkin-mediated ubiquitination (orange spheres) primes these mitochondria to enter the autophagic pathway and available P62 links them to LC3 (green spheres) and the growing autophagosome. (B) In PMI-treated cells, P62 is more abundant therefore able to drive mitochondria into autophagy with increased efficiency. (C) In cells where Parkin expression is reduced, a reduced number of mitochondria are primed for autophagy, so although P62 is overexpressed, the efficiency of mitophagy is reduced. (D) Finally, in cells devoid of PINK1, Parkin is not recruited to mitochondria; however, redundant/alternative ubiquitin ligases may still be capable of ubiquitinating mitochondria, which can then be driven into autophagy by P62, albeit with reduced efficiency. PMI-treated mitochondria display an increased superoxide metabolism, (Suski et al., 2012) (Figure 6G) which, in light of the parallel effects on mitochondrial network appearance (Figure 1H) and ΔΨm (Figures 6C and 6D), could indicate an improved oxidative-respiratory capacity; data that are consistent with recent reports (Holmström et al., 2013). The accompanying respiratory metabolic by-products remain undetectable in the cytoplasm, possibly due to the Nrf2-mediated upregulation of antioxidant responses as demonstrated by increases in ARE-dependent HO1 and NQO1 expression (Figures 1B–1D). Based on these in vitro findings, PMI is a molecule that drives mitochondria to a process of quality control without compromising the bio-energetic competence of the whole network but exposing just those organelles to be recycled. By acting alternately from FCCP, PMI could be a useful tool to define the contribution of molecules regulating mitophagy and illuminate the coordination between mitochondrial and nonmitochondrial events that drive execution of the process.

Significance

Mitochondrial quality control is a fundamental process in cellular homeostasis, and its deficiency is linked to several neurodegenerative diseases and cancers. Despite this, the discrete mechanisms, regulatory pathways, and impact on cellular physiology are still far from being elucidated. The current canonical methods to trigger mitophagy in vitro typically involve the abrupt depolarization of mitochondrial membrane potential (ΔΨ ) using ionophores such as carbonyl cyanide m-chlorophenyl hydrazone or FCCP that mediate various detrimental effects on several other cellular processes. PMI is a pharmacological agent that can trigger mitophagy while leaving ΔΨ intact. Therefore, PMI has enormous potential as a tool to further study the finely tuned process of mitochondrial quality control and dysregulation in disease states in a more physiologically relevant background.

Experimental Procedures

Chemistry and Analytical Data

Sulforaphane was purchased from Sigma-Aldrich (S6317). PMI (1-(3-iodophenyl)-4-(3-nitrophenyl)-1,2,3-triazole) was synthesized from commercially available starting materials in four solution-phase synthetic steps. 1H and 13C nuclear magnetic resonance (NMR) spectra were recorded on a Bruker Avance 400 instrument using solvent residuals as internal references. The following abbreviations are used: singlet (s), doublet (d), doublet of doublets (dd), triplet (t), doublet of triplets (dt), and multiplet (m). UCL School of Pharmacy provided high-resolution mass spectrometry and elemental analysis services. Melting points (mp, uncorrected) were determined using a Stuart Melting Point Apparatus SMP30 (Bibby Scientific). Thin-layer chromatography analysis was carried out on silica gel (Merck 60F-254) aluminum backed plates with depiction at 254 and 365 nm. Preparative flash chromatography was carried out with Merck silica gel (Si 60, 40–63 μm). Reagents, chemicals, and dry solvents (DMF) were purchased from Sigma-Aldrich unless otherwise stated. Liquid chromatography-mass spectrometry (LC-MS) analyses were performed on a Waters Micromass ZQ instrument coupled to a Waters 2695 high-performance liquid chromatography (HPLC) with a Waters 2996 PDA (LC-MS instrument). Waters Micromass ZQ parameters used were capillary (kV), 3.50; cone (V), 30; extractor (V), 3.0; source temperature (°C), 120; desolvation temperature (°C), 350; cone flow rate (l/hr), 80; desolvation flow rate (l/hr), 650. Analytical reverse-phase HPLC was carried out on a Phenomenex Onyx Monolithic C-18 column 50 × 4.6 mm. HPLC experiments were performed with gradient conditions: 95% solvent A, 5% solvent B for 1 min, then from 5% B to 95% B over 4 min (total run time 5 min, flow rate 1.5 ml/min) (solvent A [H2O containing 0.1% v/v formic acid] and solvent B [MeCN containing 0.1% v/v formic acid]).

1-Ethynyl-3-Nitrobenzene

To a solution of 1-bromo-3-nitrobenzene (2.0 g, 9.90 mmol, 1.0 equiv.) in dry DMF (5 ml) was added to diethylamine (10 ml); nitrogen gas was bubbled through the resulting solution for 20 min. CuI (8.4 mg, 0.04 mmol, 0.4%mol), Pd(PPh3)4 (125.9 mg, 0.11 mmol, 1.1%mol), and trimethylsilylacetylene (1.53 ml, 11.00 mmol, 1.11 equiv.) were then added and the resulting mixture was submitted to the following microwave heating sequence: prestirring for 30 s, then 1 hr at 120°C (Wang et al., 2007). The resulting mixture was poured into aqueous HCl (1 M, 60 ml) and extracted with DCM. The organic was washed with aqueous HCl (1 M, 50 ml) and brine (saturated solution, 50 ml), dried over MgSO4, filtered, and concentrated under reduced pressure. The residue was purified by column chromatography on silica gel (hexane/ethyl acetate 9/1) to afford 3-(trimethylsilylethynyl)nitrobenzene as a yellow solid (1.05 g, 48.5% chemical yield). Rf(hexane/EtOAc 9:1) = 0.55; 1H-NMR (400 MHz, CDCl3): δ (ppm) 8.3 (t, J = 1.6 Hz, 1H), 8.16 (ddd, J = 1.2, 2.2, 8.0 Hz, 1H), 7.75 (dt, J = 1.2, 8.0 Hz, 1H), 7.48 (t, J = 8.0 Hz, 1H), 0.27 (s, 9H); 13C-NMR (100 MHz, CDCl3): δ (ppm) 148.0, 137.5, 129.2, 126.8, 125.0, 123.1, 102.1, 97.6, 0 (3C); and LC-MS 100%, 3.60 min. 3-(trimethylsilylethynyl)nitrobenzene (317.0 mg, 1.45 mmol, 1.0 equiv.) was dissolved in methanol (15 ml). K2CO3 (359.0 mg, 2.6 mmol, 1.8 equiv.) was added and the suspension was stirred under N2 at RT for 2.5 hr. The mixture was filtered, the filtrate evaporated, and the residue taken up in water and extracted with EtOAc. The organic phase was washed with brine, dried over MgSO4, filtered, and concentrated under reduced pressure to afford1-ethynyl-3-nitrobenzene as a brown oil (180.0 mg, 85% chemical yield). Rf (hexane/EtOAc 9:1) = 0.47; 1H-NMR (400 MHz, CDCl3): δ (ppm) 8.32 (t, J = 2.0 Hz, 1H), 8.19 (ddd, J = 1.2, 2.4, 8.0 Hz, 1H), 7.78 (dt, J = 1.2, 8.0 Hz, 1H), 7.51 (t, J = 8.0 Hz, 1H), 3.22 (s, 1H); 13C-NMR (100 MHz, CDCl3): δ (ppm) 148.1, 137.7, 129.4, 127.0, 123.9, 123.5, 81.1, 79.9; and LC-MS 100%, 3.15 min.

1-Azido-3-Iodobenzene

3-Iodo-aniline (500.0 mg, 0.275 ml, 2.28 mmol, 1.0 equiv.) was suspended in water (10 ml) and aqueous HCl (1 ml, 10% v/v) was added and the solution cooled to 0°C. A solution of NaNO2 (189.0 mg, 2.74 mmol, 1.2 equiv.) in water (2 ml) was added dropwise at 0°C and the mixture stirred for a further 20 min (Faucher et al., 2002). A solution of NaN3 (223.0 mg, 3.43 mmol, 1.5 equiv.) in water (2 ml) was added dropwise at 0°C and the resulting suspension stirred for a further 3 hr. The solution was extracted with Et2O; the organic phase washed with water and saturated brine, then dried over MgSO4, filtered, and evaporated to afford 1-azido-3-iodobenzene as an orange oil (525.8 mg, 94% chemical yield). 1H-NMR (400 MHz, CDCl3): δ (ppm) 7.46 (dt, J = 1.2, 7.6 Hz, 1H), 7.37 (t, J = 2.0 Hz, 1H), 7.06 (t, J = 8.0 Hz, 1H), 6.98 (ddd, J = 1.2, 2.0, 8.0 Hz, 1H); 13C-NMR (100 MHz, CDCl3): δ (ppm) 141.3, 133.9, 131.0, 127.9, 118.4, 94.6.

1-(3-Iodophenyl)-4-(3-Nitrophenyl)-1,2,3-Triazole

1-Ethynyl-3-nitrobenzene (40.0 mg, 0.27 mmol, 1.0 equiv.) was suspended in tert-butanol (1.1 ml). An aqueous solution of CuSO4 (2.2 mg, 9.0 μmol, 0.033 equiv.; i.e. 0.54 ml from a 4.12 mg/ml solution in water), an aqueous solution of ascorbic acid (4.8 mg, 0.027 mmol, 0.1 equiv.; i.e. 0.55 ml from an 8.7 mg/ml solution in water) and 1-azido-3-iodobenzene (66.6 mg, 0.27 mmol, 1.0 equiv.) were then added. The mixture was submitted to the following microwave heating sequence: pre-stirring for 30 s, followed by stirring at 130°C for 30 min. The resulting suspension was diluted with water and filtered; the residue was washed with water and dried under vacuum to afford 1-(3-iodophenyl)-4-(3-nitrophenyl)-1,2,3-triazole as a yellow solid (57.0 mg, 53% chemical yield). mp 211-216°C (decomp.); 1H-NMR (400 MHz, DMSO-d6): δ (ppm) 9.65 (s, 1H), 8.74 (t, J = 2.0 Hz, 1H), 8.39 (dt, J = 1.2, 8.0 Hz, 1H), 8.35 (t, J = 2.0 Hz, 1H), 8.25 (ddd, J = 0.8, 2.0, 8.0 Hz, 1H), 8.03 (ddd, J = 0.8, 2.0, 8.0 Hz, 1H), 7.90 (dt, J = 1.2, 8.0 Hz, 1H), 7.83 (t, J = 8.0 Hz, 1H), 7.44 (t, J = 8.0 Hz, 1H);13C-NMR (125 MHz, DMSO-d6): δ (ppm) 148.3, 145.3, 137.4, 137.2, 131.75, 131.7, 131.2, 130.7, 128.0, 122.8, 121.1, 119.5, 119.2, 95.4; LC-MS 100%, 3.68 min; HRMS (TOF ES+): calculated for C14H10IN4O2: 392.9849, found: 392.9846; elemental analysis: calculated for: C14H9IN4O2: C 42.88%, H 2.31%, N 14.29%, found: C 42.86%, H 2.30%, N 14.01%.

Cell Culture and Transfections

MEFs and SH-SY5Y (SHY) cells were maintained at 37°C under humidified conditions and 5% CO2 and grown in Dulbecco’s modified Eagle medium (Life Technologies, 41966-052) supplemented with 10% fetal bovine serum (Life Technologies, 10082-147), 100 U/ml penicillin, and 100 mg/ml streptomycin (Life Technologies, 15140-122). Cells plated on glass coverslips/10 cm dishes at a 10%–20% confluence 1 day prior to transfection were transiently transfected with the genes of interest or siRNA using a standard Ca2+ phosphate method as described previously (Morelli et al., 2003). Cells were used in experiments 36–48 hr after transfection. To knock down parkin expression, species-dependent pre-designed siRNA was used—Murine Park2 target sequence: ACCATTGGGCCTGCTGGTCTA (QIAGEN, SI01369599). Experiments, unless otherwise indicated, were performed in Dulbecco’s modified Eagle medium supplemented with 10% fetal bovine serum or in the following recording medium (RM): 125 mM NaCl, 5 mM KCl, 1 mM NaH2PO4, 20 mM HEPES, 5.5 mM glucose, 5 mM NaHCO3, and 1 mM CaCl2, pH 7.4. The murine hepatoma Hepa1c1c7 cell line was obtained from the European Collection of Cell Culture. The cells were grown as monolayers and maintained by regular passage in α-MEM (Hepa1c1c7 cell line) supplemented with 2 mM L-glutamine, 100 units/ml penicillin and 100 μg/ml streptomycin and 10% heat-inactivated fetal bovine serum, cultured at 37°C in a water vapor saturated atmosphere with 5% CO2.

NQO1 Activity Assay

The method used is a modification of the procedure described by Fahey et al. (2004). Hepa1c1c7 cells were seeded in 96-well plates with a cell density of 2 × 104 cells/200 μl per well. After 12 hr, the cells were treated with compound or vehicle (final DMSO concentration 0.1% DMSO) and incubated for 24 hr. The culture medium was aspirated and cells lysed using 50 μl/well lysis buffer (0.1% Tween20 in 2 mM EDTA [pH 7.5]) and the plate shaken at room temperature for 15 min. The enzyme reaction mixture (200 μl; 25 mM Tris buffer [pH 7.5] containing BSA [0.067%], Tween20 (0.01%), FAD (5 μM), G6P (1 mM), NADP (30 μM), G6P dehydrogenase (40 units), MTT (0.03%), and menadione (50 μM)) was added to each well. After 5 min at room temperature, 40 μl of the stop solution (10% SDS, final concentration 1.5% SDS) was added to each well and the plate shaken for 5 s. The absorbance at 595 nm was measured. The background optical density was measured using wells containing tissue culture medium, lysis buffer, and enzyme and stop solutions without Hepa1c1c7 cells. The optical density values at 595 nm were averaged and the background corrected ratio of optical densities (compound treated/control) was calculated.

ΔΨm Measurements

Cells were loaded with 100 nM tetramethyl rhodamine methyl ester (TMRM) (Sigma-Aldrich, T5428) in recording medium (125 mM NaCl, 5 mM KCl, 1 mM NaH2PO4, 20 mM HEPES, 5.5 mM glucose, 5 mM NaHCO3, and 1 mM CaCl2, pH 7.4) for 30 min at 37°C. The TMRM dye accumulates in mitochondria, and its signal intensity is a function of potential (Scaduto and Grotyohann, 1999). Cells were washed once in recording medium then transferred to the Zeiss LSM 510 confocal microscope (40× objective) for imaging. After several minutes of continuous recording at basal conditions, 1 μM FCCP was added to induce depolarization. Settings were kept constant between experiments. Mitochondrial regions of interest were selected and the corresponding TMRM fluorescence intensities calculated.

Reactive Oxygen Species Analysis

Cells were incubated with 5 μM dihydroethidium (Life Technologies, D-1168) or 5 μM mitoSOX (Life Technologies, M-36008) in recording medium (125 mM NaCl, 5 mM KCl, 1 mM NaH2PO4, 20 mM HEPES, 5.5 mM glucose, 5 mM NaHCO3, and 1 mM CaCl2, pH 7.4) for 30 min at 37°C. Cells were washed once in recording medium then transferred to a Zeiss LSM 510 confocal microscope (40× objective) for imaging and fluorescence intensity was measured through continuous recording for at least 10 min. Settings were kept constant between experiments. Mitochondrial ROIs were selected and the corresponding fluorescence intensities were calculated.

Subcellular Fractionation

Cells were lysed in cold isotonic buffer (250 mM sucrose, 10 mM KCl, 1.5 mM MgCl2, 1 mM EDTA, 1 mM EGTA, 20 mM HEPES, pH 7.4) containing protease inhibitor cocktail (Roche, 05892791001) by passing through a 26 gauge needle ten times using a 1 ml syringe followed by 20 min incubation on ice. Unbroken cells and nuclei were removed by centrifugation at 800 × g for 5 min at 4°C. Supernatants were transferred to fresh tubes and centrifuged at 10,000 × g for 10 min at 4°C, Subsequent supernatants were collected as the cytosolic fractions while mitochondrial pellets were washed once in cold isotonic buffer then centrifuged at 10,000 × g for 10 min at 4°C. Finally, mitochondrial pellets were lysed in lysis buffer (150 mM NaCl, 1% v/v Triton X-100, 20 mM Tris pH 7.4) for 30 min on ice.

Western Blotting

Sample proteins were quantified using a BCA protein assay kit (Fisher Scientific, 13276818). Equal amounts of protein (10–30 μg for whole cell lysates/cytosolic fractions; 10 μg for mitochondrial fractions) were resolved on 10% or 12% SDS-PAGE gels and transferred to nitrocellulose membranes (Fisher Scientific, 10339574). The membranes were blocked in 3% nonfat dry milk in 50 mM Tris, 150 mM NaCl, 0.05% Tween 20, pH 7.5 (TBST) for 1 hr, then incubated with the appropriate diluted primary antibody at 4°C overnight: rabbit α-LC3 (Abcam, ab48394) 1:1,000; mouse α-P62/SQSTM1 (Abcam, ab56416) 1:20,000; α-GAPDH-Hrp conj. 1:50,000 (Abcam, ab9484); α-ubiquitin (Abcam, ab7780) 1:10,000, mouse α-parkin (Abcam, ab77924) 1:1,000. Membranes were washed in TBST (3 × 15 min at room temperature [RT]) and then incubated with corresponding peroxidase-conjugated secondary antibodies (Dako, P0447, P0448) for 1 hr at RT. After further washing in TBST, blots were developed using an ECL Plus western blotting detection kit (Fisher Scientific, 12316992). Immunoreactive bands were analyzed by performing densitometry with ImageJ software. Blots from Hepa1c1c7 cells were obtained as follows. Following treatment with 10 μM PMI, cells were harvested at different time intervals. Nuclear and cytosolic fractions were obtained using NE-PER Nuclear and Cytoplasmic Extraction Reagents (Thermo Scientific, 78833). Proteins were separated by electrophoresis on 10% SDS-PAGE gels and transferred onto nitrocellulose membranes. The blots were blocked with 1% skimmed milk and probed overnight with the primary antibodies: Heme Oxygenase 1 (Santa Cruz Biotechnology, sc-10789) polyclonal antibody, NQO1 (Santa Cruz Biotechnology, sc-271116) monoclonal antibody, or β-actin (Santa Cruz Biotechnology, sc-130657) polyclonal antibody. Following a 2 hr incubation period with peroxidase-conjugated secondary antibodies, proteins were detected using enhanced chemiluminescence (Fisher Scientific, 12316992).

Immunofluorescence

Cells were fixed in 4% PFA (10 min, RT) followed by three 5-minute washes in PBS. Permeabilization was performed with 0.5% Triton-X in PBS (10 min, RT) followed by washing. Blocking was carried out for 1 hr at RT in 10% goat serum and 3% BSA in PBS. Primary antibody incubations were conducted overnight for 16 hr at 4°C in blocking solution as described. After a further wash step, secondary antibodies were incubated for 1 hr in blocking solution, before a final wash step. Cells were then mounted on slides with DAPI mounting medium (Abcam, ab 104139). Cells were stained with the following primary antibodies: mouse α-β-subunit (Abcam, ab14730) 1:1,000; α-P62/SQSTM1 (Abcam, ab56416) 1:500; α-LC3 (Abcam, ab48394) 1:50, and the following secondary antibodies: α-mouse Alexa 555 (Life Technologies, A21424) 1:1,000; α-rabbit Alexa 488 (Life Technologies, A11008) 1:1,000.

Quantitative Real-Time PCR

Total RNA was extracted from the cultured cells using Tri-Reagent (Sigma) and purified using an RNeasy Mini Kit (QIAGEN). Spectrophotometry was used to quantify and determine purity (260/280nm ratio) of the total RNA (Nanodrop, LabTechnologies). One microgram of total RNA was used to synthesize cDNA in a 20 μl reaction volume as described using the QuantiTect Reverse Transcription kit (QIAGEN). Gene transcripts were amplified by RT-PCR using commercially available primer against mouse p62/sqstm1 (Sigma KiCqStart SYBR Green Primer pair:: M_Sqstm1_3). Quantitative real-time PCR reactions were performed in the Chromo 4 light cycler (Biorad). The absolute quantification method was used whereby the level of gene expression was expressed as a copy number. A standard curve was generated using known amounts of the DNA PCR product of the gene. A volume of 2 μl of the cDNA product from the reverse transcription reaction was used in a total volume of 20 μl SYBR green detection (QIAGEN). The SYBR green PCR reaction mix constituted of a final concentration of 2.5 mM MgCl2, 0.1 μM of each primer with the reaction consisting of the following: an initial 15 min denaturation step at 95°C followed by denaturation at 94°C for 15 s, annealing at 55°C for 25 s, and extension at 72°C for 15 s repeated for 40 cycles. The DNA standards and samples were run in the same 96-well PCR plate and the average of each duplicate value was used for subsequent statistical analyses. All PCR products were checked for specificity and purity from a melting curve profile performed by the lightcycler software at the end of each run.

Statistical Analysis

Data are presented as mean ± SEM. One-way ANOVA was used in multiple group comparisons with Bonferroni’s post hoc test to compare two data sets within the group and a p value less than 0.05 was considered significant. All analyses were performed in Microsoft Office Excel 2007. ∗p < 0.05, ∗∗p < 0.01, ∗∗∗p < 0.001.
  58 in total

Review 1.  Neurodegeneration as a consequence of failed mitochondrial maintenance.

Authors:  Mariusz Karbowski; Albert Neutzner
Journal:  Acta Neuropathol       Date:  2011-12-07       Impact factor: 17.088

Review 2.  The "Prochaska" microtiter plate bioassay for inducers of NQO1.

Authors:  Jed W Fahey; Albena T Dinkova-Kostova; Katherine K Stephenson; Paul Talalay
Journal:  Methods Enzymol       Date:  2004       Impact factor: 1.600

3.  A noncanonical mechanism of Nrf2 activation by autophagy deficiency: direct interaction between Keap1 and p62.

Authors:  Alexandria Lau; Xiao-Jun Wang; Fei Zhao; Nicole F Villeneuve; Tongde Wu; Tao Jiang; Zheng Sun; Eileen White; Donna D Zhang
Journal:  Mol Cell Biol       Date:  2010-04-26       Impact factor: 4.272

4.  Parkin-induced mitophagy in the pathogenesis of Parkinson disease.

Authors:  Derek Narendra; Atsushi Tanaka; Der-Fen Suen; Richard J Youle
Journal:  Autophagy       Date:  2009-07-22       Impact factor: 16.016

5.  The protonophore CCCP interferes with lysosomal degradation of autophagic cargo in yeast and mammalian cells.

Authors:  Benjamin S Padman; Markus Bach; Giuseppe Lucarelli; Mark Prescott; Georg Ramm
Journal:  Autophagy       Date:  2013-09-27       Impact factor: 16.016

Review 6.  Mitophagy or how to control the Jekyll and Hyde embedded in mitochondrial metabolism: implications for melanoma progression and drug resistance.

Authors:  María S Soengas
Journal:  Pigment Cell Melanoma Res       Date:  2012-11       Impact factor: 4.693

7.  Novel monoclonal antibodies demonstrate biochemical variation of brain parkin with age.

Authors:  Aaron C Pawlyk; Benoit I Giasson; Deepak M Sampathu; Francisco A Perez; Kah Leong Lim; Valina L Dawson; Ted M Dawson; Richard D Palmiter; John Q Trojanowski; Virginia M-Y Lee
Journal:  J Biol Chem       Date:  2003-09-12       Impact factor: 5.157

8.  p62/SQSTM1 binds directly to Atg8/LC3 to facilitate degradation of ubiquitinated protein aggregates by autophagy.

Authors:  Serhiy Pankiv; Terje Høyvarde Clausen; Trond Lamark; Andreas Brech; Jack-Ansgar Bruun; Heidi Outzen; Aud Øvervatn; Geir Bjørkøy; Terje Johansen
Journal:  J Biol Chem       Date:  2007-06-19       Impact factor: 5.157

9.  Mitochondrial membrane potential regulates PINK1 import and proteolytic destabilization by PARL.

Authors:  Seok Min Jin; Michael Lazarou; Chunxin Wang; Lesley A Kane; Derek P Narendra; Richard J Youle
Journal:  J Cell Biol       Date:  2010-11-29       Impact factor: 10.539

10.  Nrf2 impacts cellular bioenergetics by controlling substrate availability for mitochondrial respiration.

Authors:  Kira M Holmström; Liam Baird; Ying Zhang; Iain Hargreaves; Annapurna Chalasani; John M Land; Lee Stanyer; Masayuki Yamamoto; Albena T Dinkova-Kostova; Andrey Y Abramov
Journal:  Biol Open       Date:  2013-06-20       Impact factor: 2.422

View more
  52 in total

Review 1.  Promoting the clearance of neurotoxic proteins in neurodegenerative disorders of ageing.

Authors:  Barry Boland; Wai Haung Yu; Olga Corti; Bertrand Mollereau; Alexandre Henriques; Erwan Bezard; Greg M Pastores; David C Rubinsztein; Ralph A Nixon; Michael R Duchen; Giovanna R Mallucci; Guido Kroemer; Beth Levine; Eeva-Liisa Eskelinen; Fanny Mochel; Michael Spedding; Caroline Louis; Olivier R Martin; Mark J Millan
Journal:  Nat Rev Drug Discov       Date:  2018-08-17       Impact factor: 84.694

Review 2.  Nrf2/ARE Pathway as a Therapeutic Target for the Treatment of Parkinson Diseases.

Authors:  Artem P Gureev; Vasily N Popov
Journal:  Neurochem Res       Date:  2019-01-07       Impact factor: 3.996

3.  Emerging views of mitophagy in immunity and autoimmune diseases.

Authors:  Ye Xu; Jun Shen; Zhihua Ran
Journal:  Autophagy       Date:  2019-04-21       Impact factor: 16.016

Review 4.  The Emerging Roles of Ferroptosis in Huntington's Disease.

Authors:  Yajing Mi; Xingchun Gao; Hao Xu; Yuanyuan Cui; Yuelin Zhang; Xingchun Gou
Journal:  Neuromolecular Med       Date:  2019-01-02       Impact factor: 3.843

5.  Mycotoxin Patulin Suppresses Innate Immune Responses by Mitochondrial Dysfunction and p62/Sequestosome-1-dependent Mitophagy.

Authors:  Wan-Ting Tsai; Yin-Chiu Lo; Ming-Sian Wu; Chia-Yang Li; Yi-Ping Kuo; Yi-Hui Lai; Yu Tsai; Kai-Chieh Chen; Tsung-Hsien Chuang; Chun-Hsu Yao; Jinq-Chyi Lee; Li-Chung Hsu; John T-A Hsu; Guann-Yi Yu
Journal:  J Biol Chem       Date:  2016-07-25       Impact factor: 5.157

6.  NDPK-D (NM23-H4)-mediated externalization of cardiolipin enables elimination of depolarized mitochondria by mitophagy.

Authors:  V E Kagan; J Jiang; Z Huang; Y Y Tyurina; C Desbourdes; C Cottet-Rousselle; H H Dar; M Verma; V A Tyurin; A A Kapralov; A Cheikhi; G Mao; D Stolz; C M St Croix; S Watkins; Z Shen; Y Li; M L Greenberg; M Tokarska-Schlattner; M Boissan; M-L Lacombe; R M Epand; C T Chu; R K Mallampalli; H Bayır; U Schlattner
Journal:  Cell Death Differ       Date:  2016-01-08       Impact factor: 15.828

Review 7.  Genes associated with Parkinson's disease: regulation of autophagy and beyond.

Authors:  Alexandra Beilina; Mark R Cookson
Journal:  J Neurochem       Date:  2015-09-03       Impact factor: 5.372

Review 8.  Carnosic Acid as a Promising Agent in Protecting Mitochondria of Brain Cells.

Authors:  Marcos Roberto de Oliveira
Journal:  Mol Neurobiol       Date:  2018-01-15       Impact factor: 5.590

9.  Andrographolide alleviates Parkinsonism in MPTP-PD mice via targeting mitochondrial fission mediated by dynamin-related protein 1.

Authors:  Ji Geng; Wen Liu; Jian Gao; Chunhong Jiang; Ting Fan; Yang Sun; Zheng-Hong Qin; Qiang Xu; Wenjie Guo; Jing Gao
Journal:  Br J Pharmacol       Date:  2019-11-14       Impact factor: 8.739

10.  Guidelines for the use and interpretation of assays for monitoring autophagy (3rd edition).

Authors:  Daniel J Klionsky; Kotb Abdelmohsen; Akihisa Abe; Md Joynal Abedin; Hagai Abeliovich; Abraham Acevedo Arozena; Hiroaki Adachi; Christopher M Adams; Peter D Adams; Khosrow Adeli; Peter J Adhihetty; Sharon G Adler; Galila Agam; Rajesh Agarwal; Manish K Aghi; Maria Agnello; Patrizia Agostinis; Patricia V Aguilar; Julio Aguirre-Ghiso; Edoardo M Airoldi; Slimane Ait-Si-Ali; Takahiko Akematsu; Emmanuel T Akporiaye; Mohamed Al-Rubeai; Guillermo M Albaiceta; Chris Albanese; Diego Albani; Matthew L Albert; Jesus Aldudo; Hana Algül; Mehrdad Alirezaei; Iraide Alloza; Alexandru Almasan; Maylin Almonte-Beceril; Emad S Alnemri; Covadonga Alonso; Nihal Altan-Bonnet; Dario C Altieri; Silvia Alvarez; Lydia Alvarez-Erviti; Sandro Alves; Giuseppina Amadoro; Atsuo Amano; Consuelo Amantini; Santiago Ambrosio; Ivano Amelio; Amal O Amer; Mohamed Amessou; Angelika Amon; Zhenyi An; Frank A Anania; Stig U Andersen; Usha P Andley; Catherine K Andreadi; Nathalie Andrieu-Abadie; Alberto Anel; David K Ann; Shailendra Anoopkumar-Dukie; Manuela Antonioli; Hiroshi Aoki; Nadezda Apostolova; Saveria Aquila; Katia Aquilano; Koichi Araki; Eli Arama; Agustin Aranda; Jun Araya; Alexandre Arcaro; Esperanza Arias; Hirokazu Arimoto; Aileen R Ariosa; Jane L Armstrong; Thierry Arnould; Ivica Arsov; Katsuhiko Asanuma; Valerie Askanas; Eric Asselin; Ryuichiro Atarashi; Sally S Atherton; Julie D Atkin; Laura D Attardi; Patrick Auberger; Georg Auburger; Laure Aurelian; Riccardo Autelli; Laura Avagliano; Maria Laura Avantaggiati; Limor Avrahami; Suresh Awale; Neelam Azad; Tiziana Bachetti; Jonathan M Backer; Dong-Hun Bae; Jae-Sung Bae; Ok-Nam Bae; Soo Han Bae; Eric H Baehrecke; Seung-Hoon Baek; Stephen Baghdiguian; Agnieszka Bagniewska-Zadworna; Hua Bai; Jie Bai; Xue-Yuan Bai; Yannick Bailly; Kithiganahalli Narayanaswamy Balaji; Walter Balduini; Andrea Ballabio; Rena Balzan; Rajkumar Banerjee; Gábor Bánhegyi; Haijun Bao; Benoit Barbeau; Maria D Barrachina; Esther Barreiro; Bonnie Bartel; Alberto Bartolomé; Diane C Bassham; Maria Teresa Bassi; Robert C Bast; Alakananda Basu; Maria Teresa Batista; Henri Batoko; Maurizio Battino; Kyle Bauckman; Bradley L Baumgarner; K Ulrich Bayer; Rupert Beale; Jean-François Beaulieu; George R Beck; Christoph Becker; J David Beckham; Pierre-André Bédard; Patrick J Bednarski; Thomas J Begley; Christian Behl; Christian Behrends; Georg Mn Behrens; Kevin E Behrns; Eloy Bejarano; Amine Belaid; Francesca Belleudi; Giovanni Bénard; Guy Berchem; Daniele Bergamaschi; Matteo Bergami; Ben Berkhout; Laura Berliocchi; Amélie Bernard; Monique Bernard; Francesca Bernassola; Anne Bertolotti; Amanda S Bess; Sébastien Besteiro; Saverio Bettuzzi; Savita Bhalla; Shalmoli Bhattacharyya; Sujit K Bhutia; Caroline Biagosch; Michele Wolfe Bianchi; Martine Biard-Piechaczyk; Viktor Billes; Claudia Bincoletto; Baris Bingol; Sara W Bird; Marc Bitoun; Ivana Bjedov; Craig Blackstone; Lionel Blanc; Guillermo A Blanco; Heidi Kiil Blomhoff; Emilio Boada-Romero; Stefan Böckler; Marianne Boes; Kathleen Boesze-Battaglia; Lawrence H Boise; Alessandra Bolino; Andrea Boman; Paolo Bonaldo; Matteo Bordi; Jürgen Bosch; Luis M Botana; Joelle Botti; German Bou; Marina Bouché; Marion Bouchecareilh; Marie-Josée Boucher; Michael E Boulton; Sebastien G Bouret; Patricia Boya; Michaël Boyer-Guittaut; Peter V Bozhkov; Nathan Brady; Vania Mm Braga; Claudio Brancolini; Gerhard H Braus; José M Bravo-San Pedro; Lisa A Brennan; Emery H Bresnick; Patrick Brest; Dave Bridges; Marie-Agnès Bringer; Marisa Brini; Glauber C Brito; Bertha Brodin; Paul S Brookes; Eric J Brown; Karen Brown; Hal E Broxmeyer; Alain Bruhat; Patricia Chakur Brum; John H Brumell; Nicola Brunetti-Pierri; Robert J Bryson-Richardson; Shilpa Buch; Alastair M Buchan; Hikmet Budak; Dmitry V Bulavin; Scott J Bultman; Geert Bultynck; Vladimir Bumbasirevic; Yan Burelle; Robert E Burke; Margit Burmeister; Peter Bütikofer; Laura Caberlotto; Ken Cadwell; Monika Cahova; Dongsheng Cai; Jingjing Cai; Qian Cai; Sara Calatayud; Nadine Camougrand; Michelangelo Campanella; Grant R Campbell; Matthew Campbell; Silvia Campello; Robin Candau; Isabella Caniggia; Lavinia Cantoni; Lizhi Cao; Allan B Caplan; Michele Caraglia; Claudio Cardinali; Sandra Morais Cardoso; Jennifer S Carew; Laura A Carleton; Cathleen R Carlin; Silvia Carloni; Sven R Carlsson; Didac Carmona-Gutierrez; Leticia Am Carneiro; Oliana Carnevali; Serena Carra; Alice Carrier; Bernadette Carroll; Caty Casas; Josefina Casas; Giuliana Cassinelli; Perrine Castets; Susana Castro-Obregon; Gabriella Cavallini; Isabella Ceccherini; Francesco Cecconi; Arthur I Cederbaum; Valentín Ceña; Simone Cenci; Claudia Cerella; Davide Cervia; Silvia Cetrullo; Hassan Chaachouay; Han-Jung Chae; Andrei S Chagin; Chee-Yin Chai; Gopal Chakrabarti; Georgios Chamilos; Edmond Yw Chan; Matthew Tv Chan; Dhyan Chandra; Pallavi Chandra; Chih-Peng Chang; Raymond Chuen-Chung Chang; Ta Yuan Chang; John C Chatham; Saurabh Chatterjee; Santosh Chauhan; Yongsheng Che; Michael E Cheetham; Rajkumar Cheluvappa; Chun-Jung Chen; Gang Chen; Guang-Chao Chen; Guoqiang Chen; Hongzhuan Chen; Jeff W Chen; Jian-Kang Chen; Min Chen; Mingzhou Chen; Peiwen Chen; Qi Chen; Quan Chen; Shang-Der Chen; Si Chen; Steve S-L Chen; Wei Chen; Wei-Jung Chen; Wen Qiang Chen; Wenli Chen; Xiangmei Chen; Yau-Hung Chen; Ye-Guang Chen; Yin Chen; Yingyu Chen; Yongshun Chen; Yu-Jen Chen; Yue-Qin Chen; Yujie Chen; Zhen Chen; Zhong Chen; Alan Cheng; Christopher Hk Cheng; Hua Cheng; Heesun Cheong; Sara Cherry; Jason Chesney; Chun Hei Antonio Cheung; Eric Chevet; Hsiang Cheng Chi; Sung-Gil Chi; Fulvio Chiacchiera; Hui-Ling Chiang; Roberto Chiarelli; Mario Chiariello; Marcello Chieppa; Lih-Shen Chin; Mario Chiong; Gigi Nc Chiu; Dong-Hyung Cho; Ssang-Goo Cho; William C Cho; Yong-Yeon Cho; Young-Seok Cho; Augustine Mk Choi; Eui-Ju Choi; Eun-Kyoung Choi; Jayoung Choi; Mary E Choi; Seung-Il Choi; Tsui-Fen Chou; Salem Chouaib; Divaker Choubey; Vinay Choubey; Kuan-Chih Chow; Kamal Chowdhury; Charleen T Chu; Tsung-Hsien Chuang; Taehoon Chun; Hyewon Chung; Taijoon Chung; Yuen-Li Chung; Yong-Joon Chwae; Valentina Cianfanelli; Roberto Ciarcia; Iwona A Ciechomska; Maria Rosa Ciriolo; Mara Cirone; Sofie Claerhout; Michael J Clague; Joan Clària; Peter Gh Clarke; Robert Clarke; Emilio Clementi; Cédric Cleyrat; Miriam Cnop; Eliana M Coccia; Tiziana Cocco; Patrice Codogno; Jörn Coers; Ezra Ew Cohen; David Colecchia; Luisa Coletto; Núria S Coll; Emma Colucci-Guyon; Sergio Comincini; Maria Condello; Katherine L Cook; Graham H Coombs; Cynthia D Cooper; J Mark Cooper; Isabelle Coppens; Maria Tiziana Corasaniti; Marco Corazzari; Ramon Corbalan; Elisabeth Corcelle-Termeau; Mario D Cordero; Cristina Corral-Ramos; Olga Corti; Andrea Cossarizza; Paola Costelli; Safia Costes; Susan L Cotman; Ana Coto-Montes; Sandra Cottet; Eduardo Couve; Lori R Covey; L Ashley Cowart; Jeffery S Cox; Fraser P Coxon; Carolyn B Coyne; Mark S Cragg; Rolf J Craven; Tiziana Crepaldi; Jose L Crespo; Alfredo Criollo; Valeria Crippa; Maria Teresa Cruz; Ana Maria Cuervo; Jose M Cuezva; Taixing Cui; Pedro R Cutillas; Mark J Czaja; Maria F Czyzyk-Krzeska; Ruben K Dagda; Uta Dahmen; Chunsun Dai; Wenjie Dai; Yun Dai; Kevin N Dalby; Luisa Dalla Valle; Guillaume Dalmasso; Marcello D'Amelio; Markus Damme; Arlette Darfeuille-Michaud; Catherine Dargemont; Victor M Darley-Usmar; Srinivasan Dasarathy; Biplab Dasgupta; Srikanta Dash; Crispin R Dass; Hazel Marie Davey; Lester M Davids; David Dávila; Roger J Davis; Ted M Dawson; Valina L Dawson; Paula Daza; Jackie de Belleroche; Paul de Figueiredo; Regina Celia Bressan Queiroz de Figueiredo; José de la Fuente; Luisa De Martino; Antonella De Matteis; Guido Ry De Meyer; Angelo De Milito; Mauro De Santi; Wanderley de Souza; Vincenzo De Tata; Daniela De Zio; Jayanta Debnath; Reinhard Dechant; Jean-Paul Decuypere; Shane Deegan; Benjamin Dehay; Barbara Del Bello; Dominic P Del Re; Régis Delage-Mourroux; Lea Md Delbridge; Louise Deldicque; Elizabeth Delorme-Axford; Yizhen Deng; Joern Dengjel; Melanie Denizot; Paul Dent; Channing J Der; Vojo Deretic; Benoît Derrien; Eric Deutsch; Timothy P Devarenne; Rodney J Devenish; Sabrina Di Bartolomeo; Nicola Di Daniele; Fabio Di Domenico; Alessia Di Nardo; Simone Di Paola; Antonio Di Pietro; Livia Di Renzo; Aaron DiAntonio; Guillermo Díaz-Araya; Ines Díaz-Laviada; Maria T Diaz-Meco; Javier Diaz-Nido; Chad A Dickey; Robert C Dickson; Marc Diederich; Paul Digard; Ivan Dikic; Savithrama P Dinesh-Kumar; Chan Ding; Wen-Xing Ding; Zufeng Ding; Luciana Dini; Jörg Hw Distler; Abhinav Diwan; Mojgan Djavaheri-Mergny; Kostyantyn Dmytruk; Renwick Cj Dobson; Volker Doetsch; Karol Dokladny; Svetlana Dokudovskaya; Massimo Donadelli; X Charlie Dong; Xiaonan Dong; Zheng Dong; Terrence M Donohue; Kelly S Doran; Gabriella D'Orazi; Gerald W Dorn; Victor Dosenko; Sami Dridi; Liat Drucker; Jie Du; Li-Lin Du; Lihuan Du; André du Toit; Priyamvada Dua; Lei Duan; Pu Duann; Vikash Kumar Dubey; Michael R Duchen; Michel A Duchosal; Helene Duez; Isabelle Dugail; Verónica I Dumit; Mara C Duncan; Elaine A Dunlop; William A Dunn; Nicolas Dupont; Luc Dupuis; Raúl V Durán; Thomas M Durcan; Stéphane Duvezin-Caubet; Umamaheswar Duvvuri; Vinay Eapen; Darius Ebrahimi-Fakhari; Arnaud Echard; Leopold Eckhart; Charles L Edelstein; Aimee L Edinger; Ludwig Eichinger; Tobias Eisenberg; Avital Eisenberg-Lerner; N Tony Eissa; Wafik S El-Deiry; Victoria El-Khoury; Zvulun Elazar; Hagit Eldar-Finkelman; Chris Jh Elliott; Enzo Emanuele; Urban Emmenegger; Nikolai Engedal; Anna-Mart Engelbrecht; Simone Engelender; Jorrit M Enserink; Ralf Erdmann; Jekaterina Erenpreisa; Rajaraman Eri; Jason L Eriksen; Andreja Erman; Ricardo Escalante; Eeva-Liisa Eskelinen; Lucile Espert; Lorena Esteban-Martínez; Thomas J Evans; Mario Fabri; Gemma Fabrias; Cinzia Fabrizi; Antonio Facchiano; Nils J Færgeman; Alberto Faggioni; W Douglas Fairlie; Chunhai Fan; Daping Fan; Jie Fan; Shengyun Fang; Manolis Fanto; Alessandro Fanzani; Thomas Farkas; Mathias Faure; Francois B Favier; Howard Fearnhead; Massimo Federici; Erkang Fei; Tania C Felizardo; Hua Feng; Yibin Feng; Yuchen Feng; Thomas A Ferguson; Álvaro F Fernández; Maite G Fernandez-Barrena; Jose C Fernandez-Checa; Arsenio Fernández-López; Martin E Fernandez-Zapico; Olivier Feron; Elisabetta Ferraro; Carmen Veríssima Ferreira-Halder; Laszlo Fesus; Ralph Feuer; Fabienne C Fiesel; Eduardo C Filippi-Chiela; Giuseppe Filomeni; Gian Maria Fimia; John H Fingert; Steven Finkbeiner; Toren Finkel; Filomena Fiorito; Paul B Fisher; Marc Flajolet; Flavio Flamigni; Oliver Florey; Salvatore Florio; R Andres Floto; Marco Folini; Carlo Follo; Edward A Fon; Francesco Fornai; Franco Fortunato; Alessandro Fraldi; Rodrigo Franco; Arnaud Francois; Aurélie François; Lisa B Frankel; Iain Dc Fraser; Norbert Frey; Damien G Freyssenet; Christian Frezza; Scott L Friedman; Daniel E Frigo; Dongxu Fu; José M Fuentes; Juan Fueyo; Yoshio Fujitani; Yuuki Fujiwara; Mikihiro Fujiya; Mitsunori Fukuda; Simone Fulda; Carmela Fusco; Bozena Gabryel; Matthias Gaestel; Philippe Gailly; Malgorzata Gajewska; Sehamuddin Galadari; Gad Galili; Inmaculada Galindo; Maria F Galindo; Giovanna Galliciotti; Lorenzo Galluzzi; Luca Galluzzi; Vincent Galy; Noor Gammoh; Sam Gandy; Anand K Ganesan; Swamynathan Ganesan; Ian G Ganley; Monique Gannagé; Fen-Biao Gao; Feng Gao; Jian-Xin Gao; Lorena García Nannig; Eleonora García Véscovi; Marina Garcia-Macía; Carmen Garcia-Ruiz; Abhishek D Garg; Pramod Kumar Garg; Ricardo Gargini; Nils Christian Gassen; Damián Gatica; Evelina Gatti; Julie Gavard; Evripidis Gavathiotis; Liang Ge; Pengfei Ge; Shengfang Ge; Po-Wu Gean; Vania Gelmetti; Armando A Genazzani; Jiefei Geng; Pascal Genschik; Lisa Gerner; Jason E Gestwicki; David A Gewirtz; Saeid Ghavami; Eric Ghigo; Debabrata Ghosh; Anna Maria Giammarioli; Francesca Giampieri; Claudia Giampietri; Alexandra Giatromanolaki; Derrick J Gibbings; Lara Gibellini; Spencer B Gibson; Vanessa Ginet; Antonio Giordano; Flaviano Giorgini; Elisa Giovannetti; Stephen E Girardin; Suzana Gispert; Sandy Giuliano; Candece L Gladson; Alvaro Glavic; Martin Gleave; Nelly Godefroy; Robert M Gogal; Kuppan Gokulan; Gustavo H Goldman; Delia Goletti; Michael S Goligorsky; Aldrin V Gomes; Ligia C Gomes; Hernando Gomez; Candelaria Gomez-Manzano; Rubén Gómez-Sánchez; Dawit Ap Gonçalves; Ebru Goncu; Qingqiu Gong; Céline Gongora; Carlos B Gonzalez; Pedro Gonzalez-Alegre; Pilar Gonzalez-Cabo; Rosa Ana González-Polo; Ing Swie Goping; Carlos Gorbea; Nikolai V Gorbunov; Daphne R Goring; Adrienne M Gorman; Sharon M Gorski; Sandro Goruppi; Shino Goto-Yamada; Cecilia Gotor; Roberta A Gottlieb; Illana Gozes; Devrim Gozuacik; Yacine Graba; Martin Graef; Giovanna E Granato; Gary Dean Grant; Steven Grant; Giovanni Luca Gravina; Douglas R Green; Alexander Greenhough; Michael T Greenwood; Benedetto Grimaldi; Frédéric Gros; Charles Grose; Jean-Francois Groulx; Florian Gruber; Paolo Grumati; Tilman Grune; Jun-Lin Guan; Kun-Liang Guan; Barbara Guerra; Carlos Guillen; Kailash Gulshan; Jan Gunst; Chuanyong Guo; Lei Guo; Ming Guo; Wenjie Guo; Xu-Guang Guo; Andrea A Gust; Åsa B Gustafsson; Elaine Gutierrez; Maximiliano G Gutierrez; Ho-Shin Gwak; Albert Haas; James E Haber; Shinji Hadano; Monica Hagedorn; David R Hahn; Andrew J Halayko; Anne Hamacher-Brady; Kozo Hamada; Ahmed Hamai; Andrea Hamann; Maho Hamasaki; Isabelle Hamer; Qutayba Hamid; Ester M Hammond; Feng Han; Weidong Han; James T Handa; John A Hanover; Malene Hansen; Masaru Harada; Ljubica Harhaji-Trajkovic; J Wade Harper; Abdel Halim Harrath; Adrian L Harris; James Harris; Udo Hasler; Peter Hasselblatt; Kazuhisa Hasui; Robert G Hawley; Teresa S Hawley; Congcong He; Cynthia Y He; Fengtian He; Gu He; Rong-Rong He; Xian-Hui He; You-Wen He; Yu-Ying He; Joan K Heath; Marie-Josée Hébert; Robert A Heinzen; Gudmundur Vignir Helgason; Michael Hensel; Elizabeth P Henske; Chengtao Her; Paul K Herman; Agustín Hernández; Carlos Hernandez; Sonia Hernández-Tiedra; Claudio Hetz; P Robin Hiesinger; Katsumi Higaki; Sabine Hilfiker; Bradford G Hill; Joseph A Hill; William D Hill; Keisuke Hino; Daniel Hofius; Paul Hofman; Günter U Höglinger; Jörg Höhfeld; Marina K Holz; Yonggeun Hong; David A Hood; Jeroen Jm Hoozemans; Thorsten Hoppe; Chin Hsu; Chin-Yuan Hsu; Li-Chung Hsu; Dong Hu; Guochang Hu; Hong-Ming Hu; Hongbo Hu; Ming Chang Hu; Yu-Chen Hu; Zhuo-Wei Hu; Fang Hua; Ya Hua; Canhua Huang; Huey-Lan Huang; Kuo-How Huang; Kuo-Yang Huang; Shile Huang; Shiqian Huang; Wei-Pang Huang; Yi-Ran Huang; Yong Huang; Yunfei Huang; Tobias B Huber; Patricia Huebbe; Won-Ki Huh; Juha J Hulmi; Gang Min Hur; James H Hurley; Zvenyslava Husak; Sabah Na Hussain; Salik Hussain; Jung Jin Hwang; Seungmin Hwang; Thomas Is Hwang; Atsuhiro Ichihara; Yuzuru Imai; Carol Imbriano; Megumi Inomata; Takeshi Into; Valentina Iovane; Juan L Iovanna; Renato V Iozzo; Nancy Y Ip; Javier E Irazoqui; Pablo Iribarren; Yoshitaka Isaka; Aleksandra J Isakovic; Harry Ischiropoulos; Jeffrey S Isenberg; Mohammad Ishaq; Hiroyuki Ishida; Isao Ishii; Jane E Ishmael; Ciro Isidoro; Ken-Ichi Isobe; Erika Isono; Shohreh Issazadeh-Navikas; Koji Itahana; Eisuke Itakura; Andrei I Ivanov; Anand Krishnan V Iyer; José M Izquierdo; Yotaro Izumi; Valentina Izzo; Marja Jäättelä; Nadia Jaber; Daniel John Jackson; William T Jackson; Tony George Jacob; Thomas S Jacques; Chinnaswamy Jagannath; Ashish Jain; Nihar Ranjan Jana; Byoung Kuk Jang; Alkesh Jani; Bassam Janji; Paulo Roberto Jannig; Patric J Jansson; Steve Jean; Marina Jendrach; Ju-Hong Jeon; Niels Jessen; Eui-Bae Jeung; Kailiang Jia; Lijun Jia; Hong Jiang; Hongchi Jiang; Liwen Jiang; Teng Jiang; Xiaoyan Jiang; Xuejun Jiang; Xuejun Jiang; Ying Jiang; Yongjun Jiang; Alberto Jiménez; Cheng Jin; Hongchuan Jin; Lei Jin; Meiyan Jin; Shengkan Jin; Umesh Kumar Jinwal; Eun-Kyeong Jo; Terje Johansen; Daniel E Johnson; Gail Vw Johnson; James D Johnson; Eric Jonasch; Chris Jones; Leo Ab Joosten; Joaquin Jordan; Anna-Maria Joseph; Bertrand Joseph; Annie M Joubert; Dianwen Ju; Jingfang Ju; Hsueh-Fen Juan; Katrin Juenemann; Gábor Juhász; Hye Seung Jung; Jae U Jung; Yong-Keun Jung; Heinz Jungbluth; Matthew J Justice; Barry Jutten; Nadeem O Kaakoush; Kai Kaarniranta; Allen Kaasik; Tomohiro Kabuta; Bertrand Kaeffer; Katarina Kågedal; Alon Kahana; Shingo Kajimura; Or Kakhlon; Manjula Kalia; Dhan V Kalvakolanu; Yoshiaki Kamada; Konstantinos Kambas; Vitaliy O Kaminskyy; Harm H Kampinga; Mustapha Kandouz; Chanhee Kang; Rui Kang; Tae-Cheon Kang; Tomotake Kanki; Thirumala-Devi Kanneganti; Haruo Kanno; Anumantha G Kanthasamy; Marc Kantorow; Maria Kaparakis-Liaskos; Orsolya Kapuy; Vassiliki Karantza; Md Razaul Karim; Parimal Karmakar; Arthur Kaser; Susmita Kaushik; Thomas Kawula; A Murat Kaynar; Po-Yuan Ke; Zun-Ji Ke; John H Kehrl; Kate E Keller; Jongsook Kim Kemper; Anne K Kenworthy; Oliver Kepp; Andreas Kern; Santosh Kesari; David Kessel; Robin Ketteler; Isis do Carmo Kettelhut; Bilon Khambu; Muzamil Majid Khan; Vinoth Km Khandelwal; Sangeeta Khare; Juliann G Kiang; Amy A Kiger; Akio Kihara; Arianna L Kim; Cheol Hyeon Kim; Deok Ryong Kim; Do-Hyung Kim; Eung Kweon Kim; Hye Young Kim; Hyung-Ryong Kim; Jae-Sung Kim; Jeong Hun Kim; Jin Cheon Kim; Jin Hyoung Kim; Kwang Woon Kim; Michael D Kim; Moon-Moo Kim; Peter K Kim; Seong Who Kim; Soo-Youl Kim; Yong-Sun Kim; Yonghyun Kim; Adi Kimchi; Alec C Kimmelman; Tomonori Kimura; Jason S King; Karla Kirkegaard; Vladimir Kirkin; Lorrie A Kirshenbaum; Shuji Kishi; Yasuo Kitajima; Katsuhiko Kitamoto; Yasushi Kitaoka; Kaio Kitazato; Rudolf A Kley; Walter T Klimecki; Michael Klinkenberg; Jochen Klucken; Helene Knævelsrud; Erwin Knecht; Laura Knuppertz; Jiunn-Liang Ko; Satoru Kobayashi; Jan C Koch; Christelle Koechlin-Ramonatxo; Ulrich Koenig; Young Ho Koh; Katja Köhler; Sepp D Kohlwein; Masato Koike; Masaaki Komatsu; Eiki Kominami; Dexin Kong; Hee Jeong Kong; Eumorphia G Konstantakou; Benjamin T Kopp; Tamas Korcsmaros; Laura Korhonen; Viktor I Korolchuk; Nadya V Koshkina; Yanjun Kou; Michael I Koukourakis; Constantinos Koumenis; Attila L Kovács; Tibor Kovács; Werner J Kovacs; Daisuke Koya; Claudine Kraft; Dimitri Krainc; Helmut Kramer; Tamara Kravic-Stevovic; Wilhelm Krek; Carole Kretz-Remy; Roswitha Krick; Malathi Krishnamurthy; Janos Kriston-Vizi; Guido Kroemer; Michael C Kruer; Rejko Kruger; Nicholas T Ktistakis; Kazuyuki Kuchitsu; Christian Kuhn; Addanki Pratap Kumar; Anuj Kumar; Ashok Kumar; Deepak Kumar; Dhiraj Kumar; Rakesh Kumar; Sharad Kumar; Mondira Kundu; Hsing-Jien Kung; Atsushi Kuno; Sheng-Han Kuo; Jeff Kuret; Tino Kurz; Terry Kwok; Taeg Kyu Kwon; Yong Tae Kwon; Irene Kyrmizi; Albert R La Spada; Frank Lafont; Tim Lahm; Aparna Lakkaraju; Truong Lam; Trond Lamark; Steve Lancel; Terry H Landowski; Darius J R Lane; Jon D Lane; Cinzia Lanzi; Pierre Lapaquette; Louis R Lapierre; Jocelyn Laporte; Johanna Laukkarinen; Gordon W Laurie; Sergio Lavandero; Lena Lavie; Matthew J LaVoie; Betty Yuen Kwan Law; Helen Ka-Wai Law; Kelsey B Law; Robert Layfield; Pedro A Lazo; Laurent Le Cam; Karine G Le Roch; Hervé Le Stunff; Vijittra Leardkamolkarn; Marc Lecuit; Byung-Hoon Lee; Che-Hsin Lee; Erinna F Lee; Gyun Min Lee; He-Jin Lee; Hsinyu Lee; Jae Keun Lee; Jongdae Lee; Ju-Hyun Lee; Jun Hee Lee; Michael Lee; Myung-Shik Lee; Patty J Lee; Sam W Lee; Seung-Jae Lee; Shiow-Ju Lee; Stella Y Lee; Sug Hyung Lee; Sung Sik Lee; Sung-Joon Lee; Sunhee Lee; Ying-Ray Lee; Yong J Lee; Young H Lee; Christiaan Leeuwenburgh; Sylvain Lefort; Renaud Legouis; Jinzhi Lei; Qun-Ying Lei; David A Leib; Gil Leibowitz; Istvan Lekli; Stéphane D Lemaire; John J Lemasters; Marius K Lemberg; Antoinette Lemoine; Shuilong Leng; Guido Lenz; Paola Lenzi; Lilach O Lerman; Daniele Lettieri Barbato; Julia I-Ju Leu; Hing Y Leung; Beth Levine; Patrick A Lewis; Frank Lezoualc'h; Chi Li; Faqiang Li; Feng-Jun Li; Jun Li; Ke Li; Lian Li; Min Li; Min Li; Qiang Li; Rui Li; Sheng Li; Wei Li; Wei Li; Xiaotao Li; Yumin Li; Jiqin Lian; Chengyu Liang; Qiangrong Liang; Yulin Liao; Joana Liberal; Pawel P Liberski; Pearl Lie; Andrew P Lieberman; Hyunjung Jade Lim; Kah-Leong Lim; Kyu Lim; Raquel T Lima; Chang-Shen Lin; Chiou-Feng Lin; Fang Lin; Fangming Lin; Fu-Cheng Lin; Kui Lin; Kwang-Huei Lin; Pei-Hui Lin; Tianwei Lin; Wan-Wan Lin; Yee-Shin Lin; Yong Lin; Rafael Linden; Dan Lindholm; Lisa M Lindqvist; Paul Lingor; Andreas Linkermann; Lance A Liotta; Marta M Lipinski; Vitor A Lira; Michael P Lisanti; Paloma B Liton; Bo Liu; Chong Liu; Chun-Feng Liu; Fei Liu; Hung-Jen Liu; Jianxun Liu; Jing-Jing Liu; Jing-Lan Liu; Ke Liu; Leyuan Liu; Liang Liu; Quentin Liu; Rong-Yu Liu; Shiming Liu; Shuwen Liu; Wei Liu; Xian-De Liu; Xiangguo Liu; Xiao-Hong Liu; Xinfeng Liu; Xu Liu; Xueqin Liu; Yang Liu; Yule Liu; Zexian Liu; Zhe Liu; Juan P Liuzzi; Gérard Lizard; Mila Ljujic; Irfan J Lodhi; Susan E Logue; Bal L Lokeshwar; Yun Chau Long; Sagar Lonial; Benjamin Loos; Carlos López-Otín; Cristina López-Vicario; Mar Lorente; Philip L Lorenzi; Péter Lõrincz; Marek Los; Michael T Lotze; Penny E Lovat; Binfeng Lu; Bo Lu; Jiahong Lu; Qing Lu; She-Min Lu; Shuyan Lu; Yingying Lu; Frédéric Luciano; Shirley Luckhart; John Milton Lucocq; Paula Ludovico; Aurelia Lugea; Nicholas W Lukacs; Julian J Lum; Anders H Lund; Honglin Luo; Jia Luo; Shouqing Luo; Claudio Luparello; Timothy Lyons; Jianjie Ma; Yi Ma; Yong Ma; Zhenyi Ma; Juliano Machado; Glaucia M Machado-Santelli; Fernando Macian; Gustavo C MacIntosh; Jeffrey P MacKeigan; Kay F Macleod; John D MacMicking; Lee Ann MacMillan-Crow; Frank Madeo; Muniswamy Madesh; Julio Madrigal-Matute; Akiko Maeda; Tatsuya Maeda; Gustavo Maegawa; Emilia Maellaro; Hannelore Maes; Marta Magariños; Kenneth Maiese; Tapas K Maiti; Luigi Maiuri; Maria Chiara Maiuri; Carl G Maki; Roland Malli; Walter Malorni; Alina Maloyan; Fathia Mami-Chouaib; Na Man; Joseph D Mancias; Eva-Maria Mandelkow; Michael A Mandell; Angelo A Manfredi; Serge N Manié; Claudia Manzoni; Kai Mao; Zixu Mao; Zong-Wan Mao; Philippe Marambaud; Anna Maria Marconi; Zvonimir Marelja; Gabriella Marfe; Marta Margeta; Eva Margittai; Muriel Mari; Francesca V Mariani; Concepcio Marin; Sara Marinelli; Guillermo Mariño; Ivanka Markovic; Rebecca Marquez; Alberto M Martelli; Sascha Martens; Katie R Martin; Seamus J Martin; Shaun Martin; Miguel A Martin-Acebes; Paloma Martín-Sanz; Camille Martinand-Mari; Wim Martinet; Jennifer Martinez; Nuria Martinez-Lopez; Ubaldo Martinez-Outschoorn; Moisés Martínez-Velázquez; Marta Martinez-Vicente; Waleska Kerllen Martins; Hirosato Mashima; James A Mastrianni; Giuseppe Matarese; Paola Matarrese; Roberto Mateo; Satoaki Matoba; Naomichi Matsumoto; Takehiko Matsushita; Akira Matsuura; Takeshi Matsuzawa; Mark P Mattson; Soledad Matus; Norma Maugeri; Caroline Mauvezin; Andreas Mayer; Dusica Maysinger; Guillermo D Mazzolini; Mary Kate McBrayer; Kimberly McCall; Craig McCormick; Gerald M McInerney; Skye C McIver; Sharon McKenna; John J McMahon; Iain A McNeish; Fatima Mechta-Grigoriou; Jan Paul Medema; Diego L Medina; Klara Megyeri; Maryam Mehrpour; Jawahar L Mehta; Yide Mei; Ute-Christiane Meier; Alfred J Meijer; Alicia Meléndez; Gerry Melino; Sonia Melino; Edesio Jose Tenorio de Melo; Maria A Mena; Marc D Meneghini; Javier A Menendez; Regina Menezes; Liesu Meng; Ling-Hua Meng; Songshu Meng; Rossella Menghini; A Sue Menko; Rubem Fs Menna-Barreto; Manoj B Menon; Marco A Meraz-Ríos; Giuseppe Merla; Luciano Merlini; Angelica M Merlot; Andreas Meryk; Stefania Meschini; Joel N Meyer; Man-Tian Mi; Chao-Yu Miao; Lucia Micale; Simon Michaeli; Carine Michiels; Anna Rita Migliaccio; Anastasia Susie Mihailidou; Dalibor Mijaljica; Katsuhiko Mikoshiba; Enrico Milan; Leonor Miller-Fleming; Gordon B Mills; Ian G Mills; Georgia Minakaki; Berge A Minassian; Xiu-Fen Ming; Farida Minibayeva; Elena A Minina; Justine D Mintern; Saverio Minucci; Antonio Miranda-Vizuete; Claire H Mitchell; Shigeki Miyamoto; Keisuke Miyazawa; Noboru Mizushima; Katarzyna Mnich; Baharia Mograbi; Simin Mohseni; Luis Ferreira Moita; Marco Molinari; Maurizio Molinari; Andreas Buch Møller; Bertrand Mollereau; Faustino Mollinedo; Marco Mongillo; Martha M Monick; Serena Montagnaro; Craig Montell; Darren J Moore; Michael N Moore; Rodrigo Mora-Rodriguez; Paula I Moreira; Etienne Morel; Maria Beatrice Morelli; Sandra Moreno; Michael J Morgan; Arnaud Moris; Yuji Moriyasu; Janna L Morrison; Lynda A Morrison; Eugenia Morselli; Jorge Moscat; Pope L Moseley; Serge Mostowy; Elisa Motori; Denis Mottet; Jeremy C Mottram; Charbel E-H Moussa; Vassiliki E Mpakou; Hasan Mukhtar; Jean M Mulcahy Levy; Sylviane Muller; Raquel Muñoz-Moreno; Cristina Muñoz-Pinedo; Christian Münz; Maureen E Murphy; James T Murray; Aditya Murthy; Indira U Mysorekar; Ivan R Nabi; Massimo Nabissi; Gustavo A Nader; Yukitoshi Nagahara; Yoshitaka Nagai; Kazuhiro Nagata; Anika Nagelkerke; Péter Nagy; Samisubbu R Naidu; Sreejayan Nair; Hiroyasu Nakano; Hitoshi Nakatogawa; Meera Nanjundan; Gennaro Napolitano; Naweed I Naqvi; Roberta Nardacci; Derek P Narendra; Masashi Narita; Anna Chiara Nascimbeni; Ramesh Natarajan; Luiz C Navegantes; Steffan T Nawrocki; Taras Y Nazarko; Volodymyr Y Nazarko; Thomas Neill; Luca M Neri; Mihai G Netea; Romana T Netea-Maier; Bruno M Neves; Paul A Ney; Ioannis P Nezis; Hang Tt Nguyen; Huu Phuc Nguyen; Anne-Sophie Nicot; Hilde Nilsen; Per Nilsson; Mikio Nishimura; Ichizo Nishino; Mireia Niso-Santano; Hua Niu; Ralph A Nixon; Vincent Co Njar; Takeshi Noda; Angelika A Noegel; Elsie Magdalena Nolte; Erik Norberg; Koenraad K Norga; Sakineh Kazemi Noureini; Shoji Notomi; Lucia Notterpek; Karin Nowikovsky; Nobuyuki Nukina; Thorsten Nürnberger; Valerie B O'Donnell; Tracey O'Donovan; Peter J O'Dwyer; Ina Oehme; Clara L Oeste; Michinaga Ogawa; Besim Ogretmen; Yuji Ogura; Young J Oh; Masaki Ohmuraya; Takayuki Ohshima; Rani Ojha; Koji Okamoto; Toshiro Okazaki; F Javier Oliver; Karin Ollinger; Stefan Olsson; Daniel P Orban; Paulina Ordonez; Idil Orhon; Laszlo Orosz; Eyleen J O'Rourke; Helena Orozco; Angel L Ortega; Elena Ortona; Laura D Osellame; Junko Oshima; Shigeru Oshima; Heinz D Osiewacz; Takanobu Otomo; Kinya Otsu; Jing-Hsiung James Ou; Tiago F Outeiro; Dong-Yun Ouyang; Hongjiao Ouyang; Michael Overholtzer; Michelle A Ozbun; P Hande Ozdinler; Bulent Ozpolat; Consiglia Pacelli; Paolo Paganetti; Guylène Page; Gilles Pages; Ugo Pagnini; Beata Pajak; Stephen C Pak; Karolina Pakos-Zebrucka; Nazzy Pakpour; Zdena Palková; Francesca Palladino; Kathrin Pallauf; Nicolas Pallet; Marta Palmieri; Søren R Paludan; Camilla Palumbo; Silvia Palumbo; Olatz Pampliega; Hongming Pan; Wei Pan; Theocharis Panaretakis; Aseem Pandey; Areti Pantazopoulou; Zuzana Papackova; Daniela L Papademetrio; Issidora Papassideri; Alessio Papini; Nirmala Parajuli; Julian Pardo; Vrajesh V Parekh; Giancarlo Parenti; Jong-In Park; Junsoo Park; Ohkmae K Park; Roy Parker; Rosanna Parlato; Jan B Parys; Katherine R Parzych; Jean-Max Pasquet; Benoit Pasquier; Kishore Bs Pasumarthi; Daniel Patschan; Cam Patterson; Sophie Pattingre; Scott Pattison; Arnim Pause; Hermann Pavenstädt; Flaminia Pavone; Zully Pedrozo; Fernando J Peña; Miguel A Peñalva; Mario Pende; Jianxin Peng; Fabio Penna; Josef M Penninger; Anna Pensalfini; Salvatore Pepe; Gustavo Js Pereira; Paulo C Pereira; Verónica Pérez-de la Cruz; María Esther Pérez-Pérez; Diego Pérez-Rodríguez; Dolores Pérez-Sala; Celine Perier; Andras Perl; David H Perlmutter; Ida Perrotta; Shazib Pervaiz; Maija Pesonen; Jeffrey E Pessin; Godefridus J Peters; Morten Petersen; Irina Petrache; Basil J Petrof; Goran Petrovski; James M Phang; Mauro Piacentini; Marina Pierdominici; Philippe Pierre; Valérie Pierrefite-Carle; Federico Pietrocola; Felipe X Pimentel-Muiños; Mario Pinar; Benjamin Pineda; Ronit Pinkas-Kramarski; Marcello Pinti; Paolo Pinton; Bilal Piperdi; James M Piret; Leonidas C Platanias; Harald W Platta; Edward D Plowey; Stefanie Pöggeler; Marc Poirot; Peter Polčic; Angelo Poletti; Audrey H Poon; Hana Popelka; Blagovesta Popova; Izabela Poprawa; Shibu M Poulose; Joanna Poulton; Scott K Powers; Ted Powers; Mercedes Pozuelo-Rubio; Krisna Prak; Reinhild Prange; Mark Prescott; Muriel Priault; Sharon Prince; Richard L Proia; Tassula Proikas-Cezanne; Holger Prokisch; Vasilis J Promponas; Karin Przyklenk; Rosa Puertollano; Subbiah Pugazhenthi; Luigi Puglielli; Aurora Pujol; Julien Puyal; Dohun Pyeon; Xin Qi; Wen-Bin Qian; Zheng-Hong Qin; Yu Qiu; Ziwei Qu; Joe Quadrilatero; Frederick Quinn; Nina Raben; Hannah Rabinowich; Flavia Radogna; Michael J Ragusa; Mohamed Rahmani; Komal Raina; Sasanka Ramanadham; Rajagopal Ramesh; Abdelhaq Rami; Sarron Randall-Demllo; Felix Randow; Hai Rao; V Ashutosh Rao; Blake B Rasmussen; Tobias M Rasse; Edward A Ratovitski; Pierre-Emmanuel Rautou; Swapan K Ray; Babak Razani; Bruce H Reed; Fulvio Reggiori; Markus Rehm; Andreas S Reichert; Theo Rein; David J Reiner; Eric Reits; Jun Ren; Xingcong Ren; Maurizio Renna; Jane Eb Reusch; Jose L Revuelta; Leticia Reyes; Alireza R Rezaie; Robert I Richards; Des R Richardson; Clémence Richetta; Michael A Riehle; Bertrand H Rihn; Yasuko Rikihisa; Brigit E Riley; Gerald Rimbach; Maria Rita Rippo; Konstantinos Ritis; Federica Rizzi; Elizete Rizzo; Peter J Roach; Jeffrey Robbins; Michel Roberge; Gabriela Roca; Maria Carmela Roccheri; Sonia Rocha; Cecilia Mp Rodrigues; Clara I Rodríguez; Santiago Rodriguez de Cordoba; Natalia Rodriguez-Muela; Jeroen Roelofs; Vladimir V Rogov; Troy T Rohn; Bärbel Rohrer; Davide Romanelli; Luigina Romani; Patricia Silvia Romano; M Isabel G Roncero; Jose Luis Rosa; Alicia Rosello; Kirill V Rosen; Philip Rosenstiel; Magdalena Rost-Roszkowska; Kevin A Roth; Gael Roué; Mustapha Rouis; Kasper M Rouschop; Daniel T Ruan; Diego Ruano; David C Rubinsztein; Edmund B Rucker; Assaf Rudich; Emil Rudolf; Ruediger Rudolf; Markus A Ruegg; Carmen Ruiz-Roldan; Avnika Ashok Ruparelia; Paola Rusmini; David W Russ; Gian Luigi Russo; Giuseppe Russo; Rossella Russo; Tor Erik Rusten; Victoria Ryabovol; Kevin M Ryan; Stefan W Ryter; David M Sabatini; Michael Sacher; Carsten Sachse; Michael N Sack; Junichi Sadoshima; Paul Saftig; Ronit Sagi-Eisenberg; Sumit Sahni; Pothana Saikumar; Tsunenori Saito; Tatsuya Saitoh; Koichi Sakakura; Machiko Sakoh-Nakatogawa; Yasuhito Sakuraba; María Salazar-Roa; Paolo Salomoni; Ashok K Saluja; Paul M Salvaterra; Rosa Salvioli; Afshin Samali; Anthony Mj Sanchez; José A Sánchez-Alcázar; Ricardo Sanchez-Prieto; Marco Sandri; Miguel A Sanjuan; Stefano Santaguida; Laura Santambrogio; Giorgio Santoni; Claudia Nunes Dos Santos; Shweta Saran; Marco Sardiello; Graeme Sargent; Pallabi Sarkar; Sovan Sarkar; Maria Rosa Sarrias; Minnie M Sarwal; Chihiro Sasakawa; Motoko Sasaki; Miklos Sass; Ken Sato; Miyuki Sato; Joseph Satriano; Niramol Savaraj; Svetlana Saveljeva; Liliana Schaefer; Ulrich E Schaible; Michael Scharl; Hermann M Schatzl; Randy Schekman; Wiep Scheper; Alfonso Schiavi; Hyman M Schipper; Hana Schmeisser; Jens Schmidt; Ingo Schmitz; Bianca E Schneider; E Marion Schneider; Jaime L Schneider; Eric A Schon; Miriam J Schönenberger; Axel H Schönthal; Daniel F Schorderet; Bernd Schröder; Sebastian Schuck; Ryan J Schulze; Melanie Schwarten; Thomas L Schwarz; Sebastiano Sciarretta; Kathleen Scotto; A Ivana Scovassi; Robert A Screaton; Mark Screen; Hugo Seca; Simon Sedej; Laura Segatori; Nava Segev; Per O Seglen; Jose M Seguí-Simarro; Juan Segura-Aguilar; Ekihiro Seki; Christian Sell; Iban Seiliez; Clay F Semenkovich; Gregg L Semenza; Utpal Sen; Andreas L Serra; Ana Serrano-Puebla; Hiromi Sesaki; Takao Setoguchi; Carmine Settembre; John J Shacka; Ayesha N Shajahan-Haq; Irving M Shapiro; Shweta Sharma; Hua She; C-K James Shen; Chiung-Chyi Shen; Han-Ming Shen; Sanbing Shen; Weili Shen; Rui Sheng; Xianyong Sheng; Zu-Hang Sheng; Trevor G Shepherd; Junyan Shi; Qiang Shi; Qinghua Shi; Yuguang Shi; Shusaku Shibutani; Kenichi Shibuya; Yoshihiro Shidoji; Jeng-Jer Shieh; Chwen-Ming Shih; Yohta Shimada; Shigeomi Shimizu; Dong Wook Shin; Mari L Shinohara; Michiko Shintani; Takahiro Shintani; Tetsuo Shioi; Ken Shirabe; Ronit Shiri-Sverdlov; Orian Shirihai; Gordon C Shore; Chih-Wen Shu; Deepak Shukla; Andriy A Sibirny; Valentina Sica; Christina J Sigurdson; Einar M Sigurdsson; Puran Singh Sijwali; Beata Sikorska; Wilian A Silveira; Sandrine Silvente-Poirot; Gary A Silverman; Jan Simak; Thomas Simmet; Anna Katharina Simon; Hans-Uwe Simon; Cristiano Simone; Matias Simons; Anne Simonsen; Rajat Singh; Shivendra V Singh; Shrawan K Singh; Debasish Sinha; Sangita Sinha; Frank A Sinicrope; Agnieszka Sirko; Kapil Sirohi; Balindiwe Jn Sishi; Annie Sittler; Parco M Siu; Efthimios Sivridis; Anna Skwarska; Ruth Slack; Iva Slaninová; Nikolai Slavov; Soraya S Smaili; Keiran Sm Smalley; Duncan R Smith; Stefaan J Soenen; Scott A Soleimanpour; Anita Solhaug; Kumaravel Somasundaram; Jin H Son; Avinash Sonawane; Chunjuan Song; Fuyong Song; Hyun Kyu Song; Ju-Xian Song; Wei Song; Kai Y Soo; Anil K Sood; Tuck Wah Soong; Virawudh Soontornniyomkij; Maurizio Sorice; Federica Sotgia; David R Soto-Pantoja; Areechun Sotthibundhu; Maria João Sousa; Herman P Spaink; Paul N Span; Anne Spang; Janet D Sparks; Peter G Speck; Stephen A Spector; Claudia D Spies; Wolfdieter Springer; Daret St Clair; Alessandra Stacchiotti; Bart Staels; Michael T Stang; Daniel T Starczynowski; Petro Starokadomskyy; Clemens Steegborn; John W Steele; Leonidas Stefanis; Joan Steffan; Christine M Stellrecht; Harald Stenmark; Tomasz M Stepkowski; Stęphan T Stern; Craig Stevens; Brent R Stockwell; Veronika Stoka; Zuzana Storchova; Björn Stork; Vassilis Stratoulias; Dimitrios J Stravopodis; Pavel Strnad; Anne Marie Strohecker; Anna-Lena Ström; Per Stromhaug; Jiri Stulik; Yu-Xiong Su; Zhaoliang Su; Carlos S Subauste; Srinivasa Subramaniam; Carolyn M Sue; Sang Won Suh; Xinbing Sui; Supawadee Sukseree; David Sulzer; Fang-Lin Sun; Jiaren Sun; Jun Sun; Shi-Yong Sun; Yang Sun; Yi Sun; Yingjie Sun; Vinod Sundaramoorthy; Joseph Sung; Hidekazu Suzuki; Kuninori Suzuki; Naoki Suzuki; Tadashi Suzuki; Yuichiro J Suzuki; Michele S Swanson; Charles Swanton; Karl Swärd; Ghanshyam Swarup; Sean T Sweeney; Paul W Sylvester; Zsuzsanna Szatmari; Eva Szegezdi; Peter W Szlosarek; Heinrich Taegtmeyer; Marco Tafani; Emmanuel Taillebourg; Stephen Wg Tait; Krisztina Takacs-Vellai; Yoshinori Takahashi; Szabolcs Takáts; Genzou Takemura; Nagio Takigawa; Nicholas J Talbot; Elena Tamagno; Jerome Tamburini; Cai-Ping Tan; Lan Tan; Mei Lan Tan; Ming Tan; Yee-Joo Tan; Keiji Tanaka; Masaki Tanaka; Daolin Tang; Dingzhong Tang; Guomei Tang; Isei Tanida; Kunikazu Tanji; Bakhos A Tannous; Jose A Tapia; Inmaculada Tasset-Cuevas; Marc Tatar; Iman Tavassoly; Nektarios Tavernarakis; Allen Taylor; Graham S Taylor; Gregory A Taylor; J Paul Taylor; Mark J Taylor; Elena V Tchetina; Andrew R Tee; Fatima Teixeira-Clerc; Sucheta Telang; Tewin Tencomnao; Ba-Bie Teng; Ru-Jeng Teng; Faraj Terro; Gianluca Tettamanti; Arianne L Theiss; Anne E Theron; Kelly Jean Thomas; Marcos P Thomé; Paul G Thomes; Andrew Thorburn; Jeremy Thorner; Thomas Thum; Michael Thumm; Teresa Lm Thurston; Ling Tian; Andreas Till; Jenny Pan-Yun Ting; Vladimir I Titorenko; Lilach Toker; Stefano Toldo; Sharon A Tooze; Ivan Topisirovic; Maria Lyngaas Torgersen; Liliana Torosantucci; Alicia Torriglia; Maria Rosaria Torrisi; Cathy Tournier; Roberto Towns; Vladimir Trajkovic; Leonardo H Travassos; Gemma Triola; Durga Nand Tripathi; Daniela Trisciuoglio; Rodrigo Troncoso; Ioannis P Trougakos; Anita C Truttmann; Kuen-Jer Tsai; Mario P Tschan; Yi-Hsin Tseng; Takayuki Tsukuba; Allan Tsung; Andrey S Tsvetkov; Shuiping Tu; Hsing-Yu Tuan; Marco Tucci; David A Tumbarello; Boris Turk; Vito Turk; Robin Fb Turner; Anders A Tveita; Suresh C Tyagi; Makoto Ubukata; Yasuo Uchiyama; Andrej Udelnow; Takashi Ueno; Midori Umekawa; Rika Umemiya-Shirafuji; Benjamin R Underwood; Christian Ungermann; Rodrigo P Ureshino; Ryo Ushioda; Vladimir N Uversky; Néstor L Uzcátegui; Thomas Vaccari; Maria I Vaccaro; Libuše Váchová; Helin Vakifahmetoglu-Norberg; Rut Valdor; Enza Maria Valente; Francois Vallette; Angela M Valverde; Greet Van den Berghe; Ludo Van Den Bosch; Gijs R van den Brink; F Gisou van der Goot; Ida J van der Klei; Luc Jw van der Laan; Wouter G van Doorn; Marjolein van Egmond; Kenneth L van Golen; Luc Van Kaer; Menno van Lookeren Campagne; Peter Vandenabeele; Wim Vandenberghe; Ilse Vanhorebeek; Isabel Varela-Nieto; M Helena Vasconcelos; Radovan Vasko; Demetrios G Vavvas; Ignacio Vega-Naredo; Guillermo Velasco; Athanassios D Velentzas; Panagiotis D Velentzas; Tibor Vellai; Edo Vellenga; Mikkel Holm Vendelbo; Kartik Venkatachalam; Natascia Ventura; Salvador Ventura; Patrícia St Veras; Mireille Verdier; Beata G Vertessy; Andrea Viale; Michel Vidal; Helena L A Vieira; Richard D Vierstra; Nadarajah Vigneswaran; Neeraj Vij; Miquel Vila; Margarita Villar; Victor H Villar; Joan Villarroya; Cécile Vindis; Giampietro Viola; Maria Teresa Viscomi; Giovanni Vitale; Dan T Vogl; Olga V Voitsekhovskaja; Clarissa von Haefen; Karin von Schwarzenberg; Daniel E Voth; Valérie Vouret-Craviari; Kristina Vuori; Jatin M Vyas; Christian Waeber; Cheryl Lyn Walker; Mark J Walker; Jochen Walter; Lei Wan; Xiangbo Wan; Bo Wang; Caihong Wang; Chao-Yung Wang; Chengshu Wang; Chenran Wang; Chuangui Wang; Dong Wang; Fen Wang; Fuxin Wang; Guanghui Wang; Hai-Jie Wang; Haichao Wang; Hong-Gang Wang; Hongmin Wang; Horng-Dar Wang; Jing Wang; Junjun Wang; Mei Wang; Mei-Qing Wang; Pei-Yu Wang; Peng Wang; Richard C Wang; Shuo Wang; Ting-Fang Wang; Xian Wang; Xiao-Jia Wang; Xiao-Wei Wang; Xin Wang; Xuejun Wang; Yan Wang; Yanming Wang; Ying Wang; Ying-Jan Wang; Yipeng Wang; Yu Wang; Yu Tian Wang; Yuqing Wang; Zhi-Nong Wang; Pablo Wappner; Carl Ward; Diane McVey Ward; Gary Warnes; Hirotaka Watada; Yoshihisa Watanabe; Kei Watase; Timothy E Weaver; Colin D Weekes; Jiwu Wei; Thomas Weide; Conrad C Weihl; Günther Weindl; Simone Nardin Weis; Longping Wen; Xin Wen; Yunfei Wen; Benedikt Westermann; Cornelia M Weyand; Anthony R White; Eileen White; J Lindsay Whitton; Alexander J Whitworth; Joëlle Wiels; Franziska Wild; Manon E Wildenberg; Tom Wileman; Deepti Srinivas Wilkinson; Simon Wilkinson; Dieter Willbold; Chris Williams; Katherine Williams; Peter R Williamson; Konstanze F Winklhofer; Steven S Witkin; Stephanie E Wohlgemuth; Thomas Wollert; Ernst J Wolvetang; Esther Wong; G William Wong; Richard W Wong; Vincent Kam Wai Wong; Elizabeth A Woodcock; Karen L Wright; Chunlai Wu; Defeng Wu; Gen Sheng Wu; Jian Wu; Junfang Wu; Mian Wu; Min Wu; Shengzhou Wu; William Kk Wu; Yaohua Wu; Zhenlong Wu; Cristina Pr Xavier; Ramnik J Xavier; Gui-Xian Xia; Tian Xia; Weiliang Xia; Yong Xia; Hengyi Xiao; Jian Xiao; Shi Xiao; Wuhan Xiao; Chuan-Ming Xie; Zhiping Xie; Zhonglin Xie; Maria Xilouri; Yuyan Xiong; Chuanshan Xu; Congfeng Xu; Feng Xu; Haoxing Xu; Hongwei Xu; Jian Xu; Jianzhen Xu; Jinxian Xu; Liang Xu; Xiaolei Xu; Yangqing Xu; Ye Xu; Zhi-Xiang Xu; Ziheng Xu; Yu Xue; Takahiro Yamada; Ai Yamamoto; Koji Yamanaka; Shunhei Yamashina; Shigeko Yamashiro; Bing Yan; Bo Yan; Xianghua Yan; Zhen Yan; Yasuo Yanagi; Dun-Sheng Yang; Jin-Ming Yang; Liu Yang; Minghua Yang; Pei-Ming Yang; Peixin Yang; Qian Yang; Wannian Yang; Wei Yuan Yang; Xuesong Yang; Yi Yang; Ying Yang; Zhifen Yang; Zhihong Yang; Meng-Chao Yao; Pamela J Yao; Xiaofeng Yao; Zhenyu Yao; Zhiyuan Yao; Linda S Yasui; Mingxiang Ye; Barry Yedvobnick; Behzad Yeganeh; Elizabeth S Yeh; Patricia L Yeyati; Fan Yi; Long Yi; Xiao-Ming Yin; Calvin K Yip; Yeong-Min Yoo; Young Hyun Yoo; Seung-Yong Yoon; Ken-Ichi Yoshida; Tamotsu Yoshimori; Ken H Young; Huixin Yu; Jane J Yu; Jin-Tai Yu; Jun Yu; Li Yu; W Haung Yu; Xiao-Fang Yu; Zhengping Yu; Junying Yuan; Zhi-Min Yuan; Beatrice Yjt Yue; Jianbo Yue; Zhenyu Yue; David N Zacks; Eldad Zacksenhaus; Nadia Zaffaroni; Tania Zaglia; Zahra Zakeri; Vincent Zecchini; Jinsheng Zeng; Min Zeng; Qi Zeng; Antonis S Zervos; Donna D Zhang; Fan Zhang; Guo Zhang; Guo-Chang Zhang; Hao Zhang; Hong Zhang; Hong Zhang; Hongbing Zhang; Jian Zhang; Jian Zhang; Jiangwei Zhang; Jianhua Zhang; Jing-Pu Zhang; Li Zhang; Lin Zhang; Lin Zhang; Long Zhang; Ming-Yong Zhang; Xiangnan Zhang; Xu Dong Zhang; Yan Zhang; Yang Zhang; Yanjin Zhang; Yingmei Zhang; Yunjiao Zhang; Mei Zhao; Wei-Li Zhao; Xiaonan Zhao; Yan G Zhao; Ying Zhao; Yongchao Zhao; Yu-Xia Zhao; Zhendong Zhao; Zhizhuang J Zhao; Dexian Zheng; Xi-Long Zheng; Xiaoxiang Zheng; Boris Zhivotovsky; Qing Zhong; Guang-Zhou Zhou; Guofei Zhou; Huiping Zhou; Shu-Feng Zhou; Xu-Jie Zhou; Hongxin Zhu; Hua Zhu; Wei-Guo Zhu; Wenhua Zhu; Xiao-Feng Zhu; Yuhua Zhu; Shi-Mei Zhuang; Xiaohong Zhuang; Elio Ziparo; Christos E Zois; Teresa Zoladek; Wei-Xing Zong; Antonio Zorzano; Susu M Zughaier
Journal:  Autophagy       Date:  2016       Impact factor: 16.016

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.