Literature DB >> 25398139

Fine mapping and candidate gene search of quantitative trait loci for growth and obesity using mouse intersubspecific subcongenic intercrosses and exome sequencing.

Akira Ishikawa1, Sin-ichiro Okuno1.   

Abstract

Although growth and body composition traits are quantitative traits of medical and agricultural importance, the genetic and molecular basis of those traits remains elusive. Our previous genome-wide quantitative trait locus (QTL) analyses in an intersubspecific backcross population between C57BL/6JJcl (B6) and wild Mus musculus castaneus mice revealed a major growth QTL (named Pbwg1) on a proximal region of mouse chromosome 2. Using the B6.Cg-Pbwg1 intersubspecific congenic strain created, we revealed 12 closely linked QTLs for body weight and body composition traits on an approximately 44.1-Mb wild-derived congenic region. In this study, we narrowed down genomic regions harboring three (Pbwg1.12, Pbwg1.3 and Pbwg1.5) of the 12 linked QTLs and searched for possible candidate genes for the QTLs. By phenotypic analyses of F2 intercross populations between B6 and each of four B6.Cg-Pbwg1 subcongenic strains with overlapping and non-overlapping introgressed regions, we physically defined Pbwg1.12 affecting body weight to a 3.8-Mb interval (61.5-65.3 Mb) on chromosome 2. We fine-mapped Pbwg1.3 for body length to an 8.0-Mb interval (57.3-65.3) and Pbwg1.5 for abdominal white fat weight to a 2.1-Mb interval (59.4-61.5). The wild-derived allele at Pbwg1.12 and Pbwg1.3 uniquely increased body weight and length despite the fact that the wild mouse has a smaller body size than that of B6, whereas it decreased fat weight at Pbwg1.5. Exome sequencing and candidate gene prioritization suggested that Gcg and Grb14 are putative candidate genes for Pbwg1.12 and that Ly75 and Itgb6 are putative candidate genes for Pbwg1.5. These genes had nonsynonymous SNPs, but the SNPs were predicted to be not harmful to protein functions. These results provide information helpful to identify wild-derived quantitative trait genes causing enhanced growth and resistance to obesity.

Entities:  

Mesh:

Substances:

Year:  2014        PMID: 25398139      PMCID: PMC4232600          DOI: 10.1371/journal.pone.0113233

Source DB:  PubMed          Journal:  PLoS One        ISSN: 1932-6203            Impact factor:   3.240


Introduction

Body weight and body composition traits, including fat and organ weight, are quantitative in nature and are controlled by multiple genetic loci, referred to as QTLs (quantitative trait loci), environmental factors and their interactions. They are important economic traits in livestock [1]. For example, modern broiler chickens have been intensively selected for rapid growth rate, but they display excessive deposition of body fat. Since fat is a by-product of little economic value and often causes a decrease in feed efficiency, it is now an important selection criterion in chicken breeding programs [2]. In humans, obesity is characterized by excessive abdominal fat deposition and is now a main health concern worldwide because it is a predisposing factor of complex metabolic diseases such as type-2 diabetes and cardiovascular diseases [3]. The laboratory mouse has been long and widely used as the premier model animal for elucidating the genetic and molecular basis of these traits and other quantitative traits in livestock and humans because of its small body size, cost-effective rearing, easy development of genetically engineered mice (e.g., knockouts and transgenics) and large amount of genomic information that is freely available [1], [4]. Thousands of QTLs affecting various quantitative traits have been mapped to many chromosomal regions of the mouse and have been deposited in the Mouse Genome Database (MGD, release 5.19, August 2014) [5]. However, the genetic and molecular basis of quantitative traits remains elusive because it is not an easy task to pinpoint causative genes underlying QTLs, particularly for QTLs with small phenotypic effects on the traits. Most of the QTLs have small effects and only a few loci have moderate to large effects [4]. In mice, initial genome-wide QTL analysis is usually performed with a backcross or F2 intercross population between two inbred strains and it provides a large confidence interval (10–50 cM) for a mapped QTL [6], where hundreds or thousands of genes are possibly located. Next, to reduce the confidence interval of the QTL to a level amenable to positional cloning, fine mapping is performed using a congenic mouse strain and subsequently developed subcongenic strains [7]. Then phenotypic values are compared between homozygous congenic/subcongenic strains and the background strain and/or among homozygous congenic/subcongenic strains with overlapping and non-overlapping introgressed regions. Often, the phenotypic effect of the QTL fails to be confirmed, illustrating the difficulty of identifying a causative gene for the QTL. If the QTL successfully is fine-mapped to a small region, the road from a QTL to a causative gene is still long [8]. In the present study, to overcome the problem of frequent failure in traditional congenic/subcongenic analyses, we used several F2 populations obtained from intercrosses between each of the subcongenic strains and the background strain. In each of the F2 populations, three possible diplotypes for the introgressed region are segregating: two are homozygous for either haplotype derived from the donor mouse or from the background mouse and the other is heterozygous for both haplotypes. Hence, using the F2 mice can randomize environmental effects such as litter size and effects of contaminating donor and recipient alleles on unwanted small regions, both of which are produced by double recombination during recurrent backcrossing for development of subcongenic strains, as previously documented [9], [10]. Moreover, the F2 mice produced have genetically identical F1 dams and F1 sires. That is, the F1 mice are heterozygotes for all loci on the introgressed region. Hence, using the F2 mice can minimize genomic imprinting effects of alleles inherited from either F1 dams or F1 sires [11] and maternal genetic effects exerted from the F1 dams [12] and epigenetic effects such as histone modification [13]–[15] exerted from either or both F1 parents. Probably, some of these effects result in the missing QTL effect seen in traditional congenic/subcongenic analyses. We previously discovered many QTLs for postnatal body weight and growth from an untapped resource of wild M. m. castaneus mice captured live in the Philippines, by genome-wide QTL analyses in an intersubspecific backcross population between C57BL/6JJcl (B6) inbred mice and the wild castaneus mice [16]–[18]. We further created the B6.Cg-Pbwg1 congenic strain on the B6 genetic background with an approximately 44.1-Mb wild-derived genomic region between D2Mit33 and D2Mit38 microsatellite markers, on which Pbwg1, a prominent growth QTL on a proximal region of mouse chromosome 2, is located. We developed more than 20 subcongenic strains derived from B6.Cg-Pbwg1. By phenotypic analysis of the F2 intercross between B6.Cg-Pbwg1 and B6 strains and by congenic/subcongenic analyses, we revealed 12 closely linked QTLs for body weight and body composition traits within the 44.1-Mb congenic region. These linked QTLs explained a small fraction of phenotypic variances [9], [19]–[22]. Among the linked loci, several have unique QTL effects and are located on the distal half of the congenic region. For example, the wild-derived allele at Pbwg1.12 and Pbwg1.3 QTLs increases body weight and total body length, respectively, despite the fact that wild mice have a smaller body size than that of B6 [19], [9]. In contrast, the allele at the Pbwg1.5 QTL decreases abdominal white fat weight [19] and prevents obesity in mice fed both standard and high-fat diets [21]. In this study, we fine-mapped the three unique QTLs (Pbwg1.12, Pbwg1.3 and Pbwg1.5) mentioned above by phenotypic analysis of F2 mice obtained from intersubspecific subcongenic intercrosses. To search for possible candidate genes of the QTLs, we performed exome sequencing of genes on the congenic region and also prioritized candidate genes using bioinformatics analysis. Sequence data are not available for our wild M. m. castaneus mice captured in the Philippines, in contrast to the CAST/Eij inbred strain derived from wild M. m. castaneus mice trapped in Thailand, for which the whole genome has been already sequenced [23].

Materials and Methods

Ethics Statement

This study was carried out in accordance with the guidelines for the care and use of laboratory animals of the Graduate School of Bioagricultural Sciences, Nagoya University, Japan. The protocol was approved by the Animal Research Committee of Nagoya University.

Animals

The B6.Cg-Pbwg1 congenic strain was previously constructed [19]. Many subcongenic strains, named B6.Cg-Pbwg1/#Nga (old name: B6.Cg-Pbwg1/SR#, called SR# hereafter), were previously developed from descendants of B6.Cg-Pbwg1 [9]. Previously developed SR1, SR3 and SR12 subcongenic strains and a newly developed SR21 subcongenic strain were used in this study (Figure 1). The background C57BL/6JJcl (B6) mice were purchased from Clea Japan (Tokyo, Japan). To develop four F2 segregating populations, males of each subcongenic strain were crossed with B6 females to generate F1 mice. The F1 mice obtained were mated inter se. In total, the following F2 individuals were produced: 273 (138 males and 135 females) for B6×SR1, 236 (113 males and 123 females) for B6×SR2, 132 (58 males and 74 females) for B6×SR12 and 291 (151 males and 140 females) for B6×SR21. Litter size was not standardized at birth to maximize the number of F2 mice reared.
Figure 1

Relative introgressed genomic intervals of four subcongenic strains (B6.Cg-Pbwg1/#Nga, abbreviation SR#) developed from the original B6.Cg-Pbwg1 congenic strain carrying the Pbwg1 growth QTL on mouse chromosome 2.

The black bar indicates the minimum introgressed interval derived from the wild Mus musculus castaneus mouse, and the gray bar indicates the interval from the background C57BL/6JJcl (B6) strain. The hatched bar shows a gray zone where recombination occurred. The physical map positions (Mb) of 27 microsatellite markers (D2Mit#) and two PCR-RFLP markers (rs#) developed in this study (Figure S1) are shown on the horizontal line. The triangle indicates the position of the peak LOD score for three body composition QTLs (Pbwg1.3 to Pbwg1.5) previously identified [19], [21]. The horizontal double-headed arrows indicate the maximum intervals of two body weight QTLs (Pbwg1.11 and Pbwg1.12) previously defined [9].

Relative introgressed genomic intervals of four subcongenic strains (B6.Cg-Pbwg1/#Nga, abbreviation SR#) developed from the original B6.Cg-Pbwg1 congenic strain carrying the Pbwg1 growth QTL on mouse chromosome 2.

The black bar indicates the minimum introgressed interval derived from the wild Mus musculus castaneus mouse, and the gray bar indicates the interval from the background C57BL/6JJcl (B6) strain. The hatched bar shows a gray zone where recombination occurred. The physical map positions (Mb) of 27 microsatellite markers (D2Mit#) and two PCR-RFLP markers (rs#) developed in this study (Figure S1) are shown on the horizontal line. The triangle indicates the position of the peak LOD score for three body composition QTLs (Pbwg1.3 to Pbwg1.5) previously identified [19], [21]. The horizontal double-headed arrows indicate the maximum intervals of two body weight QTLs (Pbwg1.11 and Pbwg1.12) previously defined [9]. All mice were weaned at 3 weeks of age. Littermates of the same sex were housed in groups of up to four mice per cage. Standard chow (CA-1, Clea Japan), containing 27% crude protein, 5% crude fat, 3% crude fiber, 8% crude ash and 3.5 kcal/g, and tap water were provided ad libitum. The mice were reared in an environment with a temperature of 23±3°C, 55% relative humidity, and a light/dark cycle of 12∶12.

Genotyping

Genomic DNAs were extracted with a standard method from ear clips of the F2 mice. Microsatellite markers located within each of the subcongenic intervals (Figure 1) were genotyped as described previously [19]. To reduce as short as possible the gray regions flanking the subcongenic intervals, where recombination occurred, we newly developed two PCR-RFLP markers based on two SNPs identified by exome sequencing in this study (Figure S1). Each of the F2 mice had one of three diplotypes (B/B, B/C and C/C), where B is the haplotype derived from B6 mice and C is the haplotype derived from wild castaneus mice. Diplotype configuration was determined for each mouse of the four F2 populations produced. F2 mice having recombination within the subcongenic interval were excluded from this study.

Phenotyping

Body weight of F2 mice was measured to the nearest 0.01 g at 1, 3, 6, 10 and 14 weeks of age. Four body weight gains at 1–3 weeks, 3–6 weeks, 6–10 weeks and 10–14 weeks of age were calculated. After overnight fasting, mice were sacrificed under anesthesia. Total body length (from the tip of the nose to the end of the tail) and tail length (from the anus to the end of the tail) were immediately measured to the nearest 0.01 cm. Head-body length was obtained by subtracting tail length from total body length. After taking a blood sample by cardiopuncture, the lungs, spleen, liver, kidneys and testes were dissected and weighed to the nearest 0.001 g. In addition, the weights of two-sided inguinal and gonadal (epidydimal in males and parametrial in females) fat pads were recorded. In mice, the weight of white fat depots such as gonadal fat pads has been long and widely used as an indicator of fatness because the fat depots can be easily dissected out and are highly correlated with total body fat [1]. Body weight, weight gain and body composition data obtained for the F2 populations were analyzed with a linear mixed model of the statistical discovery software JMP version 11.1.1 (SAS Institute, Cary, NC) in which diplotype, sex, parity, litter size and their possible two-way interactions were treated as fixed effects and dam was treated as a random effect. The fixed effects and interaction effects that were significant at the nominal 5% level were included in the final model. Phenotypic differences among diplotypes were determined by one-way analysis of variance followed by Tukey's HSD test. To adjust for multiple testing, Bonferroni-corrected 5% level was finally used as a significant threshold. To estimate additive and dominance effects of diplotypes, a linear mixed model was fitted, with additive, dominance, sex, parity, litter size and their possible two-way interactions being included as fixed effects and dam being included as a random effect. The fixed effects and interaction effects that were significant at the nominal 5% level were finally included in the model. As previously defined for allelic effects of a QTL [24], additive diplotype effect is half of the difference between B/B and C/C homozygous diplotypes, and dominance diplotype effect is the difference between B/C heterozygous diplotypes and the average of B/B and C/C homozygous diplotypes. To estimate the additive diplotype effect, diplotypes were assigned quantitatively as −1 for B/B homozygotes, zero for B/C heterozygotes and +1 for C/C homozygotes. To estimate the dominance diplotype effect, diplotypes were assigned as zero for two types of homozygotes and +1 for heterozygotes. The degree of dominance was calculated as the ratio of dominance diplotype effect to additive diplotype effect.

Exome Sequencing

Genomic DNA was extracted with a standard method from the tail of a B6.Cg-Pbwg1 congenic mouse. Enrichment of exon regions in the 44.1-Mb congenic interval on mouse chromosome 2 was performed using Roche NimbleGen sequence capture arrays that were custom-made on the basis of UCSC Mouse Genome Browser NCBI37/mm9 assembly (RefSeq mm9). Enrichment experiments and exome sequencing with the next-generation sequencer Roche GS FLX were outsourced to Hokkaido System Science Co., Ltd (Sapporo, Japan). Sequence reads obtained were mapped to RefSeq mm9, and then synonymous SNPs (sSNPs), nonsynonymous SNPs (nsSNPs), indels (insertions and deletions) and nonsense mutations were investigated.

Candidate Gene Search

Endevour is a web-based computational software program that prioritizes candidate genes with respect to their biological processes or diseases of interest [25]. Genes on target regions carrying QTLs for body weight and obesity were prioritized on the basis of similarity to training genes that have already been shown to be involved in body weight and obesity regulation (Table S1). The training genes used were searched using Online Mendelian Inheritance in Man (OMIM) database (http://www.omim.org). Effects of nsSNPs identified by exome sequencing on protein functions were investigated with two web-based software programs, SIFT [26] and PolyPhen-2 [27]. SIFT predicts tolerated and deleterious substitutions for nsSNPs based on the evolutionary conservation of amino acids within protein families [26]. PolyPhen-2 predicts possible impact of an amino acid substitution on the structure and function of a protein using straightforward physical and comparative considerations [27]. Since PolyPhen-2 was developed for human proteins, this software was implemented after converting the positions of amino acid substitutions in our mouse study to the corresponding positions of the human protein.

Results

Intersubspecific Subcongenic Intercross Analyses

Most growth and body composition traits examined in F2 segregating populations between each of the four subcongenic strains (Figure 1) and the background B6 strain showed significant interactions between sex and trait (data not shown). We thus performed statistical comparisons of these traits among mice with three diplotypes in each sex separately. Figure 2 shows measurements of body weight and body weight gain in the four F2 segregating populations. In the B6×SR1 intercross, body weight of male mice with C/C diplotypes at 6 weeks of age was significantly higher than that of mice with the B/B diplotype (P = 0.0041, Tukey's HSD test) at the Bonferroni-corrected 5% significance level. However, it was not different from that of B/C males throughout ages examined. From 6 weeks onwards, the weight difference between C/C and B/B males remained significant (P = 0.0000036 at 10 weeks and 0.0000017 at 14 weeks of age). Additive diplotype effects for body weights at 6, 10 and 14 weeks of age exceeded the Bonferroni-corrected 5% level, whereas dominance diplotype effects were not significantly different from zero (Table 1). The C haplotype derived from wild mice increased body weight, despite the fact that the wild mice have approximately 60% of the body weight of B6 mice [16]. The mode of inheritance of this haplotype was additive or dominant (Table 1). In females, however, there were no significant differences in body weight at any age (Figure 2). For body weight gains at 1–3 weeks, 3–6 weeks, 6–10 weeks and 10–14 weeks, both sexes of mice with three diplotypes did not show significant differences at the Bonferroni-corrected 5% level. Although body weight gain in males at 3–6 weeks (P = 0.0058) was on the border of that level, its additive diplotype effect surpassed it (Table 1).
Figure 2

Comparisons of body weight and body weight gain among three diplotypes (B/B, B/C and C/C) in four F2 segregating populations obtained from (A) B6×SR1, (B) B6×SR2, (C) B6×SR12 and (D) B6×SR21 intercrosses.

B indicates the haplotype derived from B6 mice and C indicates the haplotype derived from wild castaneus mice. The asterisk shows significant differences in the trait among three diplotypes in each sex and the P values exceeded the Bonferroni-corrected 5% levels (see text for details).

Table 1

Additive and dominance diplotype effects for body weight at # weeks of age and weight gain between # and # weeks of age in the F2 populations obtained from B6×SR1 and B6×SR21 intercrosses.

Diplotype effecta
SexF2 populationTraitAdditive P valueDominance P valueDegree of dominanceInheritanceb
MaleB6×SR1Wt10.039±0.0460.400.049±0.0690.47--
Wt30.041±0.1110.710.193±0.1700.26--
Wt60.525±0.173 0.0030 0.376±0.2640.160.72 Add
Wt100.788±0.167 0.0000076 0.582±0.2560.0250.73 Dom
Wt140.874±0.178 0.0000034 0.586±0.2710.0330.67 Dom
Gain1–30.023±0.0950.810.151±0.1420.29--
Gain3–60.395±0.128 0.0026 0.206±0.1960.300.52Add
Gain6–100.267±0.1230.0310.040±0.1850.830.15Add
Gain10–140.160±0.1020.12−0.021±0.1530.89--
B6×SR21Wt1−0.001±0.0430.98−0.034±0.0620.59--
Wt3−0.066±0.0970.49−0.319±0.1400.024−4.83Overrec
Wt60.198±0.1640.23−0.379±0.2380.11--
Wt100.635±0.172 0.00032 −0.483±0.2490.055−0.76 Add
Wt140.833±0.192 0.000030 −0.552±0.2790.050−0.66 Rec
Gain1–3−0.074±0.0700.29−0.282±0.1020.0065−3.81Overrec
Gain3–60.277±0.1440.016−0.045±0.1660.78−0.16Add
Gain6–100.440±0.121 0.00039 −0.099±0.1760.57−0.23 Add
Gain10–140.155±0.0720.033−0.080±0.1050.45−0.52Add
FemaleB6×SR1Wt1−0.069±0.0470.15−0.146±0.0630.023−2.12Overrec
Wt3−0.156±0.0910.089−0.278±0.1200.023−1.78Overrec
Wt60.006±0.1360.97−0.092±0.1850.62--
Wt100.060±0.1220.62−0.423±0.1640.011−7.05Overrec
Wt140.099±0.1360.47−0.379±0.1820.040−3.83Overrec
Gain1–3−0.079±0.0610.19−0.160±0.0810.051−2.03Overrec
Gain3–60.010±0.1110.93−0.030±0.1520.84--
Gain6–100.177±0.0960.069−0.143±0.1300.27--
Gain10–140.033±0.0790.680.058±0.1070.59--
B6×SR21Wt10.039±0.0420.360.003±0.0580.96--
Wt30.094±0.0960.330.207±0.1320.12--
Wt60.271±0.1140.019−0.103±0.1570.51−0.38Add
Wt100.301±0.1190.013−0.201±0.1650.22−0.67Add
Wt140.208±0.1200.086−0.204±0.1160.22--
Gain1–30.058±0.0680.390.216±0.0940.0233.72Overdom
Gain3–60.181±0.1100.10−0.287±0.1520.061--
Gain6–100.027±0.0910.77−0.097±0.1270.44--
Gain10–14−0.088±0.0800.27−0.006±0.1110.96--

Data are means and standard errors. The P value in bold exceeded the Bonferroni-corrected 5% threshold level.

Positive sign indicates that the haplotype derived form the wild castaneus mouse increased the trait value.

Add, additive; Dom, dominant; Rec, recessive; Overrec, overrecessive; Overdom, overdominant; -, not applicable.

Comparisons of body weight and body weight gain among three diplotypes (B/B, B/C and C/C) in four F2 segregating populations obtained from (A) B6×SR1, (B) B6×SR2, (C) B6×SR12 and (D) B6×SR21 intercrosses.

B indicates the haplotype derived from B6 mice and C indicates the haplotype derived from wild castaneus mice. The asterisk shows significant differences in the trait among three diplotypes in each sex and the P values exceeded the Bonferroni-corrected 5% levels (see text for details). Data are means and standard errors. The P value in bold exceeded the Bonferroni-corrected 5% threshold level. Positive sign indicates that the haplotype derived form the wild castaneus mouse increased the trait value. Add, additive; Dom, dominant; Rec, recessive; Overrec, overrecessive; Overdom, overdominant; -, not applicable. In B6×SR2 and B6×SR12 intercrosses, body weights at any age did not differ significantly among mice with three diplotypes in both sexes. Similarly, there were no significant diplotype differences in body weight gains at any age in both sexes (Figure 2 and Table S2). On the other hand, in the B6×SR21 intercross, body weights of C/C males were significantly higher than those of B/C and B/B males at 10 weeks (P = 0.00028) and 14 weeks (P = 0.000029) of age (Figure 2). The wild-derived C haplotype was inherited in an additive or recessive fashion (Table 1). Furthermore, body weight gain at 6–10 weeks was significantly higher in the C/C males than in the B/C and B/B males (P = 0.0016) (Figure 2). The C haplotype was inherited in an additive fashion (Table 1). In contrast, neither body weight nor body weight gain was significantly different among females with three diplotypes at the Bonferroni-corrected 5% level (Figure 2 and Table 1). Tables 2 and S3 show measurements of body composition traits not adjusted for final body weight at 14 weeks of age in two kinds of F2 populations obtained from B6×SR1 and B6×SR21 intercrosses. In the B6×SR1 intercross, head-body length and total body length of C/C males were both significantly larger than those of B/B males at the Bonferroni-corrected 5% level (Table 2). The same tendency was observed for those traits in females, but the C haplotype was transmitted as different modes of inheritance in males (additive) and females (overrecessive) for an unknown reason. For inguinal fat pad weight and gonadal fat pad weight, C/C mice had the lowest values among mice with three diplotypes in both sexes. The C haplotype was inherited in an additive or recessive fashion depending on the sex. A significant difference in kidney weight was observed only in females (Table S3).
Table 2

Body length and fat pad weight not adjusted for body weight at 14 weeks of age, and additive and dominance diplotype effects for body length and fat pad weight in the F2 populations obtained from B6×SR1 and B6×SR21 intercrosses.

Diplotypec Diplotype effectDegree of dominance
SexF2 populationTraitB/BB/CC/C P valueAdditive P valueDominance P valueInheritanced
MaleB6×SR1No. of mice3333–3435–37
Tail length (cm)8.33±0.048.42±0.048.39±0.040.130.028±0.0240.240.060±0.0380.12--
Head-body length (cm)9.20±0.04a 9.34±0.04b 9.38±0.04b 0.00079 0.088±0.025 0.00080 0.058±0.0410.170.66 Add
Total body length (cm)17.52±0.06a 17.76±0.06b 17.77±0.06b 0.0014 0.118±0.038 0.0028 0.116±0.0630.0700.98 Add
Inguinal fat pad weight (g)0.278±0.012a 0.257±0.012a 0.203±0.012b 0.0000069 −0.037±0.012 0.0000035 0.016±0.0120.170.43 Add
Gonadal fat pad weight (g)0.280±0.014a 0.275±0.014a 0.210±0.014b 0.000038 −0.034±0.008 0.000071 0.030±0.0130.0300.88 Rec
B6×SR21No. of mice3238–3938–39
Tail length (cm)8.38±0.048.38±0.038.45±0.030.130.034±0.0210.11−0.039±0.0330.24--
Head-body length (cm)9.26±0.04a 9.27±0.03a 9.41±0.03b 0.00021 0.078±0.021 0.00035 −0.070±0.0330.038−0.90 Rec
Total body length (cm)17.62±0.05a 17.63±0.05a 17.85±0.06b 0.00022 0.115±0.032 0.00044 −0.110±0.0500.032−0.96 Rec
Inguinal fat pad weight (g)0.384±0.0160.382±0.0150.404±0.0150.350.010±0.0090.25−0.012±0.0140.39--
Gonadal fat pad weight (g)0.362±0.0160.362±0.0150.398±0.0150.0660.018±0.0090.051−0.018±0.0140.210--
FemaleB6×SR1No. of mice2434–3632
Tail length (cm)8.14±0.03ab 8.11±0.03b 8.20±0.03a 0.0380.030±0.0210.16−0.063±0.0310.048−2.10Overrec
Head-body length (cm)8.88±0.05ab 8.77±0.04b 8.91±0.04a 0.0230.013±0.0300.67−0.122±0.0450.0081−9.38Overrec
Total body length (cm)17.02±0.06ab 16.89±0.05b 17.12±0.06a 0.0043 0.049±0.0390.22−0.178±0.059 0.0034 −3.63 Overrec
Inguinal fat pad weight (g)0.231±0.13a 0.193±0.012b 0.183±0.012b 0.0037 −0.024±0.007 0.0013 −0.015±0.0110.17−0.63 Add
Gonadal fat pad weight (g)0.176±0.012a 0.137±0.010b 0.133±0.010b 0.0019 −0.022±0.006 0.0011 −0.018±0.0090.065−0.82 Add
B6×SR21No. of mice2838–3933
Tail length (cm)8.00±0.03a 8.09±0.03ab 8.16±0.03b 0.0024 0.077±0.021 0.00052 0.011±0.0320.730.14 Add
Head-body length (cm)8.85±0.04ab 8.88±0.03b 8.98±0.03a 0.0120.065±0.0230.0064−0.035±0.0360.33−0.54Add
Total body length (cm)16.85±0.06a 16.99±0.05a 17.15±0.05b 0.00051 0.150±0.004 0.00011 −0.013±0.0570.82−0.87 Rec
Inguinal fat pad weight (g)0.382±0.14a 0.371±0.012ab 0.374±0.013b 0.039−0.019±0.0080.0170.008±0.0120.500.42Add
Gonadal fat pad weight (g)0.258±0.0130.243±0.0120.226±0.0120.072−0.016±0.0070.0240.001±0.0100.920.063Add

Trait data are means and standard errors computed using a linear model including fixed and random effects (see Materials and Methods).

Means with different superscript letters within a trait indicate significant differences among three deplotypes at P≤0.05 (Tukey's HSD test). The P value in bold exceeded the Bonferroni-corrected 5% threshold level.

B denotes the haplotype where all alleles at marker loci on the congenic region are fixed for B6 alleles, and C indicates the haplotype on which all alleles are fixed for wild-derived castaneus alleles. Individuals with recombinant haplotypes were excluded from this analysis.

Add, additive; Rec, recessive; Overrec, overrecessive; -, not applicable.

Trait data are means and standard errors computed using a linear model including fixed and random effects (see Materials and Methods). Means with different superscript letters within a trait indicate significant differences among three deplotypes at P≤0.05 (Tukey's HSD test). The P value in bold exceeded the Bonferroni-corrected 5% threshold level. B denotes the haplotype where all alleles at marker loci on the congenic region are fixed for B6 alleles, and C indicates the haplotype on which all alleles are fixed for wild-derived castaneus alleles. Individuals with recombinant haplotypes were excluded from this analysis. Add, additive; Rec, recessive; Overrec, overrecessive; -, not applicable. In the B6×SR21 intercross, unadjusted body length traits were significantly different in both sexes at the Bonferroni-corrected 5% level. C/C mice had the longest length in both sexes (Table 2). The C/C mice had significantly higher kidney weight in males but not in females (Table S3). On the other hand, in both B6×SR2 and B6×SR12 intercrosses, no unadjusted traits were significantly different among mice with three diplotypes at the Bonferroni-corrected 5% level as well as the nominal 5% level (Table S4). Tables 3 and S5 show measurements of body composition traits adjusted for final body weight at 14 weeks of age, which are body-size-free traits, in two F2 populations obtained from B6×SR1 and B6×SR21 intercrosses. In the B6×SR1 intercross, significant diplotype differences were observed in inguinal and gonadal fat pad weights for both sexes and in testis weight for males at the Bonferroni-corrected 5% level. Both of the fat weights in C/C mice were lowest in each sex. Testis weight in C/C males was also lowest. The C haplotype for these three traits indicated an additive mode of inheritance. In contrast, in the B6×SR21 intercross, inguinal and gonadal fat pad weights were significantly lower in C/C females than in B/B females at the nominal 5% level, but those fat weights were not significantly different in males.
Table 3

Body length and fat pad weight adjusted for body weight at 14 weeks of age, and additive and dominance diplotype effects for body length and fat pad weight in the F2 populations obtained from B6×SR1 and B6×SR21 intercrosses.

DiplotypeDiplotype effectDegree of dominance
SexF2 populationTraitB/BB/CC/C P valueAdditive P valueDominance P valueInheritance
MaleB6×SR1No. of mice3333–3435–37
Tail length (cm)8.37±0.04a 8.40±0.04a 8.37±0.04a 0.70−0.003±0.0240.910.032±0.0370.39--
Head-body length (cm)9.27±0.03a 9.30±0.03a 9.32±0.03a 0.520.022±0.0210.310.010±0.0330.76--
Total body length (cm)17.64±0.05a 17.71±0.05a 17.69±0.05a 0.560.021±0.0320.510.042±0.0510.41--
Inguinal fat pad weight (g)0.287±0.013a 0.249±0.012b 0.198±0.012c 0.00000049 −0.042±0.008 0.00000097 0.013±0.0120.280.31 Add
Gonadal fat pad weight (g)0.290±0.014a 0.269±0.014a 0.203±0.014b 0.0000028 −0.042±0.009 0.0000036 0.023±0.0130.0880.55 Add
B6×SR21No. of mice3238–3938–39
Tail length (cm)8.40±0.038.39±0.038.41±0.030.830.008±0.0020.69−0.016±0.0320.63--
Head-body length (cm)9.31±0.029.32±0.029.35±0.020.490.017±0.0160.28−0.013±0.0240.58--
Total body length (cm)17.71±0.0417.70±0.0317.76±0.040.390.026±0.0240.29−0.340±0.3720.36--
Inguinal fat pad weight (g)0.386±0.0160.384±0.0150.398±0.0160.710.006±0.0090.53−0.008±0.0140.57--
Gonadal fat pad weight (g)0.366±0.0160.366±0.0150.388±0.0160.400.011±0.0090.26−0.011±0.0140.42--
FemaleB6×SR1No. of mice2434–3632
Tail length (cm)8.10±0.03a 8.14±0.03a 8.18±0.03a 0.0960.027±0.0180.14−0.018±0.0280.51--
Head-body length (cm)8.86±0.03a 8.82±0.03a 8.87±0.03a 0.430.006±0.0220.78−0.043±0.0350.21--
Total body length (cm)16.96±0.040a 16.96±0.034a 17.05±0.036a 0.0400.035±0.0240.14−0.056±0.0360.13--
Inguinal fat pad weight (g)0.227±0.012a 0.200±0.010ab 0.178±0.011b 0.0030 −0.025±0.007 0.00066 −0.003±0.0110.82−0.12 Add
Gonadal fat pad weight (g)0.173±0.010a 0.145±0.008ab 0.127±0.009b 0.0019 −0.021±0.006 0.00071 −0.003±0.0090.71−0.14 Add
B6×SR21No. of mice2838–3933
Tail length (cm)8.03±0.03a 8.10±0.03ab 8.13±0.03b 0.0270.050±0.0180.00760.014±0.0270.60--
Head-body length (cm)8.88±0.038.89±0.038.95±0.030.0930.039±0.0200.054−0.026±0.0300.38--
Total body length (cm)16.91±0.047a 16.97±0.041ab 17.08±0.044b 0.0110.086±0.028 0.0035 −0.017±0.0420.69−0.20Add
Inguinal fat pad weight (g)0.385±0.014a 0.372±0.012ab 0.341±0.013b 0.016−0.022±0.0080.00680.009±0.0120.45--
Gonadal fat pad weight (g)0.261±0.013a 0.244±0.011ab 0.222±0.012b 0.021−0.020±0.0070.00610.002±0.0100.82--

For abbreviations, see the footnotes to Tables 1 and 2.

For abbreviations, see the footnotes to Tables 1 and 2. On the other hand, in B6×SR2 and B6×SR12 intercrosses, neither males nor females showed significant diplotype differences in any adjusted body composition traits at the Bonferroni-corrected 5% level (Table S6). Taking all results together, a growth QTL, the wild-derived allele of which increased body weight and body weight gain, was localized to an interval between D2Mit433 (57.3 Mb) and D2Mit205 (65.3), as summarized in Table 4. In a previous study using congenic strains [9], the growth QTL Pbwg1.12 was physically localized to a maximum interval between D2Mit472 (61.5) and D2Mit327 (69.5) (see Figure 1), which overlapped with the interval of the growth QTL identified in this study. The wild-derived allele at Pbwg1.12 increased body weight [9], which was exactly the same allelic effect of the growth QTL identified in this study. Therefore, in this study, we succeeded in confirming the presence of Pbwg1.12 and in narrowing it down to a 3.8-Mb interval between D2Mit472 (61.5) and D2Mit205 (65.3).
Table 4

Summary of QTLs for growth and body composition confirmed in the four F2 segregating populations.

F2 populationa QTL
TraitB6×SR1B6×SR2B6×SR12B6×SR21SymbolGenomic interval (Mb)
Body weight & weight gainIncreasedNDNDIncreased Pbwg1.12 b D2Mit472-D2Mit205 (61.5–65.3)
Total body length (unadjusted)IncreasedNDNDIncreased Pbwg1.3 D2Mit433-D2Mit205 (57.3–65.3)
Fat pad weight (unadjusted & adjusted)DecreasedNDNDMG Pbwg1.5 c D2Mit123-D2Mit472 (59.4–61.5)

The effect of the QTL allele derived from the wild mouse is shown: Increased, increased the trait value; Decreased, decreased the trait value; MG, decreased the trait value but the QTL effect was marginal; ND, QTL was not detected.

Pbwg1.12 was previously defined to an interval between D2Mit472 and D2Mit327 [9] (see Figure 1 for their relative map positions).

Pbwg1.5 was previously defined to an interval between D2Mit270 and D2Mit472 [21] (see Figure 1).

The effect of the QTL allele derived from the wild mouse is shown: Increased, increased the trait value; Decreased, decreased the trait value; MG, decreased the trait value but the QTL effect was marginal; ND, QTL was not detected. Pbwg1.12 was previously defined to an interval between D2Mit472 and D2Mit327 [9] (see Figure 1 for their relative map positions). Pbwg1.5 was previously defined to an interval between D2Mit270 and D2Mit472 [21] (see Figure 1). Likewise, we were able to confirm the presence of the Pbwg1.3 QTL affecting total body length that was previously revealed by interval mapping with an F2 intercross population between the B6.Cg-Pbwg1 original congenic and B6 strains [19]. Pbwg1.3 was physically defined to an 8.0-Mb interval between D2Mit433 (57.3) and D2Mit205 (65.3) (Table 4). In the B6×SR1 intercross, a QTL for which the wild-derived allele decreased inguinal and gonadal fat pad weights was clearly identified. In the B6×SR21 intercross, however, the presence of the obesity QTL was ambiguous, because P values for diplotype comparisons marginally exceeded the nominal 5% level but did not reach the Bonferroni-corrected 5% level. Previously, the Pbwg1.5 QTL for resistance to obesity was physically mapped to an interval between D2Mit270 (52.9) and D2Mit472 (61.5) [21] (see Figure 1). Therefore, we were able to confirm the presence of Pbwg1.5 in this study and localize it to a 2.1-Mb interval between D2Mit123 (59.4) and D2Mit472 (61.5) (Table 4). Since no sequence data have so far been reported for the Philippine wild castaneus mice used in this study, we performed sequencing of 2,205 exons for 153 genes on the 44-Mb original congenic region of chromosome 2. According to RefSeq mm9, target bases for the exons were 767,440 bp. The NimbleGen sequence capture covered 97.1% of the target bases, i.e., 745,515 bp. Individual sequence coverage was 11.2 fold on average and ranged from 3 to 36 fold. As expected, some kinds of sequence variants, such as SNPs and indels, were observed in most genes derived from the wild mouse (Table S5). In total, 840 sSNPs and 334 nsSNPs were identified. Nine deletions and 10 insertions were detected in 13 genes. In addition, five nonsense mutations were identified within three genes. On the QTL regions narrowed by the above intersubspecific subcongenic intercross analyses, many SNPs and a few indels were identified, but no nonsense mutation was detected (Tables 5 and S7).
Table 5

Variants detected by exome sequencing of genes on the genomic regions harboring the growth QTL Pbwg1.12 and the obesity QTL Pbwg1.5, prioritization of candidate genes and damage of protein functions caused by nsSNPs found in the candidate genes.

Position (bp)Number of variantsa Candidate gene rankingb Damage to protein functionc
Gene symbolStartEndsSNPnsSNPDeletionInsertionBody weightObesitySIFTPolyPhen-2
Dapl1 59322709593430751000NA
Tanc1 594501005968420621401NA
Wdsub1 59690423597206636100NA
Baz2b 597374195996379715610NA
March7 60047992600864426000NA
Cd302 60090049601224751010NA
Ly75 601318166022128827900NA1ToleratedBenign
Pla2r1 602570956039131818800NA
Itgb6 604363496051175011300NA2AffectedBenign
Rbms1 60590009608012612000NA
Tank 61416642614922241500NA
Psmd14 61549750616384331000NA
Tbr1 61642509616521702100NA
Slc4a10 61884596621648006000NA
Dpp4 62168131622502886000NA
Gcg 623125866232171001001NAToleratedBenign
Fap 62339001624120782200NA
Ifih1 624338496248431217500NA
Gca 62502383625321663100NA
Kcnh7 62541002630223446100NA
Fign 63815417639360644100NA
Grb14 647505396486082372002NAToleratedBenign
Cobll1 6492639565076683141800NA

sSNP, synonymous SNP; nsSNP, nonsynonymous SNP; NA, not applicable because the QTL in question was not located on the region including the genes.

The top two genes were prioritized as candidate genes for growth and obesity QTLs by the web-based software program Endevour [25].

Damage caused by nsSNPs was investigated for the ranked genes by two software programs, SIFT [26] and PolyPhen-2 [27].

sSNP, synonymous SNP; nsSNP, nonsynonymous SNP; NA, not applicable because the QTL in question was not located on the region including the genes. The top two genes were prioritized as candidate genes for growth and obesity QTLs by the web-based software program Endevour [25]. Damage caused by nsSNPs was investigated for the ranked genes by two software programs, SIFT [26] and PolyPhen-2 [27]. As shown in Table 5, there were 11 genes on the 3.8-Mb region between D2Mit472 and D2Mit205, where the growth QTL Pbwg1.12 was located. Using training genes related to body weight (Table S1), Endevour prioritized Gcg (glucagon) and Grb14 (growth factor receptor-bound protein 14) as the top two candidate genes for Pbwg1.12. Gcg had one nsSNP and Grb14 had two nsSNPs. Both SIFT and PolyPhen-2 predicted that none of these nsSNPs inflicted possible damage on protein functions (Table 5). On the 2.1-Mb region between D2Mit123 and D2Mit472 harboring the obesity QTL Pbwg1.5, 12 genes were located (Table 5). Endevour ranked Ly75 (lymphocyte antigen 75) and Itgb6 (integrin beta 6) as the top two candidate genes for Pbwg1.5 using training genes related to obesity (Table S1). Ly75 had nine nsSNPs and these were predicted to have no affect on protein function. In contrast, Itgb6 had three nsSNPs. PolyPhen-2 predicted that none of the three nsSNPs caused possible damage to protein function, whereas SIFT predicted that one of them, i.e. A>C at the position of 2:60491216 leading to amino acid substitution of Sel302Ala, is harmful to protein function. This nsSNP has previously been reported as dbSNP rs28025203.

Discussion

Previously we discovered the Pbwg1.12 QTL for growth [9], the Pbwg1.3 QTL for body length [19] and the Pbwg1.5 QTL for obesity [21] from an untapped resource of wild M. m. castaneus mice caught in the Philippines. In this study, we were able to confirm the presence of these three QTLs by intersubspecific intercross analyses using four newly or previously constructed subcongenic strains with overlapping and/or non-overlapping genomic intervals. The unique effects of the wild-derived QTL allele at the QTLs revealed in previous studies [9], [19], [21] were duplicated in the present independent study. That is, this allele uniquely enhanced growth at Pbwg1.12 and increased body length at Pbwg1.3, despite the fact that the wild mouse has approximately 60% of the body weight of B6 [16], whereas it decreased fat weight at Pbwg1.5. Furthermore, we were able to reduce the genomic interval harboring Pbwg1.12 from 8.9 Mb [9] to 3.8 Mb in length and to narrow the interval of Pbwg1.5 from 8.8 Mb [21] to 2.1 Mb. Although Pbwg1.3 was previously localized to a 20-Mb confidence interval [19], it was physically mapped to an 8.0-Mb interval in this study. Although Pbwg1.3 and Pbwg1.5 exerted phenotypic effects on both sexes, Pbwg1.12 exhibited male-specific effect on body weight. In our previous study [9], the sex-specificity of Pbwg1.12 on chromosome 2 was not tested because the sample size was small. Sex-specific QTLs for body weight are revealed on different chromosomal regions in our previous genome-wide QTL analysis [18] and in different mouse crosses [5]. In addition, sex-specific QTLs have commonly been observed in different quantitative traits of mice and other species, as mentioned previously [16], [18]. However, the molecular mechanisms underlying sex-specific QTLs remain unclear. It is reported that androgen control of growth hormone secretion induces male-specific gene expression in the liver of mice [28]. We thus consider that the male-specific effect of Pbwg1.12 may be mediated by sex hormones through male-specific expression of the causative gene of Pbwg1.12. According to MGD [5], several QTLs affecting growth, body length and obesity were previously mapped to mouse chromosome 2 regions that are overlapped with our 8.0-Mb region between D2Mit443 (57.3) and D2Mit205 (65.3). Since the previous QTLs were mapped by genome-wide QTL analyses, confidence intervals of the QTLs are generally very large, spanning approximately 100 Mb or more. Thereafter, few map positions of QTLs have been determined physically, with a few exceptions. Four growth and obesity QTLs, named Wg2a-Wg2d, have been fine-mapped to the interval from D2Ucd15 (74.7) to D2Mit196 (160.5) by phenotypic analyses of subcongenic strains that possess the introgressed regions of the CAST/EiJ strain established from wild M. m. castaneus mice on the B6 genetic background [10]. However, this interval is outside of our QTL regions. The Nidd5 QTL affecting adiposity has been fine-mapped by phenotypic analysis of congenic strains with donor regions derived from the BALB/cA strain on the genetic background of the obese/diabetic TSOD strain, and Acvr1c encoding activin receptor-like kinase 7 at the position of 58.1 Mb was very recently identified as a responsible gene for Nidd5 [29]. The obese/diabetic TSOD strain unexpectedly has the wild-type allele at Acvr1c, whereas the normal BALB/cA strain has a nonsense mutation resulting in decreased fat mass phenotype [29]. In contrast, our exome sequencing analysis indicated that the Acvr1c gene derived from our wild castaneus mouse had neither nsSNPs nor nonsense mutations. Furthermore, Acvr1c lies outside the interval containing our Pbwg1.12 for increased body weight and Pbwg1.5 for decreased fat weight. Acvr1c is thus unlikely to be a candidate gene for our QTLs. In addition, as no nonsense mutation was identified for any of the genes located in the QTL interval, this kind of mutation could not become a sequence variant causing the differences in body weight and fat weight shown in this study. In this study, exome sequencing and candidate gene prioritization strongly suggested that Gcg and Grb14 are putative candidate genes for the Pbwg1.12 QTL for enhanced growth. Gcg encodes proglucagon, a precursor of glucagon, glucagon-like peptide-1 (GLP-1) and several other components. Glucagon is generated in pancreatic α-cells and GLP-1 is yielded in intestinal L-cells, and these peptides paly key roles in glucose metabolism and homeostasis [30]. Mice lacking glucagon and GLP-1 are born normally without gross abnormalities and display α-cell hyperplasia and increased body weight [31]. It has very recently been revealed in rats fed a high-fat diet that hypothalamic glucagon signaling can suppress hepatic glucose production, suggesting that hypothalamic glucagon resistance may contribute to the hyperglycemia observed in obesity and diabetes [32]. Grb14 encodes an adaptor protein belonging to the GRB7 family and it plays an important role in receptor-tyrosine kinase signaling pathways and insulin signaling [33]. Grb14 knockout mice are born normally, show a small reduction in body weight and exhibit improved glucose homeostasis and enhanced insulin signaling in the liver and skeletal muscle [34]. Judging from the phenotypic similarity between Pbwg1.12 and knockout mice, Gcg is very likely to become a candidate gene for Pbwg1.12, although further studies such as pancreatic islet characterization and Gcg expression analysis will be needed in our subcongenic mice. For the obesity Pbwg1.5 QTL, Ly75 and Itgb6 were suggested to be putative candidate genes in this study. Ly75 encodes DEC-205, a 205-kD integral membrane protein homologous to the macrophage mannose receptor, and DEC-205 is a novel endocytic receptor used by dendritic cells and thymic epithelial cells to direct captured antigens from the extracellular space to a specialized antigen-processing compartment [35]. Ly75 knockout mice exhibit abnormalities in CD8-positive T cell morphology and cytotoxic T cell physiology [36]. Itgb6 encodes the integrin β6 subunit, a member of the integrin family. This subunit heterodimerizes with the αv subunit to bind and/or activate latent transforming growth factor β. The expression of αvβ6 integrin is largely restricted to a subset of epithelial cells [37], [38]. Itgb6 knockout mice are born and grow normally but exhibit juvenile baldness associated with macrophage infiltration of the skin and accumulation of activated lymphocytes around conducting airways in the lungs, suggesting that alterations in this integrin may contribute to the development of inflammatory diseases of epithelial organs including the skin, lungs and kidney [39]. A previous microarray analysis revealed that 259 genes are differentially expressed in the liver between SM/J and LG/J mouse strains fed a high-fat diet, where SM/J is more responsive than LG/J for many obesity and diabetes traits. Most of these genes are associated with immune function, and 62 genes are located within intervals of QTLs previously mapped for obesity, diabetes and related traits [40]. High-fat diets are known to trigger an immune response through inflammation in many organs and tissues such as the liver and adipose tissue [41], [42]. Hence, the genes associated with immune function can become candidate genes for obesity and related QTLs. Therefore, the Ly75 and Itgb6 genes with immune function may be good candidate genes for our Pbwg1.5 that shows prevention of obesity when mice are fed both low-fat standard and high-fat diets [21]. The Itgb6 gene on the Pbwg1.5 region derived from a wild castaneus mouse caught in the Philippines had the nsSNP of g.2:60491216A>C, leading to amino acid substitution of Sel302Ala that was predicted to be harmful to protein function by SIFT but not by PolyPhen-2. In fact, the Sel residue is conserved among many mammals including humans, dogs, bovines, horses and rats [43]. In mice, both Sel and Ala residues are segregating among common inbred strains and also among wild-derived inbred strains [5]. It is noteworthy that the CAST/EiJ strain established from wild castaneus mice in Thailand has the same base substitution (C: Ala) as that of our wild castaneus mouse in the Philippines. In addition, QTLs for obesity and related traits identified from CAST/EiJ and other strains have so far not been fine-mapped to the Pbwg1.5 region on mouse chromosome 2, as discussed earlier. These facts thus suggest that the A>C nsSNP might not act as a sequence variant causing our phenotypic variation. Next-generation sequencing of 13 classical inbred mouse strains and four wild-derived inbred strains has recently revealed that QTLs with small effects on 100 phenotypes of disease and physiological traits, which were identified in more than 2,000 heterogeneous stock mice, are more likely to arise from intergenic sequence variants lying outside genes and are less likely to arise from nsSNPs and structural variants (indels, inversions, copy number gains and others) lying within genes. In contrast, it has been shown that QTLs with large effects are more likely to arise from structural variants and are less likely to arise from intergenic variants [23], [44]. We therefore consider that, since our QTLs have small effects on growth and obesity, their causative variants may be intergenic variants rather than nsSNPs and structural variants identified by exome sequencing in this study. As the next step, we will need to perform expression analysis of the four putative candidate genes searched in this study. Gene expression results will provide information helpful for identifying causative genes and further causative variants underlying our QTLs on chromosome 2. In conclusion, by analysis using intersubspecific subcongenic intercrosses, we precisely fine-mapped three unique QTLs for enhanced growth, prevention of obesity and increased body length, which were discovered from a wild M. m. castaneus mouse, to small genomic intervals ranging from 2.1 to 8.0 Mb on mouse chromosome 2. By combined analysis of exome sequencing and bioinformatics, we identified four genes as putative candidate genes for the unique growth and obesity QTLs. We furthermore predicted that nsSNPs found in the candidate genes would not be harmful to protein functions. Two PCR-RFLP markers on mouse chromosome 2 developed in this study. (A) The rs13476521 PCR-RFLP marker was constructed on the basis of the rs13476521 SNP located at 58,131,026 bp on the Cytip gene. B6 has the nucleotide base T and our exome sequencing revealed that our wild castaneus mouse has the base C being the same as that of CAST/EiJ. A pair of primers, 5′-CCTGGGGGAATGGATAAAGT-3′ and CCTGACTCGGACACTGGAAT, amplified a 364-bp fragment including this SNP. The restriction enzyme EcoRV cut the 364-bp fragment derived from B6 in two (195 and 169 bp), whereas it did not cut the 364-bp fragment derived from the wild mouse. (B) The rs48690987 PCR-RFLP marker was developed on the basis of the rs48690987 SNP at 62,606,356 bp on the Ifih1 gene. B6 has the nucleotide base T, whereas our wild mouse has the base C being the same as that of CAST/EiJ. A pair of primers, AAATTCATCCGTTTCGTCCA and GGATAGTTTTCTGCCCTTTGC, amplified a 306-bp fragment. The enzyme EcoT22I generated two B6-derived fragments (160 and 146 bp), whereas it did not cut a wild-derived fragment. PCR was performed as described previously [19], and 2.0–2.5% agarose gels were used for electrophoresis. (TIF) Click here for additional data file. Training genes used in prioritization of candidate genes. (XLSX) Click here for additional data file. Additive and dominance diplotype effects for body weight and weight gain in the F (XLSX) Click here for additional data file. Organ weight not adjusted for body weight at 14 weeks of age, and additive and dominance diplotype effects for organ weight in the F (XLSX) Click here for additional data file. Measurements of body composition traits not adjusted for body weight at 14 weeks of age, and additive and dominance diplotype effects for body composition traits in the F (XLSX) Click here for additional data file. Organ weight adjusted for body weight at 14 weeks of age, and additive and dominance diplotype effects for organ weight in the F (XLSX) Click here for additional data file. Measurements of body composition traits adjusted for body weight at 14 weeks of age, and additive and dominance diplotype effects for body composition traits in the F (XLSX) Click here for additional data file. Summary of variants identified by exome sequencing of 153 genes located on the original congenic region between and on mouse chromosome 2. (XLSX) Click here for additional data file.
  42 in total

Review 1.  Metabolic impact of glucagon deficiency.

Authors:  Y Hayashi
Journal:  Diabetes Obes Metab       Date:  2011-10       Impact factor: 6.577

2.  Intersubspecific subcongenic mouse strain analysis reveals closely linked QTLs with opposite effects on body weight.

Authors:  Md Bazlur R Mollah; Akira Ishikawa
Journal:  Mamm Genome       Date:  2011-03-31       Impact factor: 2.957

3.  A method and server for predicting damaging missense mutations.

Authors:  Ivan A Adzhubei; Steffen Schmidt; Leonid Peshkin; Vasily E Ramensky; Anna Gerasimova; Peer Bork; Alexey S Kondrashov; Shamil R Sunyaev
Journal:  Nat Methods       Date:  2010-04       Impact factor: 28.547

4.  A wild derived quantitative trait locus on mouse chromosome 2 prevents obesity.

Authors:  Md Bazlur R Mollah; Akira Ishikawa
Journal:  BMC Genet       Date:  2010-09-23       Impact factor: 2.797

5.  Mice deficient for glucagon gene-derived peptides display normoglycemia and hyperplasia of islet {alpha}-cells but not of intestinal L-cells.

Authors:  Yoshitaka Hayashi; Michiyo Yamamoto; Hiroyuki Mizoguchi; Chika Watanabe; Ryoichi Ito; Shiori Yamamoto; Xiao-yang Sun; Yoshiharu Murata
Journal:  Mol Endocrinol       Date:  2009-10-09

6.  Dissection of a genetically complex cluster of growth and obesity QTLs on mouse chromosome 2 using subcongenic intercrosses.

Authors:  Charles R Farber; Juan F Medrano
Journal:  Mamm Genome       Date:  2007-08-11       Impact factor: 2.957

7.  Mapping an overdominant quantitative trait locus for heterosis of body weight in mice.

Authors:  Akira Ishikawa
Journal:  J Hered       Date:  2009-03-03       Impact factor: 2.645

8.  Mouse genomic variation and its effect on phenotypes and gene regulation.

Authors:  Thomas M Keane; Leo Goodstadt; Petr Danecek; Michael A White; Kim Wong; Binnaz Yalcin; Andreas Heger; Avigail Agam; Guy Slater; Martin Goodson; Nicholas A Furlotte; Eleazar Eskin; Christoffer Nellåker; Helen Whitley; James Cleak; Deborah Janowitz; Polinka Hernandez-Pliego; Andrew Edwards; T Grant Belgard; Peter L Oliver; Rebecca E McIntyre; Amarjit Bhomra; Jérôme Nicod; Xiangchao Gan; Wei Yuan; Louise van der Weyden; Charles A Steward; Sendu Bala; Jim Stalker; Richard Mott; Richard Durbin; Ian J Jackson; Anne Czechanski; José Afonso Guerra-Assunção; Leah Rae Donahue; Laura G Reinholdt; Bret A Payseur; Chris P Ponting; Ewan Birney; Jonathan Flint; David J Adams
Journal:  Nature       Date:  2011-09-14       Impact factor: 49.962

9.  Sequence-based characterization of structural variation in the mouse genome.

Authors:  Binnaz Yalcin; Kim Wong; Avigail Agam; Martin Goodson; Thomas M Keane; Xiangchao Gan; Christoffer Nellåker; Leo Goodstadt; Jérôme Nicod; Amarjit Bhomra; Polinka Hernandez-Pliego; Helen Whitley; James Cleak; Rebekah Dutton; Deborah Janowitz; Richard Mott; David J Adams; Jonathan Flint
Journal:  Nature       Date:  2011-09-14       Impact factor: 49.962

10.  Genome-wide mRNA expression analysis of hepatic adaptation to high-fat diets reveals switch from an inflammatory to steatotic transcriptional program.

Authors:  Marijana Radonjic; Jorn R de Haan; Marjan J van Erk; Ko Willems van Dijk; Sjoerd A A van den Berg; Philip J de Groot; Michael Müller; Ben van Ommen
Journal:  PLoS One       Date:  2009-08-14       Impact factor: 3.240

View more
  5 in total

1.  Genetics of Rapid and Extreme Size Evolution in Island Mice.

Authors:  Melissa M Gray; Michelle D Parmenter; Caley A Hogan; Irene Ford; Richard J Cuthbert; Peter G Ryan; Karl W Broman; Bret A Payseur
Journal:  Genetics       Date:  2015-07-20       Impact factor: 4.562

2.  Genomic Variants Associated with Resistance to High Fat Diet Induced Obesity in a Primate Model.

Authors:  R Alan Harris; Callison E Alcott; Elinor L Sullivan; Diana Takahashi; Carrie E McCurdy; Sarah Comstock; Karalee Baquero; Peter Blundell; Antonio E Frias; Maike Kahr; Melissa Suter; Stephanie Wesolowski; Jacob E Friedman; Kevin L Grove; Kjersti M Aagaard
Journal:  Sci Rep       Date:  2016-11-04       Impact factor: 4.379

Review 3.  A Strategy for Identifying Quantitative Trait Genes Using Gene Expression Analysis and Causal Analysis.

Authors:  Akira Ishikawa
Journal:  Genes (Basel)       Date:  2017-11-27       Impact factor: 4.096

4.  Identification of a Putative Quantitative Trait Gene for Resistance to Obesity in Mice Using Transcriptome Analysis and Causal Inference Tests.

Authors:  Akira Ishikawa
Journal:  PLoS One       Date:  2017-01-23       Impact factor: 3.240

5.  Genetic identification of Ly75 as a novel quantitative trait gene for resistance to obesity in mice.

Authors:  Keita Makino; Akira Ishikawa
Journal:  Sci Rep       Date:  2018-12-05       Impact factor: 4.379

  5 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.