Literature DB >> 25333281

Characterization of the highly variable immune response gene family, He185/333, in the sea urchin, Heliocidaris erythrogramma.

Mattias O Roth1, Adam G Wilkins1, Georgina M Cooke1, David A Raftos1, Sham V Nair1.   

Abstract

This study characterizes the highly variable He185/333 genes, transcripts and proteins in coelomocytes of the sea urchin, Heliocidaris erythrogramma. Originally discovered in the purple sea urchin, Strongylocentrotus purpuratus, the products of this gene family participate in the anti-pathogen defenses of the host animals. Full-length He185/333 genes and transcripts are identified. Complete open reading frames of He185/333 homologues are analyzed as to their element structure, single nucleotide polymorphisms, indels and sequence repeats and are subjected to diversification analyses. The sequence elements that compose He185/333 are different to those identified for Sp185/333. Differences between Sp185/333 and He185/333 genes are also evident in the complexity of the sequences of the introns. He185/333 proteins show a diverse range of molecular weights on Western blots. The observed sizes and pIs of the proteins differ from predicted values, suggesting post-translational modifications and oligomerization. Immunofluorescence microscopy shows that He185/333 proteins are mainly located on the surface of coelomocyte subpopulations. Our data demonstrate that He185/333 bears the same substantial characteristics as their S. purpuratus homologues. However, we also identify several unique characteristics of He185/333 (such as novel element patterns, sequence repeats, distribution of positively-selected codons and introns), suggesting species-specific adaptations. All sequences in this publication have been submitted to Genbank (accession numbers JQ780171-JQ780321) and are listed in table S1.

Entities:  

Mesh:

Year:  2014        PMID: 25333281      PMCID: PMC4204807          DOI: 10.1371/journal.pone.0062079

Source DB:  PubMed          Journal:  PLoS One        ISSN: 1932-6203            Impact factor:   3.240


Introduction

Many invertebrate immune systems studied to-date consist of highly complex repertoires of pattern recognition receptors (PRRs), regulatory and effector systems, but lack hypervariable recognition molecules that are homologous to vertebrate immunoglobulins. Recent studies also indicate the ability of some invertebrate immune systems, such as those of some arthropods, to specifically discriminate between different pathogens [1]–[3] and there is also evidence which suggest that some invertebrate immune systems may be capable of heightening responses to repeated challenge by the same type of pathogen [4], [5], a phenomenon analogous to immunological memory [6]. However, the molecular bases of these immunological features have not been established. Some invertebrate immune genes, such as the scavenger receptor cysteine rich repeat (SRCR) genes of the sea urchins [7], are organized as large gene families that specify diverse repertoires of closely-related products [8], [9]. This diversity is presumably brought about by gene duplication and divergence, gene conversion and gene rearrangement during PRR expression [10]. Another strategy involves post-transcriptional diversification of a small number of immune-response genes. An example of this is the down syndrome cell adhesion molecule (Dscam) gene family in Drosophila melanogaster and Anopheles gambiae, which can generate thousands of alternatively spliced transcripts from single copy genes [4], [11]. Other examples of diversified families of genes in invertebrates include those encoding the fibrinogen related proteins (FREPs) in snails [12] and those encoding the variable chitin binding proteins (VCBPs) in cephalochordates [13]. Sea urchins are members of the echinoderm phylum, which is a sister group to the chordates. Thus, sea urchins are important for investigations of the immunology and the evolution of immune systems in the deuterostome lineage. The purple sea urchin, Strongylocentrotus purpuratus, has an elaborately equipped immune system [8]. The numbers of genes encoding putative PRRs (e.g. TLR, SRCR, NOD and NLR) in the S. purpuratus genome are much higher than those found in vertebrate genomes [14]. In addition, a unique class of highly variable immune-gene family, known as Sp185/333, also functions in immunity and is considerably upregulated upon immunological challenge [15]–[17]. More than 860 full-length Sp185/333 cDNAs [16], [17] and 171 genes [18] have been sequenced to-date. The diversity of Sp185/333 s is based on the presence or absence of 25 to 27 sequence blocks, called elements, depending on how the sequences are aligned [15], [17], [19]. Elements do not randomly appear in the genes, but are present in distinct element patterns (i.e. combinations of elements; 15–18) and all Sp185/333 sequences can be categorized according to their element patterns. Diversity is further enhanced by single nucleotide polymorphisms (SNPs), short insertions and deletions (indels) and a number of sequence repeats that appear throughout Sp185/333 sequences [15], [18] that enable two equally feasible alignments of the sequences. Previous studies indicated that Sp185/333 with E2, D1, 01, and E3 element patterns were under positive selection for diversification (dn/ds>1; see Ref. 16). Furthermore, sequences from the first element of all Sp185/333 sequences were under positive selection. However, Sp185/333 with C1, A2, and E1 element patterns were under negative selection (dn/ds<1). The mechanisms that generate the high variability in Sp185/333 sequences are unknown. However, gene conversion and DNA recombination driven by microsatellites that flank Sp185/333 genes have been purported as possible mechanisms that promote gene diversification [19], [20]. Post-transcriptional processing of Sp185/333 mRNAs is also thought to contribute to diversity after their synthesis [21]. The deduced Sp185/333 polypeptides carry a predicted signal peptide, an N-terminal glycine-rich, a C-terminal histidine-rich region and patches of acidic residues [16]. The Sp185/333 proteins include up to six different types of tandem and interspersed repeats [19] and several conserved N- and O- linked glycosylation sites [16]. Almost all have an RGD motif and lack cysteine residues. De novo predictions point to the lack of discernible secondary and tertiary structures, including the absence of known functional domains. Sp185/333 proteins are localized to the cell surface of small phagocytes and are present in peri-nuclear vesicles of both small and polygonal phagocytes [22]. It has been speculated that Sp185/333 proteins may play a role in cell-cell interactions to form syncytia and initiate encapsulation of invading pathogens [22]. Although genome sequencing projects indicate the presence of 185/333 homologues in other sea urchins, only the Sp185/333 gene family has been characterized to-date [15]–[20], [22]–[25]. We report here the He185/333 genes, transcripts and proteins in coelomocytes of the sea urchin, Heliocidaris erythrogramma. This family exhibits characteristic features of the Sp185/333 family and the striking sequence diversity of the genes and proteins are common to both families. Full-length He185/333 genes and transcripts possess element patterns, SNPs, short indels, as well as tandem and interspersed repeats. He185/333 proteins show a broad range of diversity in sizes and pIs and are expressed on the surfaces of some coelomocytes. Although He185/333 and Sp185/333 share many attributes, there are a few substantial differences between them. For example, He185/333 sequences tend to be shorter than Sp185/333 sequences. He185/333 sequences also consist of element patterns that are not found amongst the Sp185/333 sequences. There are also significant differences in intron structures, codon diversity, sequence repeats, amongst others.

Materials and Methods

All reagents were purchased from Sigma Aldrich or Amresco, unless otherwise indicated.

Sea urchins

All animals were collected according the rules indicated in the scientific collection permit (permit number F95/403–7.1) issued to Macquarie University by the NSW Department of Primary Industries, Australia. Heliocidaris erythrogramma specimens were collected at Clifton Gardens in Sydney Harbour and maintained at 22°C in the Macquarie University sea water facility in 50-liter tubs with continuous recycling of sea water from Sydney Harbor. Sea urchins were fed once a week with fresh algae that was collected from Sydney Harbour. All necessary permits were obtained for the described field studies.

Immune challenge and extraction of coelomic fluid

As described previously [24], between 0.5 ml and 25 n class="Disease">ml of coelomic fluid was harvested from each animal and mixed with an equal volume of ice-cold calcium- and magnesium-free sea water (CMFSW-EI; 460 mM sodium chloride, 10.73 mM potassium chloride, 7.04 mM disodium sulfate, 2.38 mM sodium hydrogen carbonate) with 30 mM EDTA and 50 mM imidazole, pH 7.4. Coelomocytes were pelleted (1200–5000×g for 4 min at 4°C) and washed in CMFSW-EI before further processing. When required, sea urchins were challenged with 1.2×108 heat-killed E. coli cells (inoculum volume of 0.2 ml) per animal for 24 h or 48 h (for subsequent protein extraction and microscopy) prior to harvesting coelomic fluid.

Total RNA and DNA isolation

Coelomocytes collected from sea urchins 24 hr after challenge with E. coli were pelleted and extracted using TRI Reagent® (Molecular Research Center Inc.) for RNA and DNA isolation according to the manufacturer's instructions. The extracted RNA and DNA were each dissolved in 50 µl of nuclease free water. The quality of RNA was determined by formaldehyde agarose gel electrophoresis [26], while DNA quality was assessed by standard agarose gel electrophoresis. RNA quality was considered good when formaldehyde agarose gels showed 18 S and 28 S ribosomal RNA bands, without smears. DNA preparations that contained high molecular weight (MW) DNA, without smearing, were considered to be of good quality.

RT-PCR

RT-PCR was carried out with 0.05–3 µg of total RNA, using either Superscript III (Invitrogen) or PowerScript reverse transcriptase (Clontech) in conjunction with SpAncRT or SMARTIV and CDIII (Clontech) oligonucleotides (Table 1). All RT-PCR procedures were carried out in accordance with manufacturers' protocols. Both the 5′ and 3′ oligonucleotides used in reverse transcription reactions provided binding sites for primers used in PCR amplifications.
Table 1

Oligonucleotides used in RT-PCR, PCR and sequencing.

LetterNameFunctionSequence (5′– 3′)
ASMARTIV Oligo5′ linker used in RT-PCR AAGCAGTGGTATCAACGCAGAGTGGCCATTACGGCCGGG
BCDSIII 3′ PCR primer3′ linker used in RT-PCR and as generic 3′ PCR primerATTCTAGAGGCCGAGGCGGCCGACATGd(T)30N-1N
CSpAncRT3′ linker used in RT-PCRACTATCTAGAGCGGCCGC(T)16V
DSMARTIVPCRF5′ PCR primer, binds to SMARTIV Oligo AAGCAGTGGTATCAACGCAGAGT
ESpR13′ PCR primer, binds to SpAncRT ACTATCTAGAGCGGCCGCTT
F185F5 Sp185/333 forward primerGGAACYGARGAMGGATCTC
G185R6 Sp185/333 reverse primerGCAGCATCAGTTTCTTCKTCTC
HMRHE1855′UTRF1 He185/333 5′ UTR primer GCTAGTTCTCTCTTGGAAGCTGGACGA
IMRHE1855′UTRF4 He185/333 5′ UTR primer TCTCTTGGAAGCTGGACGAA
JMRHE1855′UTRF2 He185/333 5′ UTR primer TGGAAGCTGGACGAAGGGAAAGGA
KMRHE185R6 He185/333 3′ UTR primer TGGAAAAGACATCAGTGACA
LMRHE185R9 He185/333 3′ UTR primer CTTTCAGGAATGTAATTGTCTTGAT
MMRHE185R10 He185/333 3′ UTR primer CTGCAATTTTTCTACAAACTCA
MRPGEMTM13FForward sequencing primer CGCCAGGGTTTTCCCAGTCACGAC
MRPGEMTM13RReverse sequencing primer TCACACAGGAAACAGCTATGAC

The letters in the first column refer to the primer binding sites indicated in Fig. S1.

The letters in the first column refer to the primer binding sites indicated in Fig. S1.

He185/333 PCR amplification optimization

PCR amplification of 185/333 sequences was carried out in 50 μl reactions using the Advantage 2 PCR system (Clontech) or Phusion DNA polymerase (Finnzymes). Each reaction consisted of 0.2 μM dNTPs, 0.4 µM of each primer (Table 1) and 1 µl of RT-PCR reaction or gDNA as template. The cycling parameters were as follows; for Advantage 2, an initial denaturation at 94°C for 2 min, followed by 35 cycles of denaturation at 94°C for 30 s, annealing at 60°C for 30 s and extension at 72°C for 3 min followed by a final extension at 72°C for 5 min. For amplification using Phusion DNA polymerase, the following conditions were used: an initial denaturation at 98°C for 1.5 min, followed by 35 cycles of denaturation at 98°C for 15 s, annealing at 60°C for 20 s and extension at 72°C for 20–40 s, followed by a final extension at 72°C for 3 min. Amplification products were analyzed by agarose gel electrophoresis.

Amplification strategy

Attempts to amplify He185/333 sequences from H. erythrogramma using Sp185/333 primers [16] were not successful. This was not unexpected, as the diversity of 185/333 sequences creates formidable barriers to amplification, especially when applied across species. Thus, a modified rapid amplification of cDNA ends (RACE) strategy was conducted (Fig. 1): Linker sequences at the 5′ (SMARTIV oligo) and 3′ (CDSIII) ends of the double stranded He185/333 cDNAs provided annealing sites for PCR primers. Primers (5′ SMARTIV primer and 3′ CDSIII or 3′ SpR1) specific to the linker regions were used in combination with Sp185/333 primers to generate partial He185/333 sequences (5′ and 3′ ends) that in turn enabled primers specific to He185/333 UTRs to be designed (MRHE1855UTRF1, MRHE1855UTRF2, MRHE5UTRF4, MRHE185R6, MRHE185R9, MRHE185R10; see Table 1). By using these primers in PCR reactions, full length (i.e. complete ORFs) He185/333 cDNA and gDNA sequences were amplified from H. erythrogramma. Those PCR primers were designed to bind to highly conserved nucleotide stretches in the UTRs and the leader/element 1 regions. Although this approach allowed us to identify more than 100 unique He185/333 sequences (see Results), He185/333 sequences that contain variant UTRs, if present, will not be identified. Despite this, the population of unique He185/333 sequences that we identified was sufficiently large for this study.
Figure 1

Element patterns of He185/333 cDNAs.

A. A total of 26 distinct elements (1–26 and leader (L) – see consensus pattern in the top row of the alignment) have been identified amongst He185/333 sequences, and these are arranged into 28 unique element patterns. A horizontal line indicates elements that are “missing”. The locations of sequence repeats are shown at the bottom of the figure. The numbers at the bottom of the alignments indicate nucleotide positions. B. Element patterns of He185/333 cDNAs with mutations. Sequences with the element patterns E, I, P, Q, U, L, M contained insertions, deletions or point mutations, resulting in frame shifts and/or early stop codons. Mutations are marked by black lined yellow arrowheads, early stop codons as red bars across an element. Arrowheads falling together with bars are cases of stop codons caused by point mutations, as seen in the three lower element patterns. Arrowheads and bars that are located apart from each other are cases of insertions or deletions, resulting in frame shifts and downstream early stop codons. Elements between mutations and early stop codons contain black central lines to point out missense translations, due to the frame shift. Elements after early stops are patterned with white centres to highlight non-translated regions of the cDNAs.

Element patterns of He185/333 cDNAs.

A. A total of 26 distinct elements (1–26 and leader (L) – see consensus pattern in the top row of the alignment) have been identified amongst He185/333 sequences, and these are arranged into 28 unique element patterns. A horizontal line indicates elements that are “missing”. The locations of sequence repeats are shown at the bottom of the figure. The numbers at the bottom of the alignments indicate nucleotide positions. B. Element patterns of He185/333 cDNAs with mutations. Sequences with the element patterns E, I, P, Q, U, L, M contained insertions, deletions or point mutations, resulting in frame shifts and/or early stop codons. Mutations are marked by black lined yellow arrowheads, early stop codons as red bars across an element. Arrowheads falling together with bars are cases of stop codons caused by point mutations, as seen in the three lower element patterns. Arrowheads and bars that are located apart from each other are cases of insertions or deletions, resulting in frame shifts and downstream early stop codons. Elements between mutations and early stop codons contain black central lines to point out missense translations, due to the frame shift. Elements after early stops are patterned with white centres to highlight non-translated regions of the cDNAs.

Cloning and sequencing of PCR products

Amplicons from PCR reaction mixes or amplicons separated by agarose gel electrophoresis were purified with the PCR purification or QIAquick gel extraction kits according to the manufacturer's instructions (Qiagen) and eluted in 30 µl or 50 µl of 10 mM Tris-HCl, pH 8.0. The DNA was quantified by spectrophotometry. Purified DNA were ligated to pGEM T-Easy Vectors (Promega) overnight at 4°C and subsequently used to transform chemically competent One Shot® Top Ten (Invitrogen) or JM109 (Promega) E. coli cells according to standard protocols. Transformed bacterial culture (200 µl) were plated on pre-warmed LB-Agar plates with 100 μg/ml ampicillin, 50 μg/ml X-Gal and 0.5 mM IPTG, and incubated overnight at 37°C. Plasmids were isolated from overnight cultures of E. coli using the QIAprep miniprep kit (Qiagen) according to the manufacturer's instructions. Purified plasmids were eluted in 50 µl of 10 mM Tris-HCl, pH 8.0 and evaluated by spectrophotometry and agarose gel electrophoresis. DNA inserts were sequenced at the Australian Genome Research Facility (AGRF, University of Brisbane, Queensland). Inserts were sequenced in both the forward and reverse directions with MRPGEMTM13F and MRPGEMTM13R sequencing primers (Table 1).

Analysis of DNA sequences

After removing vector and primer sequences computationally, the forward and reverse sequences for each cloned insert were aligned using the BioEdit sequence alignment editor [27]. Homology searches were performed using nucleotide BLAST [28]. Sequences homologous to Sp185/333 were aligned with ClustalW2 (default parameters, nucleotide sequences: gap initiation penalty  = 3, gap extension penalty  = 1, base match score  = 2, base mismatch penalty  = 1; amino acid sequences: gap initiation penalty  = 8, gap extension penalty  = 2; see Refs. [29], [30]) and the alignments were further edited manually in BioEdit.

Immunofluorescence labeling and confocal microscopy

Coelomocytes were collected from sea urchins 48 hrs after challenge with E. coli. The density of coelomocytes in the final suspension was determined using a Neubauer Cell haemocytometer and adjusted to 1×106 cells/ml with CMFSW-EI (on ice). The cell suspension (100 µl) was pipetted onto glass slides and cells were allowed to settle and adhere to the slide surface for 5 min. Cells were fixed at 17°C in 0.5%–1% paraformaldehyde (PFA) in CMFSW-EI in a two-step procedure: (i) in 0.5% PFA for 15 min, (ii) 1% PFA for 15 min. After three washes in CMFSW-I, cells were permeabilized with 0.025% Triton X100 in CMFSW-I for 3 min followed by three washes for 5 min each. Non-specific epitopes were blocked with heat inactivated horse serum for 30 min at 17°C before the primary rabbit antisera mix was added for 1 h at 17°C. The primary antisera mix contained three polyclonal antibodies, anti-Sp185–66, anti-Sp185–68 and anti-Sp185–71 (each diluted 1:10,000 in CMFSW-I, kindly provided by L. Courtney Smith), which targeted the N-terminal-, central- and C-terminal- 185/333 regions [22]. The antibodies were raised in rabbits against synthetic peptides corresponing to those regions. The anti-Sp185/333 antibodies cross react with the He185/333 proteins as described [24]. After 3 washes, slides were incubated for 1 h in the dark at 17°C in a cocktail consisting of secondary antibody (mouse anti rabbit IgG-Alexafluor 546 conjugate), actin counterstain (phalloidin-Alexafluor 488 conjugate) and/or nuclear counterstain (Toto; all dyes from Invitrogen). Slides were washed three times in CMFSW-I. Finally, Biomeda Gel Mount (ProSciTech) was added, a coverslip overlaid and sealed with nail polish, and the slides stored at 4°C until analyzed on the Fluoview 300 laser scanning confocal microscope (Olympus).

Protein extraction

Total protein from coelomocytes was extracted and purified for subsequent SDS-polyacrylamide gel electrophoresis (SDS-PAGE). Total coelomic fluid (12.5–25 ml depending on the size of the sea urchin) was collected after removal of Aristotle's Lantern and coelomocytes were pelleted at 3000×g for 5 min at 4°C. The cell pellet was lysed in lysis buffer (5 ml; 7 M urea, 2 M thiourea, 1% 3-[4-heptyl]phenyl-3-hydroxypropyldimethylammoniopropanesulfo-nate [ASB-C7BzO], 40 mM Tris base, 15 mM acrylamide [Bio-Rad], 10 mM tributyl phosphine [TBP], and 1x complete protease inhibitors [Roche]) using a French press (Thermo Spectronic). The lysate was incubated for 1 h at room temperature to allow complete reduction and alkylation of cysteines. Cell debris was pelleted by centrifugation for 10 min at 5000×g, the supernatant was transferred to a fresh tube and proteins were precipitated for 30 min at room temperature with five volumes of acetone and centrifuged for 10 min at 5000×g. The acetone supernatant was decanted, the pellet was air dried for 5 min and dissolved in 0.5–1.5 ml of sample buffer (7 M urea, 2 M thiourea, 1% ASB-C7BzO). Finally, the protein solutions were desalted using Micro Biospin tubes (Bio-Rad) and the eluates stored at −20°C.

Protein assay

Proteins were quantified using the Non Interfering™ Protein Assay kit (G-Biosciences) according to the manufacturer's instructions. BSA was used as the protein standard reference.

SDS polyacrylamide gel electrophoresis (SDS-PAGE)

SDS-n class="Chemical">polyacrylamide gels (10%) were loaded with 20 μg protein/lane and separated for an initial 10 min at 100 V followed by 80 min at 150 V and stained with Coomassie blue silver stain (20% methanol, 10% (w/v) ammonium sulfate, 1.6% orthophosphoric acid, 0.15% (w/v) Coomassie G250). Other gels were loaded with 10 μg proteins per lane followed by Western blotting (see below). Either Broad Range or Precision Plus protein markers (Bio-Rad) were used as size standards.

Western blotting and immunodetection

Proteins were blotted onto polyvinylidene fluoride membranes for 1 h at a constant current of 2 mA/cm2 in a Transblot semidry transfer cell (Bio-Rad) followed by two washes in Tris buffered saline (TBS buffer, 20 mM Tris-HCl, pH 7.5, 150 mM sodium chloride) for 10 min each at room temperature, blocking of the membrane at 4°C overnight in TBS buffer containing 10% skim milk powder (block buffer), three washes at room temperature in TBS-Tween/Triton buffer (TBS buffer, 0.05% (v/v) Tween 20, 0.2% (v/v) Triton X-100) and incubation with the primary antibody (equal mix of anti-185/333 antisera diluted 1∶10000 in block buffer). This was followed by three washes in TBS-Tween/Triton buffer for 10 min each at room temperature and incubation in the secondary antibody (goat anti rabbit IgG Alkaline Phosphatase conjugate, 1∶20000 in block buffer), followed by three final washes in TBS-Tween/Triton buffer. Protein-antibody complexes were visualized by colour reaction with 3 ml BCIP/NBT per 150 cm2 membrane area for 2–5 min at room temperature and photographed with a digital camera (Canon EOS 40 d).

Phylogenetic analyses

Twenty-five randomly chosen 185/333 cDNA sequences from each species, H. erythrogramma and S. purpuratus, were aligned in ClustalW with default parameters and the alignment was further refined manually in BioEdit. Phylogenetic analyses were performed in PAUP*4.0b10 [31] using character based, distance-based and model-based (Maximum Parsimony, MP; Neighbor-joining, NJ and Maximum Likelihood, ML) methods of analysis. For MP analysis, a heuristic search strategy was employed to identify the most parsimonious tree. All characters were treated as unordered and un-weighted, while gaps were treated as missing data. Bootstrap re-sampling based on 1000 replicates was used to assess the support of relationships for the majority-rule consensus tree. For the NJ and ML phylogenetic analyses MODELTEST v.3.06 [32] was used to estimate the most likely model of sequence evolution for the sequence data. Based on the Akaike Information Criterion (AIC), Tamura-Nei (+G) was selected as the most likely model of sequence evolution for 185/333. Corrected genetic distances based on 2025 positions in the alignment were calculated in PAUP*4.0b10. NJ and ML trees were obtained in PAUP*4.0b10 using model parameters specified by MODELTEST and NJ was also assessed with 1000 bootstrap replicates.

Diversity analysis

The diversity of He185/333 sequences was determined from their alignments using the HyPhy suite of algorithms that were accessed via Datamonkey [33], [34]. Unique, full-length He185/333 cDNA sequences were processed to remove 5′ and 3′ untranslated regions (UTRs). As there were 112 He185/333 sequences in our dataset, we customized our analytical approach to circumvent data processing restrictions on Datamonkey, which will only process a maximum of 100 sequences at a time. We developed a custom script to randomly select 100 He185/333 sequences from our dataset for the analysis. These sequences were aligned using ClustalW [29] as described above and uploaded to Datamonkey for diversity analysis. Each alignment was subjected to automatic nucleotide substitution model detection, generation of NJ trees and then SLAC (Single Likelihood Ancestor Counting, see Ref. [35]), FEL (Fixed Effects Likelihood, see Ref. [35]), IFEL (Internal Fixed Effects Likelihood, see Ref. [36]) analyses. The diversity scores were considered to be significant at a confidence interval of p≤0.1. The final diversity score for He185/333 sequences was the consensus of the data output from all three analytical algorithms (SLAC, FEL and IFEL). This was repeated a further nine times (i.e. a total of ten sets of sequences, each containing 100 sequences, were analyzed) and a consensus diversity score was generated. A similar analysis was conducted on 231 Sp185/333 cDNA sequences so that the data from the two families of 185/333 sequences could be compared.

Results

He185/333 cDNA sequences

A total of 112 unique full-length cDNAs were obtained. BLAST searches revealed significant homology of all sequences only to Sp185/333 mRNAs and genes, with sequence identity of 68% to 74%. All cDNAs contained an open reading frame (ORF) of 219 to 1050 nucleotides, a Kozak consensus sequence (5′-CAGACATGG-3′; see Ref. [37]) and an in-frame stop codon. Optimal alignment of the 112 He185/333 revealed conserved sequence blocks or sequence elements (Fig. 1A and S2), a feature associated with 185/333 sequences. Each element has a conserved sequence and amongst the 112 He185/333 sequences that were characterised in this study, a total of 31 different elements were identified. The shortest elements were 15 bp in length (elements 7, 11, 14, 16, 26, 27, 28 and 30), while the largest one was 111 bp long (element 21). Each 185/333 sequence is composed of a mosaic of elements, which is referred to as an element pattern. 29 distinctive element patterns were evident amongst the He185/333 sequences (alphabetically labelled A–AC, Fig. 1A). In our library, all except for six element patterns were singletons; A (12 clones), E (41), R (2), S (3), W (30) and Y (2). Depending on the primers that were used, regions of up to 33 bp of the 5′ UTRs and up to 105 bp of the 3′UTRs were amplified (note: the location of the 5′UTR was based on the alignment of the He185/333 sequences with Sp185/333 sequences, especially with the region surrounding the initiating codon). One partial He185/333 cDNA contained the 3′end of the ORF and an entire 3′UTR including the polyadenylation signal sequence (PAS, 5′-ATTAAA-3′) was located 185 bp downstream of the stop codon and 21 bp upstream of the poly A-tail (data not shown). Of the 112 cDNA sequences, 11 had early stop codons and/or frame shifts resulting from indels or point mutations (Fig. 1B) and encode truncated polypeptides, some with missense sequence.

He185/333 gDNA sequences

To date, 39 unique genes were sequenced, and these varied in length between 1261 bp and 2301 bp (Fig. 2 and S3). They consisted of two exons, the first and shorter of which was 55 bp long (excluding the putative 5′ UTR, of which 33 bp were amplified). The size of the larger second exon ranged from 749 bp to 905 bp (excluding the 3′ UTR, of which either 30 bp or 105 bp were amplified, depending on the primers used in PCRs). The intron ranged in size from 457 bp to 1392 bp. The element patterns in the second exon matched the cDNA element patterns A, E, I, W and Y (Fig. 2B). An additional element pattern, AC, which was not identified in the library of cDNA sequences was found among the gDNA sequences. Element patterns were also evident in the introns (Fig. 2B). A total of 10 intron elements (i1– i10) were identified and these were in four recognizable intron element patterns (alpha (α), beta (β), gamma (γ) and delta (δ)). The intron patterns, when combined with exon patterns, form nine gene element patterns; E-α, AC-α, W-α, Y-α, E-β, R-β, W-β, E-γ and W-δ.
Figure 2

He185/333 gene structure.

A. Genes consist of a short exon 1 and a longer exon 2, separated by one intron. The leader is 63 bp in length and is interspersed between positions 55/56 by the Intron. Thus, the leader represents exon 1 (excluding the 5′UTR) but also forms the first eight nucleotides of the second exon. The intron varies in size between 457 bp and 1392 bp. The second, long exon ranges from 749 bp to 905 bp (excluding the 3′UTR) and contains the mosaic organisation of elements. The 5′ and 3′ UTRs of He185/333 genes have only been partially sequenced. B. Element patterns of 39 manually aligned gDNA sequences. i. The coding regions (exons 1 and 2) are interspersed by one intron, dividing the leader in two parts, as indicated at the top of the diagram. Genes identified to-date show the five exon element patterns E, I, R, W and Y as described for cDNAs in figure 1A. Introns are simplified by interrupted, checkered boxes. The consensus at the top of the diagram is based on all element patterns, including cDNA element patterns as shown in figure 1A. ii. Similar to exons, introns align optimally with insertion of large gaps, resulting in ten intron elements and four intron element patterns, designated alpha (α), beta (β), gamma (γ) and delta (δ). Individual intron elements are named i1 to i10 and are shown as differently shaded gray boxes. Exons are represented as fading extensions to the left and right of intron element patterns. i & ii. Combinations of exon and intron element patterns define gene element patterns of which the following nine have been identified among the 39 gene sequences (number of individual sequences with according gene element pattern in brackets: E-α (11), I-α (2), W-α (8), Y-a (1), E-β (2), R-β (2), W-β (1), E-γ (10), W-δ (2). The first element pattern is the consensus.

He185/333 gene structure.

A. Genes consist of a short exon 1 and a longer exon 2, separated by one intron. The leader is 63 bp in length and is interspersed between positions 55/56 by the Intron. Thus, the leader represents exon 1 (excluding the 5′UTR) but also forms the first eight nucleotides of the second exon. The intron varies in size between 457 bp and 1392 bp. The second, long exon ranges from 749 bp to 905 bp (excluding the 3′UTR) and contains the mosaic organisation of elements. The 5′ and 3′ UTRs of He185/333 genes have only been partially sequenced. B. Element patterns of 39 manually aligned gDNA sequences. i. The coding regions (exons 1 and 2) are interspersed by one intron, dividing the leader in two parts, as indicated at the top of the diagram. Genes identified to-date show the five exon element patterns E, I, R, W and Y as described for cDNAs in figure 1A. Introns are simplified by interrupted, checkered boxes. The consensus at the top of the diagram is based on all element patterns, including cDNA element patterns as shown in figure 1A. ii. Similar to exons, introns align optimally with insertion of large gaps, resulting in ten intron elements and four intron element patterns, designated alpha (α), beta (β), gamma (γ) and delta (δ). Individual intron elements are named i1 to i10 and are shown as differently shaded gray boxes. Exons are represented as fading extensions to the left and right of intron element patterns. i & ii. Combinations of exon and intron element patterns define gene element patterns of which the following nine have been identified among the 39 gene sequences (number of individual sequences with according gene element pattern in brackets: E-α (11), I-α (2), W-α (8), Y-a (1), E-β (2), R-β (2), W-β (1), E-γ (10), W-δ (2). The first element pattern is the consensus.

Deduced polypeptide sequences

The deduced polypeptides had between 72 and 349 aa with predicted MW ranging from 8 to 39 kDa and the predicted isoelectric points (pIs) ranged from 4.63 to 6.99. The first 21 aa represented a predicted signal sequence (see Ref. [38] and Fig. 3), suggesting an extracellular destination of the He185/333 proteins. At the same time the He185/333 proteins were predicted to lack both transmembrane regions [39] and canonical signatures of glycosylphosphatidylinositol-anchors [40]. The deduced polypeptides also contained up to ten potential N- and one O-linked glycosylation sites [41] and a total of 16 potential serine-, two threonine- and one tyrosine-phosphorylation sites were predicted [42]. The translated sequences included an N-terminal glycine-rich and a central histidine-rich region. The predicted polypeptides were also rich in arginine, which were evenly distributed along the polypeptide and typically constituted 11%–12% of total number of amino acids. The histidine rich region contained a poly-histidine stretch of at least six, but usually more (8 to 13) consecutive residues. Common web-based programs did not predict extensive secondary structures or folding patterns.
Figure 3

Structural overview of deduced consensus of He185/333 polypeptides.

Approximate amino acid positions are given at the top, amino/carboxy-terimini are labeled with N and C to the left and right of the consensus, respectively. Polypeptides carry a signal sequence at the N-terminus, followed by glycine-rich and histidine-rich regions. Potential phosphorylated serine, threonine and tyrosine residues are marked with S, T and Y respectively and potential N- and O-linked glycosylations with N and O, respectively. Repeats, as shown for cDNA element patterns in figure 2A and in table S2, are shown at the bottom and are labeled with repeat type followed by copy number.

Structural overview of deduced consensus of He185/333 polypeptides.

Approximate amino acid positions are given at the top, amino/carboxy-terimini are labeled with N and C to the left and right of the consensus, respectively. Polypeptides carry a signal sequence at the N-terminus, followed by glycine-rich and histidine-rich regions. Potential phosphorylated serine, threonine and tyrosine residues are marked with S, T and Y respectively and potential N- and O-linked glycosylations with N and O, respectively. Repeats, as shown for cDNA element patterns in figure 2A and in table S2, are shown at the bottom and are labeled with repeat type followed by copy number.

Repeats

We found four types of tandem and interspersed sequence repeats in 104 of the 112 185/333 deduced polypeptide sequence, named types 1 to 4 (Fig. S4 and S5) and were comparable to five repeat types in S. purpuratus (Fig. S6). Eight sequences that contained non-synonymous substitutions and frameshift mutations (sequences He_185/333_cDNA_105–112) were omitted in the analysis of sequence repeats because major parts of their deduced amino acid sequence were not homologous to 185/333 proteins. Most of the He185/333 repeats were homologous to repeats found in S. purpuratus but varied in the maximum repeat copy numbers and in their length.

Phylogenetic analysis

As 185/333 sequences are members of a diversifying gene family [15]–[19], [21], the identification of these sequences in a second species (H. erythrogramma) enabled us to compare the sequence similarity amongst 185/333 sequences from these two animal groups. Analysis of the phylogenetic relationships between unique He185/333 and Sp185/333 cDNAs indicates that the sequences clustered according to the species from which they derived (Fig. 4). Of the 2025 bp of the aligned sequences, 418 characters were variable and 287 were parsimony informative. The Tamura-Nei corrected genetic distances ranged from 0.00216 to 0.07705 for He185/333 and from 0.00115 to 0.12781 for Sp185/333 (Table S2). The genetic distances between He185/333 and Sp185/333 were significantly greater and ranged from 0.27949 to 0.38071. Moreover, groups of 185/333 within each species clustered separately from one another in branches with well-supported bootstrap values, indicating presence of subfamilies that may have originated by duplication and divergence from a common founding member.
Figure 4

Phylogenetic relationship between 25 He185/333 and Sp185/333 cDNAs.

He185/333 clades are highlighted in a darker shade than Sp185/333 clades. The phylogenetic tree shows clearly that 185/333 sequences cluster according the species they originated from. The main branch separating the two clades was shortened for display purposes (dashed line). It is representative of the corrected genetic distance of 0.27949 and is supported by 100% of bootstraps. Hence, all sequences within one species had lower genetic distances to each other (highest value 0.07705 for He185/333 and 0.12781 for Sp185/333, respectively) than to any sequence from the opposite species. Boot Strap values are shown next to the branches with the ordering NJ/MP. Values below 50 are not displayed.

Phylogenetic relationship between 25 He185/333 and Sp185/333 cDNAs.

He185/333 clades are highlighted in a darker shade than Sp185/333 clades. The phylogenetic tree shows clearly that 185/333 sequences cluster according the species they originated from. The main branch separating the two clades was shortened for display purposes (dashed line). It is representative of the corrected genetic distance of 0.27949 and is supported by 100% of bootstraps. Hence, all sequences within one species had lower genetic distances to each other (highest value 0.07705 for He185/333 and 0.12781 for Sp185/333, respectively) than to any sequence from the opposite species. Boot Strap values are shown next to the branches with the ordering NJ/MP. Values below 50 are not displayed. Within the H. erythrogramma clade, there was a correlation between the sequence clusters and the element patterns of the He185/333 sequences within those clusters. Three distinct clusters were evident: one cluster consisted exclusively of sequences with exon element pattern W (sequences HE085, HE045, HE041, HE037 and HE033), while the second contained sequences with element patterns E, F, M and O (sequences HE061, HE054, HE081, HE078, HE049, HE029, HE017, HE013, HE005, HE021, HE009, HE001 and HE057). The third cluster, which was most diverse in terms of the element patterns, contained the patterns A, C, G and S (sequences HE097, HE093, HE089, HE073, HE069, HE065 and HE025). A total of 112 unique He185/333 cDNAs were analyzed using the HyPhy suite via Datamonkey to detect diversity and selection pressure at the level of individual codons (Fig. 5, and table S3). The consensus output from SLAC, FEL and IFEL identified 17 codons (4.6%) that were under negative selection, while nine codons (2.5%) were under positive selection (p<0.1). In comparison, the Sp185/333 sequences had 64 codons (11%) under negative selection and 15 codons (2.6%) under positive selection. While positively and negatively selected sites were evenly distributed along the length of the He185/333 alignments, 39 of the 64 negatively selected sites were located within the first 200 codons of the 581 codon Sp185/333 alignment, while only six sites were located in the last 200 codons. Positively selected sites also appeared to cluster within the first 200 codons, with eleven of the 15 positively selected sites present.
Figure 5

A comparison of codon diversification between S. purpuratus and H. erythrogramma 185/333 cDNA alignments.

Sequence alignments of 231 S. purpuratus and 112 H. erythrogramma cDNAs were used to investigate recombination and selective pressure at the codon level. Element patterns are shown as black and white banding, while positively- and negatively-selected codons are shown as green and red boxes above and below each alignment, respectively. Negative selection (against codon diversification) appears to be prevalent across 185/333 sequences from both species. Significant (p<0.1) negative selection was detected in 64 codons across the 581 codon-long S. purpuratus alignment, while 15 codons were positively-selected. The 360 codon-long H. erythrogramma alignment contained 17 codons under significant negative selective pressure and nine codons with positive selective pressure. S. purpuratus element patterns adapted from [16].

A comparison of codon diversification between S. purpuratus and H. erythrogramma 185/333 cDNA alignments.

Sequence alignments of 231 S. purpuratus and 112 H. erythrogramma cDNAs were used to investigate recombination and selective pressure at the codon level. Element patterns are shown as black and white banding, while positively- and negatively-selected codons are shown as green and red boxes above and below each alignment, respectively. Negative selection (against codon diversification) appears to be prevalent across 185/333 sequences from both species. Significant (p<0.1) negative selection was detected in 64 codons across the 581 codon-long S. purpuratus alignment, while 15 codons were positively-selected. The 360 codon-long H. erythrogramma alignment contained 17 codons under significant negative selective pressure and nine codons with positive selective pressure. S. purpuratus element patterns adapted from [16].

He185/333 protein expression profile

Western blots identified a broad range of MW for He185/333 proteins, ranging from expected values for monomers deduced from cDNA sequences to MW greater than 206 kDa (Fig. 6A). The majority of He185/333 positive bands were greater than 75 kDa, and their MW were not altered by the strong reducing agent TBP. There were considerable variations in the repertoires (relative sizes and intensities on Western blots) of He185/333 proteins between different individual sea urchins (Fig. 6A). Such variations in He185/333 protein repertoires were also evident within individuals after they were injected with heat-killed bacteria, filtered sea water or sterile needle injury (Fig. 6A).
Figure 6

Total coelomocyte proteins from five sea urchins were analysed by Western blotting (A) and SDS-PAGE (B).

Coelomocyte proteins were extracted from animals either before (pre-) or after (post-) immunological challenge with heat killed bacteria. Other treatments included injections with filtered sea water (FSW) and injury (pricked with a sterile needle). In both panels A and B, lanes with odd numbers (1, 3, 5, 7 and 9) show pre-challenged protein profiles while lanes with even numbers (2, 4, and 6) show post-challenge protein profiles. Lanes 8 and 10 show the profiles after filtered sea water injection and Injury, respectively. Asterisks to the right of the figures indicate regions that are not stained with Coomassie Blue (B), which contain He185/333 + bands in the Western blot. A. The Western blot shows a diverse pattern of He185/333 proteins between animals but also changes within individuals before and after immunological challenge, FSW injection and injury. Bands on the blot are not as discrete and sharp as their corresponding bands on the Coomassie Blue stained gel, but appear to be rather diffuse and large. Arrows between pre- and post-challenged samples indicate bands that change in intensity or are present/absent as a result of the experimental treatment. B. The Coomassie Blue stained gel shows discreet, sharp protein bands, some of which differ in size and intensity between animals and within individuals before and after immune challenge. None of the bands, however, could unambiguously be identified as He185/333 + band when compared to the Western blot.

Total coelomocyte proteins from five sea urchins were analysed by Western blotting (A) and SDS-PAGE (B).

Coelomocyte proteins were extracted from animals either before (pre-) or after (post-) immunological challenge with heat killed bacteria. Other treatments included injections with filtered sea water (FSW) and injury (pricked with a sterile needle). In both panels A and B, lanes with odd numbers (1, 3, 5, 7 and 9) show pre-challenged protein profiles while lanes with even numbers (2, 4, and 6) show post-challenge protein profiles. Lanes 8 and 10 show the profiles after filtered sea water injection and Injury, respectively. Asterisks to the right of the figures indicate regions that are not stained with Coomassie Blue (B), which contain He185/333 + bands in the Western blot. A. The Western blot shows a diverse pattern of He185/333 proteins between animals but also changes within individuals before and after immunological challenge, FSW injection and injury. Bands on the blot are not as discrete and sharp as their corresponding bands on the Coomassie Blue stained gel, but appear to be rather diffuse and large. Arrows between pre- and post-challenged samples indicate bands that change in intensity or are present/absent as a result of the experimental treatment. B. The Coomassie Blue stained gel shows discreet, sharp protein bands, some of which differ in size and intensity between animals and within individuals before and after immune challenge. None of the bands, however, could unambiguously be identified as He185/333 + band when compared to the Western blot. Interestingly, He185/333-positive bands on 1DE Western blots could not be associated with specific bands on Coomassie-stained gels. In fact, strong He185/333 signals on Western blots were associated with non-stained areas on Coomassie gels (Fig. 6A and 6B). Dheilly et al. also noted similar observations of Sp185/333 proteins [24]. This is thought to be due to the chemistry of protein-dye interactions: the post-translational modifications of the 185/333 proteins are believed to interfere with Coomassie blue interacting with those proteins, resulting in a poor alignment of Coomassie stained 185/333 proteins and the corresponding bands on Western blots (see Ref. [24] and asterisks in Fig. 6A and 6B). 2DE Western blots showed a diverse range of MW and isoelectric points (data not shown), and were very similar to those of Sp185/333 proteins [24]. Disparities between observed MW and pI and those predicted from He185/333 sequences were observed. This suggests that He185/333 proteins are post-translationally modified. Furthermore, the protein spots were arranged in trains, an effect often associated with differential glycosylation [24].

Localization of He185/333 proteins in coelomocytes

Immunofluorescence confocal microscopy showed that He185/333 expression was present in two distinct coelomocyte subpopulations: filopodial and lamellipodial amoebocytes (Fig. 7). These coelomocytes are morphologically and functionally (phagocytosis) equivalent to the corresponding cell types in S. purpuratus [25], [43]. Z-stack analysis of the images indicated that the majority of the He185/333 proteins were located on the plasma membranes (data available on request). In some instances, He185/333 proteins were detected in perinuclear areas of large filopodial cells (Fig. 7C), which may reflect their distribution within the organelles involved in protein biosynthesis (e.g. endoplasmic reticulum, Golgi apparatus and transport vesicles). He185/333-specific immunofluorescence on amoebocyte surfaces appears to be patchy (Fig. 7A–D), suggesting that the distribution of He185/333 proteins may be tightly clustered. This was particularly evident for filopodial amoebocytes, where distinct knobs of He185/333-associated fluorescence were observed (Fig. 7A).
Figure 7

Cellular expression of He185/333 proteins.

A–D. Immunofluorescence and differential intereference contrast (DIC) microscopic images of different coelomocyte types expressing He185/333 proteins (red) and actin (green). Nuclear DNA appears in blue. A. A small filopodial amoebocyte expressing He185/333 proteins. He185/333 staining is found on the cell surface and the clustering of He185/333-associated fluorescence in knobs is evident in a filopodium (white arrows). B. A large filopodial amoebocyte expressing He185/333 proteins in dense knobs. He185/333 signals are not uniformly distributed but are found in patches. C. A large filopodial amoebocyte expressing He185/333 within the cell body in perinuclear areas. D. A lamellipodial amoebocyte expressing He185/333 as knobs on the cell surface.

Cellular expression of He185/333 proteins.

A–D. Immunofluorescence and differential intereference contrast (DIC) microscopic images of different coelomocyte types expressing He185/333 proteins (red) and actin (green). Nuclear DNA appears in blue. A. A small filopodial amoebocyte expressing He185/333 proteins. He185/333 staining is found on the cell surface and the clustering of He185/333-associated fluorescence in knobs is evident in a filopodium (white arrows). B. A large filopodial amoebocyte expressing He185/333 proteins in dense knobs. He185/333 signals are not uniformly distributed but are found in patches. C. A large filopodial amoebocyte expressing He185/333 within the cell body in perinuclear areas. D. A lamellipodial amoebocyte expressing He185/333 as knobs on the cell surface.

Discussion

We describe the discovery and characterization of the He185/333 gene family in the sea urchin, Heliocidaris erythrogramma, and present characterization of this gene family in a second group of sea urchins, after its original discovery in S. purpuratus [15], [23]. Sequences that are homologous to Sp185/333 have been identified in other sea urchin genome sequencing projects, including S. franciscanus and A. fragilis (see Ref. [23] and http://www.ncbi.nlm.nih.gov/genome/?term=strongylocentrotus+purpuratus). All evidence to-date indicate that the 185/333 gene families are unique to the sea urchins, as no homologues have been identified in other animal groups.

Similarities between He185/333 and Sp185/333

Our analysis shows that He185/333 sequences bear many similarities to those from S. purpuratus. These include (i) the organization of 185/333 cDNA and gene sequences into elements, (ii) sequence variations due to indels, SNPs and repeats, (iii) structure of 185/333 genes (two exons separated by an intron), (iv) structural features of the predicted 185/333 polypeptides (a hydrophobic leader, a glycine rich and a histidine rich region and several potential N- and O-linked glycosylation sites), (v) a large repertoire of 185/333 polypeptide sizes (from ∼39 kDa to >206 kDa), as well as differences in the repertoires of 185/333 polypeptides between individual animals, (vi) changes in the repertoire of 185/333 polypeptides upon immunological insult or injury, and (vii) cell surface and peri-nuclear expression of 185/333 proteins in amoebocytes. These similarities suggest that He185/333 and Sp185/333 are closely related molecular families that bear substantial structural and functional similarities.

Differences between He185/333 and Sp185/333

Although both Sp185/333 [15], [16], [18] and He185/333 sequences are composed of elements (conserved sequence blocks), the nucleotide sequences of elements, as well as the number of elements in each gene family, are very different. Hence, an independent element pattern system had to be developed for He185/333, which resulted in 29 cDNA element patterns with 31 elements as opposed to 38 patterns with 25 elements in Sp185/333 [16], [17]. Also, although all four repeat types in H. erythrogramma find their homologous counterparts in S. purpuratus, the overall repeat lengths and maximum copy numbers vary between the two species [19]. Phylogenetic analysis shows that despite all similarities, the sequences cluster into two groups that are defined by the species from which they originate. Hence, although there are clear homologies between Sp185/333 and He185/333 the distinct clustering of the two groups suggests independent evolution of the two gene families after the divergence of the host animals. Although extensive divergence is evident within He185/333 sequences and Sp185/333 sequences, there is also a clear distinction between these homologous sequences in the two groups of animals. Hence, although there are clear homologies between Sp185/333 and He185/333 the distinct clustering of the two groups suggests independent evolution of the two gene families after the divergence of the host animals. It is estimated that the Strongylid sea urchins diverged from Heliocidaris approximately 35 MYA [47]. These groups of sea urchins are geographically isolated: H. erythrogramma is predominantly found in the southern hemisphere, while Strongylocentrotus' habitats are located in the northern hemisphere [46]–[47]. Although it is not clear if the differences in their developmental life histories contribute to the differences that exist in the 185/333 homologues from these species (S. purpuratus is an indirect developer, while H. erythrogramma is a direct developer), it is reasonable to speculate that the pathogen pressures that are present in their respective habitats may have driven the evolution of 185/333 sequences in these two groups of sea urchins. Experimentally, this was also evident from the difficulties in our initial attempts to amplify He185/333 sequences in H. erythrogramma based on Sp185/333 sequences. Experimentally, this was also evident from the difficulties in our initial attempts to amplify He185/333 sequences in H. erythrogramma based on Sp185/333 sequences. The analysis of diversity within He185/333 and Sp185/333 cDNA sequences revealed a number of similarities as well as several differences between the two families. In both families, a greater proportion of codons were under negative selection than under positive selection. Negatively-selected codons represent those sites that are invariant and are likely to encode amino acids that mediate critical structural or functional roles [36]. In both families, negatively-selected codons occurred throughout the lengths of the sequences. In He185/333, positively-selected sites are also distributed throughout the sequence, whilst in Sp185/333, the majority of the positively-selected codons are located in the first half of the sequence. The significance of this is not clear. In concurrence with previous studies, our data support the notion that 185/333 polypeptides lack distinct ‘hypervariable’ regions. Our data, the combined result of three separate diversity analyses, indicate that pressure to diversify (positive selection) or conserve (negative selection) is not evident at the level of individual sequence elements (p<0.1). In their paper, Buckley et al. have suggested that RNA editing (deamination) may be a potential source of sequence diversification [21]. While we have not looked for evidence of RNA editing in our study, our demonstration of codon-level selection supports this notion. Taken together, the 185/333 sequences from both S. purpuratus and H. erythrogramma appear to be under positive selection for diversification, although the selective pressures that drive this diversification are not known [15]–[21], [23]. Another, albeit unrelated, gene family in the sea urchins also undergoes positive selection and diversification. The bindin proteins on sea urchin sperm cells are involved in species-specific fertilisation. Molecular analyses indicate that the regions flanking the highly conserved core region of the bindin genes accumulate point mutations and indels. Phylogenetic analysis of the evolutionary rates of the bindin genes from several sea urchin species indicates that Strongylocentrotus and Heliocidaris bindin alleles have undergone rapid evolutionary divergence, compared to the other sea urchins (approximately four times greater in these species, compared to the others) [47]–[48]. It will be interesting to compare the evolutionary diversification rates between 185/333 genes with bindin genes, as well as those of the other immune response gene families. Overall, our data indicated that He185/333 cDNA sequences are less diverse than their Sp185/333 counterparts; however, this may be because the set of unique He185/333 cDNA sequences was smaller than the set of Sp185/333 sequences. The He185/333 cDNA sequences were obtained solely through RT-PCR experiments, implying that biases arising from the use of PCR primers may have reduced our ability to amplify diverse repertoires of He185/333 cDNA sequences. Sp185/333 sequences were initially obtained from screening of cDNA libraries, which enabled primer design for the subsequent production of RT-PCR amplicons that were cloned and sequenced [15]–[17]. While Sp185/333 [18] and He185/333 genes share structural similarities, there are major differences in their intron sequences. Firstly, the conservation of sequences between Sp185/333 and He185/333 introns is low (identity <50%) and BLAST searches using He185/333 intron sequences, as queries do not match to Sp185/333 gene sequences. Secondly, intron-types in He185/333 genes are structurally different from those in Sp185/333 and consist of elements, which enable their classification into intron-element patterns (designated as α, β, γ, and δ). In contrast, S. purpuratus introns (α, β, γ, δ, and ε) are defined by sequence dissimilarities and SNPs as based on phylogenetic analysis because the alignment of the Sp185/333 introns is not improved by the insertion of gaps to identify elements [18]. Last, some He185/333 genes carry unusually long introns of more than 1300 bp. This is approximately 2–3 times the average length of most He185/333 and all Sp185/333 introns and exceeds the combined lengths of He185/333 coding regions of exons 1 and 2 by several hundred base pairs. Introns as large as this have not, as yet, been identified in S. purpuratus. In general, homologous stretches of sequence between Sp185/333 and He185/333 were not well conserved. On average, sequence identity of corresponding sequence stretches was about 70–80%, depending on the length of sequence that was compared. However, there were regions that were highly conserved: the leader sequences (first ∼55 bp of the open reading frame) were relatively well conserved between Sp185/333 and He185/333 (approximately 90% sequence identity at the amino acid level). Some well-conserved blocks of sequence, ranging from 10 to 15 amino acids showed identities of up to 100% between the two species. These sequence blocks often corresponded to regions of repeated sequences. None of the predicted He185/333 polypeptide sequences contain RGD motifs. In Sp185/333 sequences, most of the predicted polypeptides have a single RGD motif [15], [16] but several Sp185/333 sequences that lack this motif have also been identified [17]. RGD motifs serve as binding sites for integrins [44], a family of plasma membrane anchor proteins which interact with cytoskeleton–connecting proteins and are involved in cell adhesion and signal transduction [45]. Assuming that both Sp185/333 and He185/333 subserve the same general immunological functions, it seems unlikely that RGD motifs in 185/333 proteins have fundamental functional significance. Similarly, the fact that cysteine residues are found in He185/333 proteins but are absent in all full-length Sp185/333 proteins (they have been predicted in missense sequences, see Ref. [24]), implies that disulphide-mediated tertiary or quaternary interactions in He185/333, if they do occur at all, may be functionally irrelevant. However, it is possible that such differences represent species-specific adaptations as a consequence of immunological or evolutionary pressures that are specific to each host. Our data indicate that disulphide bonding does not stabilize the high MW forms of He185/333. The presence of high MW He185/333 proteins even in the presence of the strong reducing agent TBP suggests that they are likely to be non-disulphide stabilized, but covalently-linked oligomers. Similar discrepancies in the sizes of recombinantly-expressed Sp185/333 proteins were also identified [22], again suggesting that oligomerization occurs between Sp185/333 proteins. Since other sea urchin proteins were not present in the recombinant expression system, it is plausible that 185/333 proteins self-oligomerize to form higher-order structures. In summary, He185/333 and Sp185/333 are homologous immune gene families that share many common features. They also demonstrate sufficient differences to suggest that the gene families have undergone independent evolution after the divergence of the host species. The data provided in the manuscript will contribute to our understanding of the evolution of this gene family that appears to be unique to the echinoderms. RACE-PCR amplification of sequences. Oligonucleotides are represented as arrows and are labeled A-M. Messenger RNA was reverse transcribed (RT) into double stranded cDNA with addition of oligonucleotide linkers (A, B or C) to the 5′ and 3′ ends. Subsequent PCRs with the cDNA used linker primers (D, B or E) in combination with Sp185/333 specific primers (F, G) to produce partial He185/333 sequences corresponding to 5′ and 3′ ends, including parts of UTRs to which He185/333 specific primers were designed. PCRs using these He185/333 UTR-primers (H-M) resulted in the amplification of full length He185/333 sequences from cDNA and gDNA templates. (TIF) Click here for additional data file. Nucleotide sequence alignment for 112 cDNAs generated in Clustal W and BioEdit. The best alignment was obtained by insertion of large gaps, resulting in 26 sequence blocks (elements). The 26 elements are numbered along the top and separated by vertical black lines. The first and last three nucleotides represent the start and stop codon, respectively. The alignment shows full-length cDNAs irrespective of mutations that lead to missense and early termination upon translation. The cDNAs with such mutations are translated accordingly in Fig. S4. (DOC) Click here for additional data file. Nucleotide sequence alignment for 39 gDNAs generated in Clustal W and BioEdit. The untranslated regions (5′UTR and 3′UTR), leader, 26 exon elements and ten intron elements (with suffix “i”) are labeled along the top and separated by vertical black lines. The start and stop codons are shaded in green and red coloured boxes, respectively and labeled along the top. The exon elements have been numbered according to the categorization system based on the 112 cDNA sequences shown in Fig. S2. The leader, which is identical to the predicted signal sequence, counts 63 nucleotides but is separated by the intron between nucleotide positions 55 and 56. (DOC) Click here for additional data file. Alignment of 112 deduced He185/333 polypeptides generated in Clustal W and BioEdit. The polypeptide sequences were deduced from the cDNA sequences shown in Fig. S2. The 26 elements are numbered along the top and separated by vertical black lines. Four types of repeats with tandem or interspersed-incomplete structures are highlighted in differently coloured boxes and labeled along the top. Also indicated along the top are glycine- and histidine-rich regions (orange and magenta arrows, respectively), predicted O-linked and N-linked glycosylation sites (red and blue triangles, respectively), as well as predicted serine, threonine and tyrosine phosphorylations (red, blue and green lightning bolts, respectively). (DOC) Click here for additional data file. Repeats found in 104 translated cDNA sequences, presented as sequence logos and linear sequences. The figure shows repeat types and maximum copy number (left column), as well as sequence variations within repeats (central column) and the structure of each repeat type (right column). For example, there are up to three copies of the type 1 repeat (1.1, 1.2 and 1.3) in He185/333 deduced polypeptides. Sequence variations within repeats are depicted as sequence logos and as plain text. Sequence logos were generated using the software, Geneious (Geneious v5.4, http://www.geneious.com). The size of each letter within the sequence logos is proportional to the frequency of that residue at the specific position in the He185/333 alignment. For example, the first position of repeat 1.1 is G (glycine), with a value of 1, because it is invariant at that position amongst the 104 He185/333 sequences. In the plain text below the logos variant amino acids at specific positions are indicated in brackets. (DOCX) Click here for additional data file. Comparison of the four types of repeats from translated sequences with five repeat types (15). The number of copies of each type of repeat varies between the two species and among sequences within one species. For example, type 1 repeat is present as two complete tandem repeats and one interspersed incomplete repeat in H. erythrogramma but as up to four tandem repeats in S. purpuratus. In He185/333, type 3 repeat appears as four tandem copies and is homologous to a portion of Sp185/333 type 5 repeat. Repeat type 5 is present up to three times in Sp185/333. Similarly, the last four residues of S. purpuratus repeat type 4 (GDQD) are not part of the homologous repeat sequence in He185/333. Most, but not all, He185/333 repeats had homologues amongst Sp185/333 sequences, as some repeats were unique to each species. For example, although the type 4 repeat sequence in He185/333 was homologous to a sequence stretch in Sp185/333, the latter was not repeated in Sp185/333. Finally, repeat type 2 of H. erythrogramma is present up to five times (four complete in tandem plus one incomplete repeats). The homologous sequences in Sp185/333 are composed of types 2, 3 and 4. (DOCX) Click here for additional data file. Genbank accession numbers of He185/333 and n class="Gene">Sp185/333 sequences. (DOC) Click here for additional data file. Tamura-Nei genetic distance matrix of phylogenetic comparison between 25 He185/333 and 25 Sp185/333 cDNA sequences. The rates are assumed to follow gamma distribution with shape parameter  = 0.8094. The distances in light and dark gray shadings represent intra-species comparisons, while those without background shading represent comparisons between He185/333 and Sp185/333 sequences. (XLSX) Click here for additional data file. Summary of diversity analysis carried out on He185/333 and Sp185/333 sequences. Only those codons (codon#) that are positively or negatively selected are indicated in this table. The diversity analysis was carried out using three separate algorithms (SLAC, FEL and iFEL) and the table indicates whether codons are positively (+) or negatively (−) selected according to each of the algorithms. Codons are considered to be under selection (+ or −) if two or more of the analytical algorithms indicate significant selection pressure (columns entitled ‘consensus’). Blank columns specify codons that are not considered to be under significant selection by an algorithm. (DOC) Click here for additional data file.
  43 in total

1.  Predicting transmembrane protein topology with a hidden Markov model: application to complete genomes.

Authors:  A Krogh; B Larsson; G von Heijne; E L Sonnhammer
Journal:  J Mol Biol       Date:  2001-01-19       Impact factor: 5.469

2.  Sequence and structure-based prediction of eukaryotic protein phosphorylation sites.

Authors:  N Blom; S Gammeltoft; S Brunak
Journal:  J Mol Biol       Date:  1999-12-17       Impact factor: 5.469

3.  Datamonkey 2010: a suite of phylogenetic analysis tools for evolutionary biology.

Authors:  Wayne Delport; Art F Y Poon; Simon D W Frost; Sergei L Kosakovsky Pond
Journal:  Bioinformatics       Date:  2010-07-29       Impact factor: 6.937

Review 4.  Genomic insights into the immune system of the sea urchin.

Authors:  Jonathan P Rast; L Courtney Smith; Mariano Loza-Coll; Taku Hibino; Gary W Litman
Journal:  Science       Date:  2006-11-10       Impact factor: 47.728

5.  Phagocytosis mediates specificity in the immune defence of an invertebrate, the woodlouse Porcellio scaber (Crustacea: Isopoda).

Authors:  Olivia Roth; Joachim Kurtz
Journal:  Dev Comp Immunol       Date:  2009-05-18       Impact factor: 3.636

6.  Ultrastructural localization of highly variable 185/333 immune response proteins in the coelomocytes of the sea urchin, Heliocidaris erythrogramma.

Authors:  Nolwenn M Dheilly; Debra Birch; Sham V Nair; David A Raftos
Journal:  Immunol Cell Biol       Date:  2011-05-17       Impact factor: 5.126

7.  Unexpected diversity displayed in cDNAs expressed by the immune cells of the purple sea urchin, Strongylocentrotus purpuratus.

Authors:  David P Terwilliger; Katherine M Buckley; Dhruti Mehta; Priya G Moorjani; L Courtney Smith
Journal:  Physiol Genomics       Date:  2006-07-12       Impact factor: 3.107

8.  AgDscam, a hypervariable immunoglobulin domain-containing receptor of the Anopheles gambiae innate immune system.

Authors:  Yuemei Dong; Harry E Taylor; George Dimopoulos
Journal:  PLoS Biol       Date:  2006-07       Impact factor: 8.029

9.  Glycosylation site prediction using ensembles of Support Vector Machine classifiers.

Authors:  Cornelia Caragea; Jivko Sinapov; Adrian Silvescu; Drena Dobbs; Vasant Honavar
Journal:  BMC Bioinformatics       Date:  2007-11-09       Impact factor: 3.169

10.  PredGPI: a GPI-anchor predictor.

Authors:  Andrea Pierleoni; Pier Luigi Martelli; Rita Casadio
Journal:  BMC Bioinformatics       Date:  2008-09-23       Impact factor: 3.169

View more
  6 in total

1.  The Recombinant Sea Urchin Immune Effector Protein, rSpTransformer-E1, Binds to Phosphatidic Acid and Deforms Membranes.

Authors:  Cheng Man Lun; Robin L Samuel; Susan D Gillmor; Anthony Boyd; L Courtney Smith
Journal:  Front Immunol       Date:  2017-05-12       Impact factor: 7.561

Review 2.  The SpTransformer Gene Family (Formerly Sp185/333) in the Purple Sea Urchin and the Functional Diversity of the Anti-Pathogen rSpTransformer-E1 Protein.

Authors:  L Courtney Smith; Cheng Man Lun
Journal:  Front Immunol       Date:  2017-06-30       Impact factor: 7.561

3.  SpTransformer proteins from the purple sea urchin opsonize bacteria, augment phagocytosis, and retard bacterial growth.

Authors:  Hung-Yen Chou; Cheng Man Lun; L Courtney Smith
Journal:  PLoS One       Date:  2018-05-08       Impact factor: 3.240

4.  Individual Sea Urchin Coelomocytes Undergo Somatic Immune Gene Diversification.

Authors:  Matan Oren; Benyamin Rosental; Teresa S Hawley; Gi-Young Kim; Jacob Agronin; Caroline R Reynolds; Leon Grayfer; L Courtney Smith
Journal:  Front Immunol       Date:  2019-06-06       Impact factor: 7.561

5.  Sequence Diversity, Locus Structure, and Evolutionary History of the SpTransformer Genes in the Sea Urchin Genome.

Authors:  Megan A Barela Hudgell; L Courtney Smith
Journal:  Front Immunol       Date:  2021-11-15       Impact factor: 7.561

6.  Short tandem repeats, segmental duplications, gene deletion, and genomic instability in a rapidly diversified immune gene family.

Authors:  Matan Oren; Megan A Barela Hudgell; Brian D'Allura; Jacob Agronin; Alexandra Gross; Daniele Podini; L Courtney Smith
Journal:  BMC Genomics       Date:  2016-11-09       Impact factor: 3.969

  6 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.