| Literature DB >> 25349780 |
Majambu Mbikay1, Francine Sirois2, Sonia Simoes3, Janice Mayne4, Michel Chrétien1.
Abstract
Low-density lipoprotein receptor (LDLR) mediates hepatic clearance of plasma cholesterol; proprotein convertase subtilisin/kexin 9 (PCSK9) opposes this clearance by promoting LDLR degradation. The plant flavonoid quercetin-3-β-d-glucoside (Q3G) has been shown to reduce hypercholesterolemia in experimental animals. Here, we examined how it affects LDLR and PCSK9 expression as well as LDL uptake by human Huh7 hepatocytes. At low micromolar concentrations, Q3G increased LDLR expression, reduced PCSK9 secretion, and stimulated LDL uptake. It also diminished intracellular sortilin, a sorting receptor known to facilitate PCSK9 secretion. Thus, as an LDLR inducer and a PCSK9 anti-secretagogue, Q3G may represent an effective anti-cholesterolemic agent.Entities:
Keywords: ABCA1, ATP-binding cassette transporter A1; ApoB, apolipoprotein B; Cholesterol; HMGCoAR, 3-hydroxy-3-methylglutaryl-CoA reductase; Hepatocytes; LDL-C, low-density lipoprotein-cholesterol; LDLR, low-density lipoprotein receptor; Low-density lipoprotein receptor; PCSK9, proprotein convertase subtilisin/kexin 9; Proprotein convertase; Q3G, quercetin-3-β-d-glucoside; Quercetin; SREBP-2, sterol regulatory element-binding protein 2; Sortilin; TGN, trans Golgi network
Year: 2014 PMID: 25349780 PMCID: PMC4208090 DOI: 10.1016/j.fob.2014.08.003
Source DB: PubMed Journal: FEBS Open Bio ISSN: 2211-5463 Impact factor: 2.693
Fig. 1(A) Structure of Q3G. (B–C) Q3G effects on the levels of LDLR and PCSK9 expression Cells were incubated for 24 h in medium containing the indicated concentrations of Q3G. Levels of mRNA were determined by qRT-PCR (B); those of proteins by sq-immunoblotting in cell extracts or ELISA in spent media (C). Values are means of triplicate experiments ± and standard errors of means (SEM). They are expressed relative to untreated cells. Significant difference (P < 0.05) is represented in the graph by different letters above symbols of means ± SEM. PCSK9 prefixes ic- and sec- stand for intracellular and secreted, respectively. Note that the LDLR band shown in B, a represents the glycosylated mature form of the receptor. A co-regulated immature form can be observed below on overexposed X-ray films (not shown).
UPL primers and probes.a
| Exon number: Primer sequence | Amplicon | |||
|---|---|---|---|---|
| Forward | Reverse | Size (bp) | Probe # | |
| Exon 14: gggatgaacatgatttcaaagg | Exon 15: ttttcctcttccctctatccaa | 147 | 62 | |
| Exon 17: aggacggctacagctaccc | Exon18: ctccaggcagatgttcacg | 73 | 88 | |
| Exon 2: catgtcttccatggccttct | Exon3: tagtcgacatggggcaactt | 89 | 62 | |
| Exon 9: gcagcaaatgatgacatggt | Exon 10: gaggtaaagattgtgccaaacc | 74 | 80 | |
| Exon 2: gcctttgatataccagaatgcag | Exon 3: cctgctgctgaatggtgac | 107 | 88 | |
| Exon 2: gaacatcatggatcagaacaaca | Exon 3: atagggattccgggagtcat | 87 | 87 | |
The probes were designed using an online algorithm at the Roche Universal Probe Library Assay Design Center (www.roche-applied-science.com/sis/rtpcr/upl/adc.jsp).
Fig. 2Q3G stimulates nuclear SREBP-2 production and delays PCSK9 secretion. Cells were incubated for 24 h in medium containing the indicated concentrations of Q3G. (A) qRT-PCR for mRNA levels of SREBP-2, HMGCoAR and ABCA1. Values are means of triplicate experiments ± SEM. They are expressed relative to untreated cells. Significant difference (P < 0.05) is represented in the graph by different letters above symbols of means ± SEM. (B) Sq-immunoblotting for cellular SREBP-2-related proteins. Density ratios of the 65-kDa SREBP over the 148-kDa precursor SREBP after normalization for β-actin were derived from two separate experiments. (C) Cells were pre-incubated for 24 h in medium 5 μM Q3G. After metabolic labeling with radioactive amino acids, labeled proteins were chased in Q3G-free non-radioactive medium, for varying lengths of time. PCSK9-related proteins were immunoprecipitated, fractionated by SDS–PAGE, and quantified by phosphorimaging. Upper panel: PCSK9-related proteins in cell lysates. Lower panel: PCSK9-related proteins in spent media. The percents of secreted PCSK9 were based on densitometric values of intracellular and extracellular bands corresponding to proPCSK9 and PCSK9. Asterisks (∗) indicate possible products of further PCSK9 processing.
Fig. 3Q3G inhibit sortilin expression. Cells were pre-treated or not with 5 μM Q5G for 24 h. Their content in sortilin protein was evaluated by sq-immunoblotting (A); that of sortilin mRNA by qRT-PCR (B). Values are expressed relative to untreated cells. They represent means of triplicate experiments ± SEM. ∗∗∗P < 0.001; ∗∗P < 0.01 by Student t test.
Fig. 4Q3G increases cell surface LDLR and LDL uptake. Cells were pre-treated or not with 5 μM Q5G; (A) they were then stained for LDLR indirect immunofluorescence and analyzed by (a) flow cytometry, or (b) confocal microscopy, (c) means of fluorescence ± SEM were compared. The experiment was conducted in triplicates. (B) Cells were incubated bodipy-LDL for up to 30 min; uptake of the lipoprotein was measured by fluorescence spectrometry. Values represents means of 6 replicates ± SEM. ∗∗∗P < 0.005; ∗∗P < 0.01 by Student t test.
Fig. 5Q3G reduces statin-induced PCSK9 secretion. Cells were incubated for 24 h in culture medium containing 5% FBS and simvastatin (SMV: 0, 0.2, or 1 μM), without or with 5 μM Q3G. The levels of LDLR and PCSK9 in cell extracts were evaluated by sq-immunoblotting; that of PCSK9 in spent media by ELISA. Significant difference (P < 0.05) is represented in the graph by different letters above symbols of means ± SEM.